ID: 945567281

View in Genome Browser
Species Human (GRCh38)
Location 2:211416451-211416473
Sequence CTGAATATACAAAGGGACAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 545
Summary {0: 3, 1: 16, 2: 56, 3: 101, 4: 369}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945567277_945567281 3 Left 945567277 2:211416425-211416447 CCGCAATGGAAACTAAATCCAAT 0: 1
1: 0
2: 3
3: 24
4: 199
Right 945567281 2:211416451-211416473 CTGAATATACAAAGGGACAATGG 0: 3
1: 16
2: 56
3: 101
4: 369

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945567281 Original CRISPR CTGAATATACAAAGGGACAA TGG Intronic
900879475 1:5370364-5370386 CTGAATATGCAAACAAACAATGG + Intergenic
902327998 1:15715200-15715222 CTGCATATACTAAGGGCCGATGG - Intronic
902794479 1:18792285-18792307 CTGAATATACAAATGGACAATGG + Intergenic
903375536 1:22863439-22863461 CTGGATTCACAAAGGGACAGGGG + Intronic
904346518 1:29875543-29875565 CTGAATATACAAATGGACAATGG + Intergenic
905117604 1:35655854-35655876 ATGAATATACAAAGGGATATGGG + Intergenic
905499174 1:38422549-38422571 AGGAATATACAAATGAACAATGG - Intergenic
906172000 1:43734133-43734155 CTGAGTAAATAAAGAGACAAAGG - Intronic
906337819 1:44949404-44949426 CTGAATATACAAAGATAAAAGGG - Intronic
906508780 1:46399097-46399119 CTGCATGTACAAAGGCATAAGGG - Intronic
907015401 1:51007228-51007250 CTAAATATAGAAAGGAAAAATGG + Intergenic
907040953 1:51258904-51258926 CTAAATATACAAAGGCCCAGTGG - Intronic
907346658 1:53787346-53787368 CTGAATATAAAAAGAAATAAAGG + Intronic
908244285 1:62215393-62215415 CTCAATATACAAACATACAATGG - Intergenic
908679766 1:66647751-66647773 CTGCATAAACAGAGGGACACTGG - Intronic
909021994 1:70441711-70441733 CTGAATATAGAAATGGACAGTGG - Intergenic
909491249 1:76229054-76229076 CTGATTATATGAATGGACAATGG + Intronic
909584971 1:77279927-77279949 CCAAATAAACAAAGGGCCAAGGG + Intergenic
909690344 1:78399518-78399540 CTAAATATCCAAGGGGACTAGGG - Intronic
910372861 1:86536664-86536686 ATTAATATACTAATGGACAAAGG - Intergenic
910474759 1:87595205-87595227 CTGAAAATACGAAGGGACTTAGG + Intergenic
911476272 1:98377284-98377306 CTGCAGATACTGAGGGACAATGG - Intergenic
911951457 1:104178095-104178117 CTGAATATTCACAAGAACAATGG - Intergenic
912269011 1:108190558-108190580 CTAAATATACGAAGAGATAATGG - Intronic
912321633 1:108719363-108719385 CTGAACCCAGAAAGGGACAAGGG - Intronic
912591599 1:110826297-110826319 CTCAATTTACAAATGGGCAAGGG + Intergenic
912656863 1:111494002-111494024 CTGAATATACAAGTGGACTATGG + Intronic
913119990 1:115731091-115731113 CAGAATATTTAAAGAGACAAAGG - Intronic
913665922 1:121048845-121048867 CAGAATATACAATCGAACAATGG + Intergenic
914017320 1:143832121-143832143 CAGAATATACAATCGAACAATGG + Intergenic
914655931 1:149740653-149740675 CAGAATATACAATCGAACAATGG + Intergenic
914750393 1:150531162-150531184 CTGATTATACAAATGAACAATGG + Intergenic
915864561 1:159485284-159485306 GTGATTATAAAAAGGGACCATGG + Intergenic
915921742 1:159980968-159980990 CTGCATACACTAAGGGACCAGGG + Intergenic
916585539 1:166146644-166146666 GCGAATATACAATGGGTCAAGGG + Intronic
916601736 1:166299709-166299731 ATGAATATTCAAAGGAATAAGGG + Intergenic
917078768 1:171235311-171235333 CTGAATATACAAAGGGCCACAGG - Intergenic
917636305 1:176940156-176940178 CTGAATATACAAATGGACAATGG + Intronic
918306183 1:183249190-183249212 TTGAATGTACATAGGAACAAGGG - Exonic
918366169 1:183810141-183810163 ATGAATACTCAAAGGGACAGAGG + Intronic
918657235 1:187043308-187043330 CTGAATATATAAATGGACAATGG + Intergenic
919102214 1:193108744-193108766 CTGAATATATAAATGGATAATGG - Intergenic
919126061 1:193395304-193395326 CTGAATATGGAAACAGACAATGG + Intergenic
919518227 1:198554128-198554150 CAGAATTTACAAAGGAACTAAGG - Intergenic
919761465 1:201100647-201100669 CTGACTAGACAGAGGGACAATGG + Intronic
920069876 1:203295174-203295196 TTGAAACTACAAAGGCACAATGG + Intergenic
920552240 1:206872294-206872316 CTGAATATACAAACAGACAGTGG + Intergenic
921371820 1:214431474-214431496 CTGAACATACAAAGAGTGAATGG + Intronic
921975864 1:221202430-221202452 CTAAAAATACAAAGGTATAAAGG - Intergenic
922369836 1:224898273-224898295 CTGAATAGACAAATGGACAATGG - Intronic
924049035 1:240061787-240061809 CAGAATAAACAAACAGACAATGG + Intronic
924272033 1:242343919-242343941 CTGAATAAACAAATGGACAATGG + Intronic
924700618 1:246448474-246448496 CTAAATAAACAAATGGTCAAAGG + Intronic
1063882234 10:10542942-10542964 CTGAAAATACAGACTGACAATGG - Intergenic
1065047853 10:21759862-21759884 CAGAGTAGAGAAAGGGACAAAGG - Intronic
1065743515 10:28817906-28817928 CTGAAATTAAAAAGGGAGAAGGG - Intergenic
1066076318 10:31881197-31881219 CAGAATATTAAAAGTGACAAAGG + Intronic
1066712636 10:38252211-38252233 CTGAATAAACAAATGGACAATGG - Intergenic
1066785529 10:39000033-39000055 GAGAATATACAAAGGGACATTGG - Intergenic
1067071230 10:43133729-43133751 CTGAACATGCAAACAGACAATGG - Intergenic
1067185246 10:44021642-44021664 ATGAATTTAGAAAGGGACAGAGG - Intergenic
