ID: 945565992

View in Genome Browser
Species Human (GRCh38)
Location 2:211400199-211400221
Sequence GGGGATAATAATGCCTGTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 178}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945565984_945565992 29 Left 945565984 2:211400147-211400169 CCCGCTGCCTTAAAAAAGTGTTC 0: 1
1: 0
2: 1
3: 14
4: 144
Right 945565992 2:211400199-211400221 GGGGATAATAATGCCTGTGTTGG 0: 1
1: 0
2: 1
3: 22
4: 178
945565985_945565992 28 Left 945565985 2:211400148-211400170 CCGCTGCCTTAAAAAAGTGTTCT 0: 1
1: 0
2: 2
3: 19
4: 277
Right 945565992 2:211400199-211400221 GGGGATAATAATGCCTGTGTTGG 0: 1
1: 0
2: 1
3: 22
4: 178
945565986_945565992 22 Left 945565986 2:211400154-211400176 CCTTAAAAAAGTGTTCTCTAAGC 0: 1
1: 1
2: 1
3: 21
4: 176
Right 945565992 2:211400199-211400221 GGGGATAATAATGCCTGTGTTGG 0: 1
1: 0
2: 1
3: 22
4: 178
945565983_945565992 30 Left 945565983 2:211400146-211400168 CCCCGCTGCCTTAAAAAAGTGTT 0: 1
1: 0
2: 1
3: 10
4: 133
Right 945565992 2:211400199-211400221 GGGGATAATAATGCCTGTGTTGG 0: 1
1: 0
2: 1
3: 22
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945565992 Original CRISPR GGGGATAATAATGCCTGTGT TGG Intronic
901380923 1:8873652-8873674 GGGCAAAAGAATGCCTGAGTTGG - Intronic
904303372 1:29570701-29570723 GGGGACTAGATTGCCTGTGTAGG - Intergenic
904427131 1:30435764-30435786 TGGGACAATTATTCCTGTGTGGG + Intergenic
904554988 1:31355454-31355476 TGGGATAATAATTCCTGTTCTGG - Intronic
905507005 1:38487937-38487959 AGGGTCAATAATTCCTGTGTGGG - Intergenic
905721054 1:40202064-40202086 GGGGATAATAATACTTGCCTTGG + Intronic
906677792 1:47705774-47705796 GGGGAAAAAATTGCCTGTGTTGG - Intergenic
908261633 1:62343704-62343726 GAGTATAAAAATGCCTGTCTTGG - Intergenic
908519195 1:64924992-64925014 GGTGATAATGATGTCAGTGTAGG + Intronic
909091336 1:71229431-71229453 GGGCAGAACAATGCCTGGGTGGG + Intergenic
909120236 1:71594100-71594122 GGGCTTACTAATGCCTATGTTGG - Intronic
909412233 1:75367850-75367872 TGGGAAAAAAATGCCTTTGTGGG - Intronic
909879166 1:80850773-80850795 GAGGAAAATAACTCCTGTGTTGG - Intergenic
910316625 1:85891986-85892008 GAGGATAATAATGACTATTTTGG + Intronic
912974499 1:114315647-114315669 GGGGATAATAATGCTTTTCTAGG - Intergenic
914926689 1:151894782-151894804 GGTGATAAGAATGCCAGGGTGGG + Intronic
915943123 1:160131503-160131525 AGGGATAATGATGCCTGCCTCGG - Intronic
919565381 1:199178926-199178948 GGGCATAATAATGCTTCTGTTGG - Intergenic
920225213 1:204433611-204433633 GAGGACAATGATGTCTGTGTAGG - Intronic
920312287 1:205055673-205055695 GGGGTTAAGAATGCTTGTGGTGG + Intronic
921278093 1:213538947-213538969 GGGGATAATAATATCTGTCCTGG - Intergenic
921546791 1:216483050-216483072 GAGGATATTGATGCTTGTGTGGG - Intergenic
921569224 1:216758928-216758950 GGGGATAATAATACCTTCTTAGG - Intronic
923892485 1:238231488-238231510 AGGGACAATAATGCATTTGTGGG - Intergenic
1065150148 10:22814169-22814191 GGAGATCATACTGCATGTGTTGG + Intergenic
1067519191 10:46982838-46982860 GGTGATAACAATGGCTTTGTAGG - Intronic
1070262907 10:74874942-74874964 GGGGAAAATTGTGCATGTGTAGG - Intronic