1067709803 10:48638775-48638797 CTTAATGAACAAAGGGATAATGG + Intronic
1068675170 10:59763040-59763062 CTGAATATACAAACAGACAGTGG - Intergenic
1069119239 10:64548160-64548182 ATGAAAATACCAAGGGAGAAGGG - Intergenic
1069144727 10:64876600-64876622 CTGAATATACAAATGGGCAATGG + Intergenic
1069357579 10:67605176-67605198 CTATATATACAAAGGAAAAAAGG + Intronic
1070612021 10:77939899-77939921 CTGAACATACAAATGGGCAATGG + Intergenic
1071352077 10:84756690-84756712 TTGAATATATAAATAGACAAGGG + Intergenic
1072086326 10:92082960-92082982 CAGAATGTACAAAGGGTGAAGGG + Intronic
1073479584 10:103778026-103778048 CTGAAGTTAAAAAGGGAAAATGG + Intronic
1073942438 10:108713876-108713898 CTGAAAAGACACAGGGCCAAAGG + Intergenic
1074658816 10:115627082-115627104 GTGAATACACAAAGTGACACCGG - Intronic
1074687514 10:115974154-115974176 CCGAATATACAAATGGACAGTGG + Intergenic
1075000379 10:118792565-118792587 CTGAATATACAAATGGACAGTGG + Intergenic
1075145542 10:119879849-119879871 CTGCATATACAAACAGACAATGG - Intronic
1075535825 10:123271346-123271368 CTGAATAAACAAAAGGTGAAGGG + Intergenic
1075598520 10:123749743-123749765 CTGACTTTACAAAGGGTGAAAGG - Intronic
1076079063 10:127561583-127561605 ATGAATATACAAACGGGCAATGG + Intergenic
1076409843 10:130239758-130239780 CTACATATGCAAAGGGTCAAAGG - Intergenic
1077728933 11:4707351-4707373 CTCAATTTAAAAAGGGACAAAGG - Intronic
1078456721 11:11481518-11481540 CTGACTTTCCCAAGGGACAAGGG + Intronic
1078493824 11:11796243-11796265 CTGATTGTAAAAAGGGCCAATGG - Intergenic
1078589802 11:12630394-12630416 CTTAATAGAAAAATGGACAAAGG - Intergenic
1080371835 11:31656752-31656774 CTAAATATGCAAAGGGGAAAAGG + Intronic
1080955412 11:37088374-37088396 TTTAATATACAAAGGAACAATGG + Intergenic
1081078180 11:38702516-38702538 TTAAATATACAAATGGACAATGG + Intergenic
1081170531 11:39864565-39864587 CTAAATAACCAAAGGGTCAAAGG - Intergenic
1081796658 11:45825208-45825230 CCAAATATACAAACGGACAATGG + Intergenic
1081902424 11:46640316-46640338 CTGAATATACTAACAGACAGTGG - Intronic
1082204134 11:49411032-49411054 ATGAAGATACAAAGGGATCATGG + Intergenic
1082881594 11:58043387-58043409 ATGAATAGACAAATAGACAAAGG - Intronic
1086515133 11:87603071-87603093 CTGAATATACAAATAGACAATGG - Intergenic
1087088374 11:94242840-94242862 CTGAACATAAAAATGGACAATGG + Intergenic
1087095230 11:94311754-94311776 CTGAATCTACAAATGAACAATGG - Intergenic
1087096743 11:94326330-94326352 CTGAATATATAAGTGGACAATGG - Intergenic
1087419450 11:97902491-97902513 CTGAAAATAAAAAGGTACACAGG + Intergenic
1087608182 11:100402945-100402967 TTGAATATACAAATAGGCAATGG + Intergenic
1087991078 11:104745630-104745652 CTGAATTTACAAAGAGAGGAAGG - Intergenic
1088333713 11:108679838-108679860 CTTAATAAACGAAGGGAGAAGGG + Intronic
1088583266 11:111335331-111335353 GTGAAGTTACAAAGGGGCAAAGG + Intergenic
1088888579 11:114027056-114027078 GTCAATCTACAAAGGGACACAGG + Intergenic
1088968326 11:114748275-114748297 CTGCATGTACTAGGGGACAAAGG - Intergenic
1089016020 11:115166282-115166304 CTGAATATTCAAAGGCACAGAGG + Intergenic
1089955885 11:122570547-122570569 AAGAACATACAAAGGCACAAAGG - Intergenic
1090037716 11:123263282-123263304 CTGGCTATACTAACGGACAATGG - Intergenic
1090730618 11:129570500-129570522 ATGAAGATGCAAAGGTACAAGGG - Intergenic
1090883345 11:130854029-130854051 ATGAATAAACAAAGGAGCAAAGG - Intergenic
1091115616 11:133010011-133010033 CTGGATATGAAAAGGGACTAGGG - Intronic
1091938272 12:4450756-4450778 CTGAATCTGCAAAGGGGCAGAGG + Intergenic
1092611982 12:10182131-10182153 ATGACTATACAAAGGAAGAAGGG - Intronic
1093512823 12:19949174-19949196 CTGAATATACAAATGGACAATGG + Intergenic
1094001946 12:25705196-25705218 CTGAATATTCAAACAGCCAATGG + Intergenic
1094425908 12:30316863-30316885 CTGAACAGACAAGAGGACAAAGG + Intergenic
1094794592 12:33956490-33956512 CTAAATATACAAACCAACAATGG + Intergenic
1095106448 12:38239104-38239126 CTAAATATACAAACCAACAATGG + Intergenic
1095121727 12:38426833-38426855 ACGAATATACAAAAGGACAATGG - Intergenic
1095535273 12:43238557-43238579 CTGAATACACAAACAGATAATGG - Intergenic
1095724389 12:45435891-45435913 CTGAATATACAAATGGACAATGG + Intronic
1095854263 12:46843245-46843267 TTGCATATAGAAAGAGACAATGG - Intergenic
1096236938 12:49935339-49935361 CTCAATTTAAAAAGGGGCAAAGG - Intergenic
1097471400 12:59997578-59997600 TTGAAGCTACATAGGGACAAAGG + Intergenic
1098024952 12:66191474-66191496 ATGAATACACAAAGGGACAATGG - Intronic
1098484380 12:71003893-71003915 TTGAATGTACAAAGGCAAAATGG + Intergenic
1099433306 12:82614855-82614877 CAGCCTATACAAAGGGACAGGGG - Intergenic
1099639228 12:85263519-85263541 CTGAAAATAAACAGTGACAAAGG + Intergenic
1100267803 12:92994736-92994758 ATATATATACAAAGGGATAAAGG - Intergenic
1101803278 12:108041468-108041490 CTGAACATACAAATGGACAGTGG + Intergenic
1101887204 12:108675746-108675768 CAGAATACACAAATGGAAAAAGG + Intronic
1104072200 12:125355585-125355607 CTGAATATACAAATGGACAACGG - Intronic
1104356623 12:128092456-128092478 CTGAATATAAAAATGGACAATGG + Intergenic
1106105888 13:26733260-26733282 CTAAATATACAAGTAGACAATGG + Intergenic
1106359943 13:29021800-29021822 TTGAATAAACAAAGACACAAGGG + Intronic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1106881627 13:34138279-34138301 CTGAATATACAAACTGACATTGG + Intergenic
1106944509 13:34811735-34811757 CTCAATATACAAAGGGATAGGGG - Intergenic
1107033923 13:35881024-35881046 CTGAATATACAGATGAACAATGG + Intronic
1107705830 13:43103786-43103808 CAAAATATACAAAGGAAAAAAGG - Intronic
1107778636 13:43875481-43875503 CTGAATATGCAAATGGACAATGG + Intronic
1108440514 13:50448461-50448483 CTGAATATACAAATGGATGACGG + Intronic
1109438036 13:62332174-62332196 CTGGATACACAAAGGGACAGTGG - Intergenic
1109684462 13:65797717-65797739 CTGATTATACAAATGGACAATGG + Intergenic
1109825165 13:67709646-67709668 CTGAATATGAAAATGGACAGTGG + Intergenic
1109958777 13:69603683-69603705 CTGAATATACAAATGCACAGTGG - Intergenic
1111880146 13:93945727-93945749 CTGAATATACAAATGGGCAGTGG - Intronic
1112263348 13:97898886-97898908 CAGAATATACAATGGGGGAAAGG - Intergenic
1112273400 13:97992558-97992580 CTGAAAAAATAAAAGGACAAAGG + Intronic
1112472701 13:99703251-99703273 TTAAATTTAAAAAGGGACAATGG - Intronic
1112586093 13:100720285-100720307 CTGAATATACACATAGACAGTGG + Intergenic
1112944351 13:104908514-104908536 CTGAATAACCAATGGGTCAATGG - Intergenic
1112989460 13:105494586-105494608 CATAATACACAAAGGGACACAGG - Intergenic
1113629858 13:111874758-111874780 CTAAATATACCAATGGACAATGG - Intergenic
1114404636 14:22444899-22444921 CTGAAAATACAGAGGGACTACGG - Intergenic
1114662902 14:24360021-24360043 CTGAATATACAGATGGAAAATGG + Intergenic
1115155191 14:30331079-30331101 CTGAATATACAAATGGACAGTGG + Intergenic
1116110672 14:40576610-40576632 CTGAACATACAAATGGACTATGG + Intergenic
1116146083 14:41070788-41070810 CTGAATATACAGATAGAAAATGG - Intergenic
1117056791 14:51920257-51920279 CTGAAGATATCAAGGGACAACGG + Intronic
1118391765 14:65301908-65301930 CCAAATATGCAAATGGACAATGG + Intergenic
1118395258 14:65330754-65330776 ATGAAAATTCAAAGGGAGAATGG + Intergenic
1119134916 14:72208581-72208603 CTGGAGATACAAAGGGAAATAGG - Intronic
1121596616 14:95168208-95168230 CAGAATAAACAGAGGGAGAAGGG - Intergenic
1122294900 14:100699917-100699939 CTAAATATCCAAAGGGACAGTGG - Intergenic
1202921255 14_KI270723v1_random:32005-32027 CTGGATCTGCAAAGGGACTAGGG + Intergenic
1124157857 15:27243698-27243720 ATGAATATGCAAATAGACAATGG - Intronic
1124640749 15:31394704-31394726 GTGAATATACTAAAGGCCAATGG - Intronic
1126338378 15:47612199-47612221 CCAAACATGCAAAGGGACAATGG - Intronic
1127620589 15:60729999-60730021 ATAAATGTAAAAAGGGACAAGGG - Intronic
1128455442 15:67829000-67829022 CTGAATCTACAAGGGGGCAAGGG + Intronic
1128869777 15:71145619-71145641 CTGAATACAGAAAGGAAGAAAGG + Intronic
1129359413 15:75015242-75015264 CTGAATAAACAAAGGAAGGAGGG - Intronic
1129881773 15:79011390-79011412 CTGAACATAGGAAGGGACAGAGG + Intronic
1129958082 15:79657577-79657599 CTGTATATACAAACAGACAATGG + Intergenic
1130810839 15:87377052-87377074 TTCAATATAAAAATGGACAAAGG + Intergenic
1131649568 15:94383965-94383987 GTGAATCTCGAAAGGGACAAGGG - Intronic
1131970770 15:97890556-97890578 CTGAATATACAAACAGACAATGG - Intergenic
1132913017 16:2325406-2325428 CTGATTGTACAATGGGACCAGGG - Intronic
1133109651 16:3540143-3540165 CCTAATTTACAAAGGGAAAAAGG - Intronic
1133512586 16:6474106-6474128 CTGCATACACAAATGGACACTGG - Intronic
1133598541 16:7316834-7316856 CTGGAAAAACAAAGGGACCAGGG + Intronic
1133611777 16:7440424-7440446 GTGGACATACAAAGGGACATAGG - Intronic
1134811767 16:17173575-17173597 CTCAATGCACACAGGGACAAAGG + Intronic
1135492213 16:22919315-22919337 CTGAATGTACCAACGAACAATGG - Intergenic
1135498659 16:22974846-22974868 CTGAATATACAGGTGGACAAAGG + Intergenic
1136607465 16:31346087-31346109 CTGAATATACAAAGGGATAGTGG + Intergenic
1137073461 16:35931204-35931226 CGGAATCTTCAAAGGGACACTGG - Intergenic
1138027293 16:53532050-53532072 CTGAATATCCCAAGGGACACAGG + Intergenic
1138326495 16:56175676-56175698 CTCAATTTAAAAATGGACAAAGG - Intergenic
1140587491 16:76310129-76310151 CTGAATACACAAATGGCAAATGG - Intronic
1143127048 17:4648982-4649004 CTGACTATACAAAAGGACAATGG - Intergenic
1144060662 17:11581123-11581145 CTGAATATGCAAGCAGACAATGG + Intergenic
1144221375 17:13102826-13102848 CTGAATGTACCCATGGACAATGG - Intergenic
1144264788 17:13557657-13557679 CTGAAAATACAAAAGTAGAAAGG + Intronic
1144362232 17:14506424-14506446 GTTAAAATACAAAGGGACATTGG - Intergenic
1147032544 17:37651510-37651532 TGGAAGAGACAAAGGGACAAGGG + Intergenic
1147207336 17:38847032-38847054 CAGAATATAAACAGTGACAAAGG + Intergenic
1151045124 17:70910909-70910931 CTGAATTAATAAACGGACAAAGG + Intergenic
1152435040 17:80271350-80271372 CTGAGTACTCAAAGGGAAAAAGG + Intronic
1153611130 18:6886304-6886326 AAGAAAATACAGAGGGACAAAGG + Intronic