1072329957 10:94337859-94337881 TGGGATGATAATGCCTCTGAAGG + Exonic
1073759086 10:106611354-106611376 GTGGATAATAATTCCTTTTTGGG + Intronic
1073768342 10:106707819-106707841 GGGGTTAAGAGTGGCTGTGTAGG - Intronic
1075328661 10:121555903-121555925 GGGAATAATAAAGGCTGTGTTGG - Intronic
1080381978 11:31781427-31781449 GGGGTTACAAATGTCTGTGTAGG - Intronic
1080929961 11:36799670-36799692 GGGGATGAGAAAGGCTGTGTGGG + Intergenic
1081260682 11:40956537-40956559 GGGGATAATATTACCTTTCTAGG + Intronic
1082913362 11:58402744-58402766 GGTGATAAAAATGAATGTGTAGG + Exonic
1083828988 11:65219105-65219127 GGGGATAAGAATGGCCGGGTTGG + Intergenic
1085735244 11:79033067-79033089 GGGGATAAAAATGCCTTAGAGGG - Intronic
1086591239 11:88516529-88516551 TGGGAAAATAATTCCTGTTTAGG + Intronic
1087187190 11:95212794-95212816 GGGAATAATAATGTGTGTGTAGG - Intronic
1087870564 11:103288502-103288524 GGGGATAAGTCTGCCTTTGTAGG + Intronic
1089986449 11:122818652-122818674 GGGGACTATACTGCCTTTGTAGG + Intergenic
1091947062 12:4556105-4556127 GGGGATAGTAATATCTGTATTGG + Intronic
1093194088 12:16109709-16109731 GGGGATATAAATGGGTGTGTAGG + Intergenic
1093357966 12:18192864-18192886 GGAGAATATTATGCCTGTGTTGG - Intronic
1093656371 12:21699142-21699164 GGGGATAATAACGCCTATATGGG + Intronic
1094430990 12:30368947-30368969 GGGGATTAGATTGCCTTTGTAGG - Intergenic
1095267724 12:40179992-40180014 GGGGATTAGATTGCCTTTGTAGG + Intergenic
1095407364 12:41881565-41881587 GGAGATAATAATACCTGCCTTGG - Intergenic
1096649850 12:53056988-53057010 GGGGATAGCAAGGCCAGTGTTGG - Intronic
1103049264 12:117765474-117765496 GGGAATAATTATGGCTTTGTTGG + Intronic
1103381533 12:120497314-120497336 GGGGAGTAGAATGCCTGTGGGGG - Intronic
1106893559 13:34272875-34272897 GGGGATAACAAGTCCTGTATGGG + Intergenic
1108555617 13:51588873-51588895 CTGGATAAAAAGGCCTGTGTTGG + Intronic
1108597906 13:51965366-51965388 CGGGATACTAATGCCTGTACGGG + Intronic
1112492526 13:99880401-99880423 GGGGATAATATCGCCCCTGTAGG - Intronic
1115086126 14:29517020-29517042 TGGGATAACATTGCCTGTTTTGG - Intergenic
1115641618 14:35339008-35339030 GGGTACAATGAGGCCTGTGTCGG - Intergenic
1115776640 14:36722508-36722530 GGGGAAGATGATGCATGTGTCGG + Intronic
1117456663 14:55904564-55904586 GTGGATAATAATGGCTCTGCAGG + Intergenic
1119381155 14:74229561-74229583 GGGGATAGTGATGCCTGTCCTGG - Intergenic
1120297098 14:82655792-82655814 GGAGATAATAATGCCAGACTCGG + Intergenic
1120628126 14:86854849-86854871 GGAGATAATGATGCCTCTCTTGG - Intergenic
1120970617 14:90204105-90204127 GGGGATTAGATTGCCTTTGTAGG - Intergenic
1121582700 14:95042882-95042904 GGAGATAATTAGGCCTGTGGGGG + Intergenic
1125514603 15:40310792-40310814 GGGGATAATAATGCCTCATGGGG + Intergenic
1127086151 15:55426333-55426355 GGGGATTAGACTGCCTTTGTAGG - Intronic
1129078976 15:73023055-73023077 GGTGGTAATGATGCCTGTGATGG + Intergenic
1129677825 15:77642003-77642025 GGGGATACTCATGCCTATCTTGG + Intronic
1130833890 15:87630661-87630683 GGGGACAAGATTGCCTTTGTAGG + Intergenic
1131500943 15:92965635-92965657 GTGGCTAACAATGACTGTGTGGG - Intronic