1153686408 18:7550511-7550533 CTGAATCTACAAATGAACAGTGG - Intergenic
1154128275 18:11713618-11713640 CTGAATATATAAACAGGCAATGG - Intronic
1155615217 18:27714348-27714370 CTGAATATACAAATGAACAATGG + Intergenic
1155864344 18:30945797-30945819 CTGAATCCACAAAGGGATAGTGG + Intergenic
1156088468 18:33438026-33438048 CTGAAAATATAAAGGGACTATGG + Intronic
1157015255 18:43704406-43704428 TTGAATATACGAACAGACAATGG - Intergenic
1157139117 18:45088106-45088128 CTGAATATACAAATGGACAATGG + Intergenic
1158066801 18:53420308-53420330 CTGAATATTCTAAAGAACAAGGG + Intronic
1158091617 18:53721261-53721283 GGGAATATACAAAGGCACAGTGG - Intergenic
1158161408 18:54488648-54488670 TTGAATATACAGATGGACAATGG - Intergenic
1158789128 18:60754447-60754469 CTGAATATACAAATGGACAAGGG + Intergenic
1159017361 18:63112209-63112231 CTGAATATACAAATGGGCAATGG + Intergenic
1159637737 18:70825914-70825936 CTGAATACGCAAATGGATAATGG - Intergenic
1159638185 18:70831426-70831448 CTGAATACACAAATGGACAATGG + Intergenic
1160611965 18:80095867-80095889 GTGAATATACAAATGAACAATGG + Exonic
1161790649 19:6357922-6357944 CTGATTAAACAAAGGGAGACAGG + Intergenic
1161879113 19:6934935-6934957 CTGGATATACAAATAGACAAGGG - Intronic
1163278150 19:16298767-16298789 CTGGAAATAGAAAGTGACAATGG + Intergenic
1168159105 19:54496983-54497005 CTGTATATACAAAAGTGCAAGGG + Intergenic
925175959 2:1784071-1784093 ATGAAAATACAAGCGGACAATGG + Intergenic
925451571 2:3973651-3973673 CTGGATATACAAAGAGACAATGG - Intergenic
926875450 2:17471741-17471763 CTGAATATAAGAAGTGACAGTGG + Intergenic
927209761 2:20631861-20631883 CTGAATACACAAAGGGACAATGG + Intronic
927745075 2:25611555-25611577 CTGCAGATACAGAGGGCCAAGGG + Intronic
928109838 2:28497698-28497720 GAGAATATACAAATGGACAACGG - Intronic
928580132 2:32699057-32699079 CTTCTTTTACAAAGGGACAAGGG - Intronic
928995339 2:37283683-37283705 CTGAGTTTTCAAAGGGAAAATGG - Intronic
929011747 2:37451854-37451876 CTGAATATACAAAGGGACAATGG - Intergenic
929077889 2:38093442-38093464 CTTTATATACAAAGGGATTAAGG + Intronic
930296666 2:49562871-49562893 CTAGAAATAAAAAGGGACAATGG + Intergenic
930775546 2:55166750-55166772 CTGAAGATACAAAGGGATCAAGG + Intergenic
931928091 2:67097080-67097102 CTGCATATGCAAAGGGTCAGAGG + Intergenic
932261785 2:70333071-70333093 CTGAATTTTCAATGGGGCAAAGG + Intergenic
932865351 2:75335675-75335697 CTGAATATACAAATGGACAATGG - Intergenic
932971587 2:76549776-76549798 CTGAATATACAAACGAACAATGG - Intergenic
933178002 2:79197546-79197568 TTGAATATACAAATGGACAATGG - Intronic
933207641 2:79527181-79527203 CTAAATTTAAAAATGGACAAAGG + Intronic
933522865 2:83394800-83394822 TTGAACATACAAAAGGGCAATGG + Intergenic
935199683 2:100845417-100845439 CTGAATGTACAAATGGACAATGG - Intronic
935330148 2:101971219-101971241 GTGGATATACAAAAAGACAATGG - Intergenic
935782981 2:106524270-106524292 ATGAATATACAAAGGGACAATGG - Intergenic
935930432 2:108118201-108118223 CTGAATATACATATGAACAAGGG - Intergenic
937804777 2:126126570-126126592 CTGAATACACACAGGAAAAAAGG - Intergenic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
938038478 2:128055965-128055987 CTCAATATTTAAAGGGAAAAGGG - Intergenic
938058926 2:128237295-128237317 ATGAATATACAAACAGACAATGG + Intronic
938171070 2:129077162-129077184 CTGAATATACACATACACAATGG - Intergenic
938807828 2:134823026-134823048 CTAAATATAGAAAGGGCCAGAGG + Intergenic
938977843 2:136496166-136496188 CTGAATATACAAATGGACAGTGG - Intergenic
939234302 2:139471080-139471102 CTGAATATACCAATGGACCATGG - Intergenic
940127959 2:150348254-150348276 CTGTATATACAAATGACCAAAGG + Intergenic
940178818 2:150908789-150908811 CTGAATATACAAGTGAACAATGG - Intergenic
941755741 2:169183925-169183947 CTGAAAACACAAAGGCAGAATGG - Intronic
941908164 2:170737049-170737071 CTGAATATACATACAGACAATGG + Intergenic
941926655 2:170902329-170902351 CTGAATATGCAAATGGAATAAGG + Intergenic
943104342 2:183525888-183525910 CTGAATATAAATAGGGACTATGG - Intergenic
943231476 2:185258345-185258367 TTAAATATAAGAAGGGACAATGG - Intergenic
943551765 2:189349315-189349337 CTGAAAATTAAAAGTGACAAAGG + Intergenic
943719758 2:191191433-191191455 CTAGATATACAAAAGGACAATGG - Intergenic
944213777 2:197233477-197233499 CAAAATTAACAAAGGGACAAAGG + Intronic
945567281 2:211416451-211416473 CTGAATATACAAAGGGACAATGG + Intronic
945791444 2:214310537-214310559 CTCAATATCCAAAGGGAAACTGG - Intronic
946026389 2:216674202-216674224 CTCAAGATGCAAAGGGAGAATGG + Exonic
946635348 2:221719016-221719038 CTGCATATACAAGCAGACAATGG + Intergenic
947849146 2:233270970-233270992 CTTAATTTACAAAGAAACAAAGG + Intronic
1169229032 20:3874792-3874814 CTGAACATACAACTGGACAATGG - Exonic
1169702112 20:8458304-8458326 TGAAATATACAAACGGACAATGG - Intronic
1170355628 20:15489272-15489294 CATAATATAAAAAGGGAAAAGGG - Intronic
1170819410 20:19743658-19743680 CTGAATATATAAAGGGACAATGG + Intergenic
1171723354 20:28589616-28589638 CTGAATAGAAAAATGGACAAGGG - Intergenic
1171754702 20:29093468-29093490 CTGAATAGAAAAATGGACAAGGG + Intergenic
1171859988 20:30390330-30390352 CTGAATAGAAAAATGGACAAGGG + Intronic
1172991332 20:39039109-39039131 CTGCAGATAAACAGGGACAAGGG - Exonic
1173266225 20:41484839-41484861 CAGAAGATAAAAAGGGAGAAAGG + Intronic
1173791382 20:45829905-45829927 TTGAATAAACAAAAGAACAAAGG - Intronic
1173794606 20:45850534-45850556 CTGAATATACAAACAGACAATGG - Intronic
1175504788 20:59473953-59473975 CTGAATATACAAATGGACCATGG - Intergenic
1176256866 20:64157543-64157565 CTGATTATTTAAAGGAACAATGG - Intronic
1176524285 21:7853688-7853710 CTAAATATACAAATGGACAATGG - Intergenic
1177378471 21:20305363-20305385 CTAGATAAACAAATGGACAATGG - Intergenic
1177650889 21:23961010-23961032 CTGAATATACAAAGGGACAATGG - Intergenic
1177766683 21:25466326-25466348 CTGAATTTCCATAGGGATAATGG - Intergenic
1178368927 21:32010979-32011001 CTGAATACATAAATGGACGACGG - Intronic
1178658305 21:34483701-34483723 CTAAATATACAAATGGACAATGG - Intergenic
1179010414 21:37552028-37552050 CTGAACATACAAATGGACAATGG + Intergenic
1179113526 21:38468338-38468360 CTGAATATAGAGAGGGAAATTGG + Intronic
1179650809 21:42807359-42807381 CTGAATATACAAATGAACAATGG - Intergenic
1180296907 22:10948273-10948295 CTGAATAGAAAAATGGACAAGGG - Intergenic
1181729801 22:24836754-24836776 CTGAATTCAAAAATGGACAAAGG - Intronic
1181737496 22:24893241-24893263 CTGAAGACACAAAGGGAGCAAGG - Intronic
1183096067 22:35553047-35553069 CTGAATTTGCTAGGGGACAAAGG - Exonic
1184144310 22:42599882-42599904 CTGGAGAAACAAAGGGACCAAGG + Intronic
949216390 3:1574201-1574223 CAGTATATGCAAAGGCACAAAGG - Intergenic
949599458 3:5582252-5582274 CTGTGTATACCAAGGGAGAATGG - Intergenic
950981925 3:17316127-17316149 CTGAACATGCAAATGGGCAATGG - Intronic
951417117 3:22438401-22438423 CTGATTATAAAATGGGAAAAAGG - Intergenic
951811358 3:26703752-26703774 CTGAATATACAAACGGACAGTGG - Intronic
952546551 3:34426158-34426180 CTGAAAATACAAGAGGACCAAGG + Intergenic
952685181 3:36139408-36139430 TTGAATATAGAAAGGGAAAATGG + Intergenic
953097503 3:39792979-39793001 CTGAATTTACAAATGGACAATGG - Intergenic
953173658 3:40529883-40529905 CTGGATGGACAAAGGAACAAAGG - Intronic
953204240 3:40807673-40807695 CCCAATTTAAAAAGGGACAAAGG - Intergenic
953375449 3:42424383-42424405 CTGAATATATAAATGGATAATGG - Intergenic
953439213 3:42903859-42903881 TTGAATATACAAATGGGCAATGG + Intronic
954749591 3:52806080-52806102 CTGCAGATACAAAGGGAGAGAGG - Intronic
954841031 3:53511822-53511844 CTCAAAATACAAAGGGATACAGG + Intronic
955724509 3:61918924-61918946 CAGCATTTACAAAGGGATAAAGG - Intronic
955895011 3:63689558-63689580 CTGAATATACAAATGAACAATGG - Intergenic
956237061 3:67084078-67084100 CTGAAAATACAAATGGACAATGG - Intergenic
956396416 3:68831325-68831347 CTAAACATGGAAAGGGACAACGG - Intronic
956697890 3:71934152-71934174 CTGAATATACAAATAGACCATGG + Intergenic
957129035 3:76199564-76199586 ATGAATGTACAAATGGATAATGG + Intronic
957718104 3:83958771-83958793 CTGAAAATACGTAGGTACAATGG + Intergenic
958599859 3:96282400-96282422 CTAAATCTACAAAGAGACTATGG - Intergenic
959050650 3:101521677-101521699 CTGAATATATGAAGAGACAATGG - Intergenic
959178872 3:102953510-102953532 GACAATATACAAATGGACAATGG + Intergenic
959710574 3:109381921-109381943 CTGAATGTACAAATGAAAAATGG + Intergenic
960460026 3:117922256-117922278 CTGAATACTCAAAGGGAGGAGGG - Intergenic
960475990 3:118129547-118129569 CTGAATATACACATTGACAGTGG + Intergenic
960622399 3:119649336-119649358 ATGAATAAACAAATGGAGAATGG - Intronic
960675465 3:120190328-120190350 CTGATTTAACAAAGGCACAAAGG + Intronic
961142664 3:124568168-124568190 CTAAATTTAAAAATGGACAAAGG + Intronic
962497319 3:135954262-135954284 CAGAATATATAAGGAGACAAGGG - Intergenic
962497325 3:135954318-135954340 CAGAATATATAAGGAGACAAGGG - Intergenic
962514638 3:136139097-136139119 CTGACTATTTACAGGGACAAAGG - Intronic
962973941 3:140429839-140429861 CTCCATAGGCAAAGGGACAAAGG + Intronic
963007910 3:140743170-140743192 CTGATTTTAAGAAGGGACAAAGG + Intergenic
963255867 3:143144539-143144561 CTTAATCTACAAAGGGAAATTGG - Intergenic
963396946 3:144747110-144747132 CTTATTGTACAAATGGACAATGG + Intergenic
963629093 3:147711298-147711320 CTAAATATAGAAAGGAAAAATGG - Intergenic
963664233 3:148162059-148162081 CTGAATAGAAAAAAGGGCAAAGG + Intergenic
964314054 3:155424635-155424657 CTAAATATACAGATGGACAATGG + Intronic
964333516 3:155629910-155629932 CTGAATATAAAAAAGGAGTAAGG - Intronic
965370173 3:167852334-167852356 CTGAGTACACAAAGGGAAATAGG + Intergenic
965540867 3:169870291-169870313 ATGAATATGCAAAGAGAAAAAGG - Intergenic
966056684 3:175701419-175701441 CTGAATATACAAATTGACGATGG - Intronic
966707239 3:182929826-182929848 CTGAATATTTTAAGGGGCAAAGG + Intergenic
967507821 3:190272989-190273011 CTGAATGTACAAATGAACAATGG - Intergenic
968537519 4:1143834-1143856 CTGAATATATAAAGGAACACGGG + Intergenic