1133534945 16:6692962-6692984 GGTGATAATGATGCCGGTGATGG - Intronic
1134301987 16:13000257-13000279 TGGGATAACAAAGCCTGAGTTGG + Intronic
1137779093 16:51081965-51081987 GGAGAAAATACTACCTGTGTAGG + Intergenic
1138889544 16:61125973-61125995 GGTGATAATAATGTCAATGTAGG - Intergenic
1139215799 16:65123191-65123213 GGGAACAACCATGCCTGTGTGGG + Intronic
1142495471 17:304280-304302 GGGAATAATAATACCTATCTCGG - Intronic
1143865715 17:9921657-9921679 TGGGACAAGAATGCCTTTGTTGG + Intronic
1146322883 17:31860059-31860081 GGGGATACTGACTCCTGTGTAGG - Intergenic
1146581827 17:34045224-34045246 GGGAATATTACTACCTGTGTTGG - Intronic
1146591569 17:34132059-34132081 GAGGATCATAATGCCTCTGCAGG + Intronic
1149725049 17:58884751-58884773 GGGGATAATACTTCCTTTGTAGG + Intronic
1149953627 17:61020394-61020416 GGAGGTAATAAGGCCTGTTTTGG + Intronic
1152799375 17:82323798-82323820 GGTGGTGATCATGCCTGTGTCGG + Intronic
1153177370 18:2392688-2392710 GGGGATTATAATTCTGGTGTTGG - Intergenic
1155715075 18:28932343-28932365 GGTGTTAATAATACCAGTGTGGG + Intergenic
1156505865 18:37591677-37591699 GGGGATTCTAATGGATGTGTGGG + Intergenic
1156903344 18:42326650-42326672 GGGGACTATACTGCCTTTGTAGG - Intergenic
1156964489 18:43074003-43074025 GGGGATCATAATGTATGTGAAGG + Intronic
1157363479 18:47041192-47041214 GTTGATAATCATGCCAGTGTAGG - Intronic
1157709761 18:49842327-49842349 GTGGATAAAATTGCCTGTGGAGG + Intronic
1166497980 19:43318567-43318589 GGGGACAAGACTGCCTTTGTGGG - Intergenic
1168155997 19:54473171-54473193 GGGGATAAGAAAGCCTGGGAGGG - Exonic
926654196 2:15382364-15382386 TGATATAATAATGCCTGTCTAGG + Intronic
926664217 2:15502219-15502241 AGGCATCATAATGCCAGTGTAGG + Intronic
927929783 2:27036712-27036734 GGGGATCATGCTGCCTGTGCTGG + Exonic
928200264 2:29243379-29243401 GGGGATAATAATACCTACCTTGG + Intronic
933384180 2:81589252-81589274 GGGGATAATGATACCTTTGTGGG + Intergenic
934790744 2:97058106-97058128 AGGGATAATGATGCCTATGCAGG + Intergenic
934815710 2:97324424-97324446 AGGGATAATGATGCCTATGCAGG - Intergenic
934821985 2:97384059-97384081 AGGGATAATGATGCCTATGCAGG + Intergenic
935715251 2:105933704-105933726 GGGGACATTAATGACTTTGTTGG - Intergenic
936090070 2:109495835-109495857 GGGGATAATAATACATGTCTGGG + Intronic
936791619 2:116159403-116159425 GGGAATATTGATGCTTGTGTGGG + Intergenic
937492844 2:122387956-122387978 GGGGACTATAATGCCTCTGTAGG + Intergenic
940612859 2:156011946-156011968 GGGGACTAGAATGCCTTTGTAGG - Intergenic
941178106 2:162225092-162225114 AGGAATAATAATGCCTCTTTTGG - Intronic
942561045 2:177218983-177219005 GGGGAAAATGATGATTGTGTAGG + Intronic
942931190 2:181494791-181494813 GCAGATAATAATGGCTATGTAGG + Exonic
943424013 2:187706620-187706642 GGGGATCATCATGTTTGTGTGGG + Intergenic
943424313 2:187710872-187710894 GGGGATCATCATGTTTGTGTGGG + Intergenic
944752633 2:202726732-202726754 GGGAATAATAATACCTGTCTCGG + Intronic
945565992 2:211400199-211400221 GGGGATAATAATGCCTGTGTTGG + Intronic
947014238 2:225600433-225600455 GGGGATTAGACTGCCTTTGTAGG - Intronic
1169635187 20:7682881-7682903 GGGGACTAGAATGCCTATGTGGG + Intergenic