970316764 4:14835460-14835482 CTGACTATCCAAACAGACAATGG + Intergenic
970504373 4:16712224-16712246 CTCAATTTACAAATGGGCAAAGG + Intronic
971272455 4:25163343-25163365 CTGACTATACAAATGGACAATGG + Intronic
971299485 4:25430001-25430023 CTGAGTATACAAATGGACAATGG - Intergenic
972694125 4:41427978-41428000 CTGAATACACAGAGGTAAAAAGG - Intronic
973587917 4:52410837-52410859 GTGAATATATAAATGGACAATGG - Intergenic
973832944 4:54780161-54780183 CTGAGTATGGAAAAGGACAATGG - Intergenic
974631103 4:64490117-64490139 ATGAATATGAAGAGGGACAATGG - Intergenic
975112083 4:70639613-70639635 CTGAATTTAGATAGGCACAATGG + Intronic
975599258 4:76082297-76082319 CTGAATATGCCAAGGTAAAATGG - Exonic
975755548 4:77568103-77568125 CTGGTAACACAAAGGGACAATGG + Intronic
976775602 4:88702869-88702891 CTGAATATTCCTATGGACAATGG + Intronic
976866794 4:89738159-89738181 TTGAATATACTAATGCACAAAGG + Intronic
977741337 4:100487162-100487184 CTGAATCTAGAAAGGAACTATGG + Intronic
978038100 4:104021791-104021813 TTGAATATATAAACAGACAATGG + Intergenic
978400815 4:108328662-108328684 CTGAGTGTCCAAAGGCACAAAGG - Intergenic
979072530 4:116226993-116227015 CTGAATATTCAAATAGCCAAAGG + Intergenic
979638463 4:122983949-122983971 CGGAATATCCCATGGGACAAAGG + Intronic
981340875 4:143619977-143619999 CTGAATATACAGATGGAAAATGG + Intronic
982173460 4:152683404-152683426 CTGGATGTACAAATGGACAGTGG - Intergenic
982270432 4:153580512-153580534 CTAAATATACACAGGAACACTGG - Intronic
982289981 4:153770306-153770328 CTCAATTTAAAAATGGACAAAGG - Intergenic
982593153 4:157342361-157342383 CTGAAGATACTATGGGAGAAAGG + Intronic
983279667 4:165664810-165664832 CTGAATAGACTGAGGGACCATGG + Intergenic
983458728 4:167999760-167999782 TTGATTATACACAGGGACCAGGG - Intergenic
983766582 4:171491530-171491552 CTGAATATATAAATGGATGATGG + Intergenic
984264997 4:177487739-177487761 CTGAACCGACAAAGGAACAAGGG - Intergenic
984449405 4:179879964-179879986 ATGAATATAAAAAGTGACATTGG - Intergenic
985438156 4:189954043-189954065 CTCAATAGAAAAATGGACAAGGG + Intronic
985981020 5:3463546-3463568 CTGCATATACAATGGGATATTGG + Intergenic
986461354 5:7975691-7975713 TTGAATACACCAAGGGACAATGG + Intergenic
986779418 5:11050575-11050597 CTGAATATGCAAATGGACAATGG + Intronic
986863327 5:11953346-11953368 CTCCACATACAAATGGACAAAGG - Intergenic
987691667 5:21274847-21274869 CTGAATACACTAACAGACAATGG - Intergenic
988123607 5:26999591-26999613 CTCATTTGACAAAGGGACAAAGG + Intronic
988303213 5:29461213-29461235 ATGCATATACAAAGGGAGAGGGG - Intergenic
988675292 5:33427303-33427325 CAGAATATACATAGGAATAAAGG - Intergenic
988684076 5:33511330-33511352 ATGAATACACAAATAGACAATGG + Intergenic
990627396 5:57630118-57630140 GAGAATATACAAATGGATAATGG + Intergenic
991502460 5:67290419-67290441 CTGAATAGAGAAAGGGAAAAGGG + Intergenic
991628545 5:68630501-68630523 ATGAATAAACAAAGGAAAAATGG + Intergenic
991748710 5:69775290-69775312 CTGAATACACTAACAGACAATGG + Intergenic
991800288 5:70355102-70355124 CTGAATACACTAACAGACAATGG + Intergenic
991828312 5:70654939-70654961 CTGAATACACTAACAGACAATGG - Intergenic
991892646 5:71354542-71354564 CTGAATACACTAACAGACAATGG + Intergenic
992553819 5:77884416-77884438 CTGTATATACAGAGTGAGAAAGG + Intergenic
994946744 5:106403610-106403632 TTGAATATAAAAAGCGAAAATGG - Intergenic
996647199 5:125830256-125830278 ATGAAAATAGAAAGGGACAAGGG - Intergenic
996662714 5:126023004-126023026 CTGAATATACAAATGAAAAATGG - Intergenic
996670892 5:126115572-126115594 CTGAATATACAAATGGACAGTGG - Intergenic
997416243 5:133731068-133731090 CTGATTCTATAAAGGGAAAATGG - Intergenic
997715168 5:136037116-136037138 CTGCATTTACAAAGAGAGAAGGG + Intronic
998106824 5:139474024-139474046 CAGAATATAAAAAGGAACAGAGG + Intergenic
998192245 5:140036148-140036170 CTGCATATACAAAGTGGGAAGGG + Intronic
999054502 5:148559588-148559610 CTAAACATACAAATGGACAATGG + Intronic
999927543 5:156395587-156395609 CTGAATATACAAATGGATGATGG - Intronic
1000898143 5:166881116-166881138 CTGAAAATGGAAAAGGACAAAGG - Intergenic
1002360887 5:178669907-178669929 CGGAATAGACTAAGGGACAAAGG + Intergenic
1002390034 5:178903479-178903501 CTCAATATAAAAATGGGCAAAGG - Intronic
1003002146 6:2346305-2346327 CTGAATAGACCAGTGGACAATGG + Intergenic
1003010769 6:2425347-2425369 CTGATTTTAAAAATGGACAAAGG - Intergenic
1003673677 6:8182797-8182819 CTGAAAATACAAATAGACAGAGG - Intergenic
1004011159 6:11689058-11689080 GTGAATATACAAAGTAGCAAAGG - Intergenic
1004039347 6:11960490-11960512 CTGACTATAGAAATGGGCAATGG + Intergenic
1004045526 6:12019241-12019263 CTGAGTAAGCAAAGGGACAGAGG + Intronic
1004091420 6:12506296-12506318 GTGAATATGCATAGCGACAATGG + Intergenic
1004332419 6:14734069-14734091 CTGAATATACAAATGGACAACGG + Intergenic
1005583878 6:27257743-27257765 TTGAATATACAAATGGATAATGG - Intergenic
1006214245 6:32426125-32426147 CTGGATATAGAAACAGACAATGG + Intergenic
1007103931 6:39270415-39270437 TTGAATATTCAGAGGGAGAAAGG + Intergenic
1008193692 6:48492002-48492024 CTGAAAACACAAAGAAACAAGGG - Intergenic
1008840365 6:55895521-55895543 CTAAATATACAAAGGAAATAAGG - Intergenic
1008876481 6:56335238-56335260 CTAAATATACAAATGGACAATGG + Intronic
1011447870 6:87462209-87462231 CTGAATATACAAATGGACAAAGG - Intronic
1011954470 6:93008964-93008986 CTGAATATGCAAAGAAGCAATGG + Intergenic
1012207187 6:96476242-96476264 CTAAATATGGAAAGGAACAATGG - Intergenic
1012774002 6:103479949-103479971 CTCAATATCCACAGGGAGAAAGG + Intergenic
1013462636 6:110389963-110389985 CTGAATGTACAAATGGACAATGG - Intergenic
1013993186 6:116278375-116278397 CTGAATATCCAAAGGAAACAGGG + Exonic
1014073510 6:117210775-117210797 CTGAATAAACAAAGGAAGAGAGG - Intergenic
1014271617 6:119342871-119342893 CTGTATATACAAAGGGTGAAAGG - Intronic
1014400322 6:120981045-120981067 CTGCAGATTCCAAGGGACAATGG + Intergenic
1014593453 6:123302398-123302420 CTGAATATGCAAAGGATCAATGG - Intronic
1014767264 6:125421307-125421329 CTGAATATATAAATGGACAATGG - Intergenic
1014835727 6:126158356-126158378 CAGAAAATACAAAAGGACAAAGG - Intergenic
1015207947 6:130662085-130662107 CTGAATGTGCAACGGAACAAAGG + Intergenic
1015225190 6:130849617-130849639 CTGAATAGGAAAATGGACAAAGG + Intronic
1016573153 6:145537288-145537310 TTGAATATACAAATTGACAATGG - Intronic
1016766656 6:147801852-147801874 CTAAATATCCATAGGGAAAAAGG + Intergenic
1016797956 6:148137970-148137992 CTGTATATGCAAATGGACAATGG - Intergenic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1017039323 6:150295117-150295139 CTGAAGAGACAAAGGGAGGAAGG + Intergenic
1017477703 6:154814882-154814904 GGGAAGATACAAAGGGAAAATGG - Intronic
1018017132 6:159722669-159722691 CTGAAAATACAAATGGTAAATGG + Intronic
1018082741 6:160272347-160272369 CTGAATATACACATGGACAATGG - Intronic
1018091472 6:160349359-160349381 CTCAAAATGCAAGGGGACAAAGG + Intronic
1018929397 6:168230659-168230681 CTGAATATACGAAGGGACGCTGG + Intergenic
1020830721 7:13091508-13091530 CTGAAGACACAAATAGACAATGG - Intergenic
1020985526 7:15129289-15129311 CTGGATATACAACTGAACAATGG - Intergenic
1021259600 7:18438154-18438176 CTGAATATAAACATGAACAAAGG + Intronic
1022047743 7:26636205-26636227 CTGTGTATACCAAGGGACAACGG + Intergenic
1022592101 7:31673387-31673409 CTGAAAATAGAAACAGACAATGG - Intergenic
1023313720 7:38913732-38913754 CTGAATATATAAAGGGGCACTGG - Intronic
1023971584 7:44995207-44995229 CTGAATATACAAATAGACAATGG + Intergenic
1024961484 7:54981381-54981403 CTGAGTACACAAATGGACAATGG + Intergenic
1024995305 7:55269656-55269678 CTGAGTACACAAATGGACAATGG + Intergenic
1026681305 7:72468881-72468903 CTGAATTTAAAAATGGGCAAAGG - Intergenic
1026981267 7:74528128-74528150 GTGAATATACAAATGGCTAAAGG - Intronic
1027331552 7:77100878-77100900 TTGAAGATTCAAAGGAACAAAGG + Intergenic
1028111570 7:86948524-86948546 CTAAATATAAAAAGGGAAACAGG + Intronic
1028270825 7:88786885-88786907 CTAAATATACAAATGAAAAAAGG + Intronic
1028379400 7:90182051-90182073 CTGAATATATACAGTGACAGAGG + Intronic
1028624218 7:92859710-92859732 CTGAATATAAAAAGGCCCAGGGG + Intergenic
1028781899 7:94746754-94746776 CTGAATATACAAATGGACAATGG + Intergenic
1029784219 7:102770462-102770484 TTGAAGATTCAAAGGAACAAAGG - Intronic
1029875729 7:103749651-103749673 CTCAAACTACTAAGGGACAAGGG + Intronic
1030359090 7:108576539-108576561 CAGAATAGACAGAGGGGCAATGG + Intergenic
1031164887 7:118216072-118216094 GTGAATGTACAAATAGACAATGG + Intronic
1032112625 7:129089665-129089687 ATGAAAATACAAACAGACAATGG + Intergenic
1032375183 7:131407721-131407743 CAGCATACACAAAGGCACAAAGG - Intronic
1032607544 7:133372056-133372078 CTGAACTTAAAAATGGACAAAGG - Intronic
1033363455 7:140654143-140654165 CTGAATACGCAAAGGGACAATGG - Intronic
1034672263 7:152867682-152867704 CTGAATACACAAATGGACAATGG - Intergenic
1035556242 8:569297-569319 CCGAATATGCAAACAGACAAGGG - Intergenic
1037421906 8:18711141-18711163 CTGAATATGGAAAGGGAAAATGG + Intronic
1037700619 8:21270989-21271011 CAGAATAAACAAAGGGAGAGAGG + Intergenic
1038627523 8:29208631-29208653 CTGAATATTCAAATAGACAACGG + Intronic
1038843867 8:31211044-31211066 CTGAATGTACAAATAGACAATGG + Intergenic
1039781372 8:40789442-40789464 CTGAATATGCAAATGGACAATGG + Intronic
1040730244 8:50436849-50436871 CTGCATATACAAAAGCAAAAAGG - Intronic
1040888131 8:52287684-52287706 TTGCATATACAAAGGGAGACAGG + Intronic
1040958007 8:52999743-52999765 CTGACTATACAAATGGGAAATGG + Intergenic
1040960995 8:53032646-53032668 TTGAAGATACAAATGGACAATGG - Intergenic
1041185398 8:55294922-55294944 CTTAATGTGCAAAGGGACACTGG - Intronic
1041384388 8:57283590-57283612 CGGTATATACAATAGGACAATGG - Intergenic
1041443914 8:57929437-57929459 CTGAATATACCAATGGATAATGG - Intergenic
1042209462 8:66365130-66365152 CTGAATACAGAGAGGAACAAAGG - Intergenic
1042568163 8:70133559-70133581 CTGAATACTAAAAGGGAAAATGG + Intronic
1042885996 8:73552573-73552595 GTGAAGCTATAAAGGGACAAGGG + Intronic