1172633669 20:36394924-36394946 GGGGATAAAAATGCCTCACTGGG + Intronic
1173024789 20:39298007-39298029 GGGGTTATTAATGCTTGAGTGGG + Intergenic
1173460905 20:43242756-43242778 GGGGATCATAATGCCTCCCTGGG + Intergenic
1175360721 20:58410135-58410157 GGGGGTTATGATGCATGTGTGGG - Intronic
1177420605 21:20852041-20852063 GGGGACAAGACTGCCTTTGTAGG - Intergenic
1181365353 22:22372328-22372350 GTGGATAAAAATGCCTGGGAGGG - Intergenic
1181742294 22:24931025-24931047 GGAGATAATAATGCCTCCTTTGG + Intergenic
1182768904 22:32779579-32779601 GGGAATAATAATGCCCGCTTCGG - Intronic
1183214759 22:36472440-36472462 GGGGATAATGATGTCCGTGTAGG + Intronic
1184632144 22:45790203-45790225 GGGGCTCTTAATGCCTGTATAGG + Intronic
949481063 3:4493992-4494014 TGGGAGAATAATGCATGTGTAGG + Intronic
950243127 3:11389560-11389582 CGGGAAAATACCGCCTGTGTGGG + Intronic
952002558 3:28803272-28803294 GGGCATAATAATGCCTTTGGAGG - Intergenic
952635032 3:35518860-35518882 GGTGATAATGATGTCAGTGTAGG - Intergenic
953339885 3:42124555-42124577 GTGCATACTAATGCCTGTGACGG - Intronic
953719506 3:45343239-45343261 GGGGATAATTCTTCCTGGGTTGG + Intergenic
959161941 3:102734556-102734578 GGGGATTAGACTGCCTTTGTAGG + Intergenic
961944297 3:130670457-130670479 TGGGATAATAAAGCACGTGTTGG + Intronic
964365587 3:155947761-155947783 AGGAATAATACTGCCTCTGTGGG + Intergenic
964557167 3:157952385-157952407 GGTAATAATAATGCCATTGTGGG + Intergenic
966390022 3:179442540-179442562 AGAGATAATAATGCTTGAGTGGG - Intronic
966757393 3:183384334-183384356 GGGGATTAGATTGCCTTTGTAGG + Intronic
971441089 4:26686678-26686700 GGGGATACTATTGCCTCTGTGGG - Intronic
972743778 4:41913484-41913506 GGGGACAAGAATGCCTTTGTAGG + Intergenic
974070406 4:57118285-57118307 GGTGGCAATGATGCCTGTGTAGG + Intergenic
974071719 4:57130037-57130059 GAGGAGGCTAATGCCTGTGTGGG - Intergenic
976603081 4:86957193-86957215 GGGGATAACATTGTCTTTGTAGG + Intronic
976608296 4:87003008-87003030 GGAAATAATAATGCCCATGTTGG + Intronic
987217639 5:15754124-15754146 GGTGATAATGATGCTGGTGTGGG + Intronic
988619089 5:32804159-32804181 GAGGATAATAACTCCTTTGTAGG + Intergenic
989690716 5:44140494-44140516 CAGGATAATAATGGCTTTGTAGG + Intergenic
991426011 5:66492455-66492477 GGGGATTAGACTGCCTTTGTAGG - Intergenic
995200947 5:109424753-109424775 GGGGATGAGACTGCCTTTGTAGG + Intergenic
996381296 5:122864848-122864870 GGGGACTATACTGCCTTTGTAGG - Intronic
996844370 5:127883219-127883241 TGGGATAATGATTCCTGTGGGGG - Intergenic
996877989 5:128261046-128261068 GGGAATAATAATACCTCTGAAGG - Intronic
997218127 5:132131716-132131738 GGGGATGTTTATGCATGTGTAGG - Intergenic
999712326 5:154329604-154329626 GGGGATGATGATGCTTGTGTTGG - Exonic
1001675377 5:173507852-173507874 GGGGAGGGTAATGCCTGGGTAGG - Intergenic
1003817411 6:9857598-9857620 TGGCATAATAAAGCCTGTGGAGG - Intronic
1004773704 6:18817745-18817767 GTGGATAATCATGCCTGTTAGGG + Intergenic
1008053955 6:46927483-46927505 GGGGATGGGAATGCATGTGTTGG - Intronic
1010653803 6:78487717-78487739 AGAGACAATAATGTCTGTGTCGG - Intergenic
1011653745 6:89531014-89531036 GGGGATAATAATGCCTGCCTCGG - Intronic
1013028797 6:106309621-106309643 GGCGATAATACTTCCTGTGGGGG - Intronic
1013238089 6:108216400-108216422 GGGGATAAAACTGCCTTTGGTGG + Intronic
1016749310 6:147614684-147614706 GGGGATAGTATTGCCTGGGAAGG + Intronic
1017269079 6:152485207-152485229 CAGAATAATAATGCATGTGTAGG - Intronic
1017453626 6:154577717-154577739 GGGGATAATAATGCCTGCTCTGG + Intergenic
1018055323 6:160047368-160047390 GAGGATACTCATGCCTGTGGTGG + Intronic
1019784220 7:2964014-2964036 GGGGATGATGATGGCTGGGTTGG + Intronic
1020628021 7:10607018-10607040 GGGGATAAAGATGGCTGTGAGGG - Intergenic
1022734202 7:33061168-33061190 AAGGTTAATAATGCCTATGTAGG - Intronic
1023970769 7:44989157-44989179 GGGGACCAGAATGCCTTTGTAGG - Intergenic
1026084191 7:67249351-67249373 GGGGACTAGAATGCCTTTGTAGG - Intergenic
1026692895 7:72564994-72565016 GGGGACTAGAATGCCTTTGTAGG + Intronic
1030439588 7:109571102-109571124 AGGACTAATAATTCCTGTGTGGG + Intergenic
1030914655 7:115297462-115297484 AGCTATACTAATGCCTGTGTGGG + Intergenic
1033627557 7:143125405-143125427 GGGGACAAGATTGCCTTTGTAGG + Intergenic
1037106943 8:15120356-15120378 GGGGAAAATACTACCTGTATAGG - Intronic
1037446873 8:18974187-18974209 GGGCATAATAATGCCTACCTTGG - Intronic
1038026594 8:23596445-23596467 GGGGATATTAATGCTTCTATGGG + Intergenic
1039572240 8:38596548-38596570 GGGGATAAAAATGCTGATGTAGG + Intergenic
1043432600 8:80209350-80209372 GGGTATAACAATGCCTGTGATGG - Intronic
1045273092 8:100678601-100678623 GGGGATAATCATGCCCTTGTGGG - Intergenic
1045991847 8:108316947-108316969 GGGGATTAGATTGCCTTTGTAGG + Intronic
1046405217 8:113764067-113764089 GGGGAAAATAATGCCTGCAAAGG - Intergenic
1050069136 9:1792037-1792059 AGGGATAATAGTACTTGTGTAGG - Intergenic
1050324904 9:4489881-4489903 GAGGAGAATAATCCCTGTGGGGG + Intergenic
1051380283 9:16451132-16451154 GGGGAAAATAATGTGTGTTTAGG + Intronic
1051988834 9:23125928-23125950 GGTGATAATAATGTCAGTGTAGG - Intergenic
1056804353 9:89717307-89717329 GTGTATAATTATGCATGTGTGGG - Intergenic
1060159042 9:121343364-121343386 AGGGTTAATAAGCCCTGTGTAGG + Intronic
1061560049 9:131396095-131396117 GGGAATAATTATGCCTGCCTTGG + Intronic
1061895377 9:133644209-133644231 GGGTAGTAAAATGCCTGTGTGGG - Exonic
1062460190 9:136659726-136659748 GGGGAAACTGAGGCCTGTGTGGG + Intronic
1190083886 X:47378458-47378480 GGGGATTAGACTGCCTTTGTAGG - Intronic
1190365050 X:49684855-49684877 GGGGAGAATTGTGCATGTGTTGG - Intergenic
1190477558 X:50842901-50842923 GGGGATTAGACTGCCTTTGTAGG - Intergenic
1192172077 X:68862199-68862221 GGGGATAATAAGGCCTGAGAAGG + Intergenic
1193257360 X:79366442-79366464 GTGGATCTTAATGCCAGTGTTGG - Intronic
1196120648 X:112046753-112046775 GTGAATAATAATAACTGTGTAGG + Intronic
1196201989 X:112897007-112897029 AGGTATAATAATGCCTATCTCGG + Intergenic
1196287520 X:113899608-113899630 GGGGACCATACTGCCTTTGTAGG + Intergenic
1196627150 X:117889514-117889536 GGAGATGATAATGGCTGTTTGGG + Intergenic
1199289256 X:146088091-146088113 GCTGATAATTATGCTTGTGTAGG - Intergenic
1199764626 X:150932042-150932064 GTGGTTAAAAATCCCTGTGTTGG + Intergenic
1200737116 Y:6811948-6811970 GAAGATAATAAGCCCTGTGTTGG + Intergenic