1042892893 8:73633012-73633034 CTGCTTATACACAGGGAAAAAGG + Intronic
1043210270 8:77505233-77505255 GTGGATAAAGAAAGGGACAAAGG - Intergenic
1043429974 8:80185240-80185262 CTGAATATACAAATGGACATTGG + Intronic
1043716040 8:83488109-83488131 CTGAATTTCAAAAGGGAAAAGGG + Intergenic
1044060794 8:87632260-87632282 TTGAATATACATAGAGAGAAAGG + Intergenic
1044203500 8:89464088-89464110 GACAATATACAAATGGACAATGG - Intergenic
1044240671 8:89884869-89884891 CTGAATATGCAAATGGACAATGG + Intergenic
1044459088 8:92424158-92424180 CTAAATATACCAAGAGAGAATGG + Intergenic
1044605892 8:94047102-94047124 CTGAATATGCAAATGGACAATGG + Intergenic
1044821636 8:96159542-96159564 CTTAATACACAAAGGTACATGGG - Intronic
1044850562 8:96423290-96423312 CTGGATATACGAATGGGCAAAGG - Intergenic
1045213354 8:100122031-100122053 CTGAATATACAAATGGACAGTGG + Intronic
1045882054 8:107052518-107052540 TTCAAAATACAAAGGGAAAAAGG + Intergenic
1046124462 8:109886811-109886833 ATGAATATACAAAGACATAAAGG + Intergenic
1046955369 8:120057884-120057906 CTTCATAAACAAAGGGAGAAAGG - Intergenic
1047177505 8:122555465-122555487 CTGTAAATACAAAGGGAGATTGG - Intergenic
1047301762 8:123619484-123619506 TTCAGTATACAAATGGACAATGG - Intergenic
1047649103 8:126900502-126900524 TTGGACATACAAAGGGACCAAGG - Intergenic
1047658182 8:127001990-127002012 GTCAATATAAAAAGGTACAAAGG + Intergenic
1048509935 8:135053171-135053193 CTGCAGATACAGAGGGCCAATGG - Intergenic
1048894256 8:138975278-138975300 CTGAATACACAGATGGACAATGG - Intergenic
1048941301 8:139403070-139403092 CTGAATATATGAATGGACAGTGG + Intergenic
1049351761 8:142168235-142168257 CACAATTTAGAAAGGGACAAAGG + Intergenic
1050483638 9:6111900-6111922 CTGAATATACAAATAAACACTGG + Intergenic
1050751640 9:8945751-8945773 CTGTATATCCAAAGGTACACAGG - Intronic
1051001814 9:12291157-12291179 CTGAATATACAAACAAACAATGG - Intergenic
1051014454 9:12458720-12458742 CTGAATATACAAATAGACAATGG + Intergenic
1051506371 9:17831636-17831658 CTGAATGAAAACAGGGACAATGG - Intergenic
1052034505 9:23665080-23665102 CTGAATATATATAGTGACAGGGG - Intergenic
1053726747 9:41010739-41010761 CTGAATAGAAAAATGGACAAGGG + Intergenic
1055641924 9:78325496-78325518 CTGCATCTGCAAAGGCACAAAGG - Intronic
1055778161 9:79789003-79789025 ATAAATATACAAATGAACAATGG - Intergenic
1056433787 9:86555579-86555601 CTCAATTTAAAAAGGGGCAAAGG + Intergenic
1056602016 9:88053874-88053896 CTGAGTACACAAACAGACAATGG + Intergenic
1056627617 9:88266472-88266494 CTGAAAATGCAAATAGACAATGG + Intergenic
1057239237 9:93393383-93393405 CTGACTGTTGAAAGGGACAAGGG - Intergenic
1057665532 9:97042099-97042121 CTGAGTAAACAAATAGACAATGG - Intergenic
1058476128 9:105335040-105335062 CTGAATATACAAAGTTAAATGGG - Intronic
1058847878 9:108979932-108979954 CTGAATTAACAAAGGAAAAATGG - Intronic
1059175996 9:112170663-112170685 CTGAATATACAAATGGACAATGG + Intronic
1059968209 9:119637227-119637249 TTGAATATATAAATGGAAAATGG - Intergenic
1061638030 9:131927788-131927810 CAGAGTATAAAAAGGGAAAAGGG - Intronic
1061718477 9:132536722-132536744 CGGAATATCCAAATGGACAATGG - Intronic
1061790952 9:133058572-133058594 AGGAATATATGAAGGGACAAAGG - Intergenic
1061841182 9:133359402-133359424 TCCAATATACAAGGGGACAACGG + Intronic
1187492980 X:19769991-19770013 CTGAATCTAAAAATGGGCAAAGG + Intronic
1187516246 X:19974039-19974061 CTGAGTGTACCAAGGGGCAATGG - Intergenic
1187550465 X:20297877-20297899 CTCAATATAAAAATGGGCAAAGG + Intergenic
1188295408 X:28441198-28441220 TTGAATATACAAAGGAACAAGGG - Intergenic
1188882846 X:35511254-35511276 CGGATAATACAAAGGGACAAAGG + Intergenic
1190139419 X:47829267-47829289 CTGAATATACAAACAGGCAATGG - Intergenic
1190473506 X:50806073-50806095 ATGAATGAACAAAGGGGCAATGG + Intronic
1190748289 X:53339857-53339879 CTGAACGTACAAATTGACAATGG + Intergenic
1191024812 X:55902463-55902485 CTCAATATAAAAATGGGCAAAGG - Intergenic
1192383493 X:70640772-70640794 CTGAACATGGAAAGGAACAACGG + Intronic
1192970849 X:76228192-76228214 GTCAATATATAAAGGGAGAAAGG - Intergenic
1192988182 X:76422998-76423020 TTGAATGTACAAATGGACAATGG - Intergenic
1193517328 X:82483270-82483292 CAGAATATGCTAAGTGACAAGGG - Intergenic
1194001688 X:88437616-88437638 CTGAATACATAAATGGACAATGG + Intergenic
1194007256 X:88510399-88510421 CTGAAGATTTTAAGGGACAATGG - Intergenic
1194127250 X:90035165-90035187 CTGAATAATCAATGGGTCAAAGG - Intergenic
1195037908 X:100986953-100986975 CTGACTATAGAATGGGCCAAGGG - Intronic
1195304945 X:103572773-103572795 CTGAATTTACAAGAGGAAAATGG - Intergenic
1196527344 X:116741524-116741546 CTGGGTATAGAGAGGGACAACGG - Intergenic
1199133295 X:144220154-144220176 CTGAAGATAGATAGAGACAAAGG - Intergenic
1199204143 X:145128089-145128111 TCGAATATACAAACAGACAACGG + Intergenic
1199702564 X:150393757-150393779 CTGATTAAACAATGGGCCAAAGG - Intronic
1200781479 Y:7220248-7220270 CTGAAAATATAAACAGACAATGG + Intergenic
1201315650 Y:12643070-12643092 CTGAATATACAAATGGACATTGG + Intergenic