ID: 945568870

View in Genome Browser
Species Human (GRCh38)
Location 2:211439043-211439065
Sequence CATGTAGGAGATGCTGTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 233}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945568870 Original CRISPR CATGTAGGAGATGCTGTGGT GGG Intronic
900470847 1:2854239-2854261 CATGAAGGAGATGCTATAGGAGG + Intergenic
902764834 1:18607186-18607208 CCTGTAGGAGAAGCTGCTGTGGG - Intergenic
903937614 1:26907431-26907453 CCTGTACTAGATGCTGGGGTAGG - Intronic
904403276 1:30270693-30270715 CAGGTAGGAGATGATGAGGCAGG - Intergenic
904907904 1:33911974-33911996 AATATAGGAGATGAGGTGGTGGG - Intronic
905669519 1:39782268-39782290 CTTGTAGTGGATGCTGTGGGGGG - Intronic
907330517 1:53668056-53668078 AATGGAGCAGATGCTGCGGTGGG - Intronic
907522607 1:55034076-55034098 CCTGTGGGACATGCTGTGCTGGG - Intergenic
908061764 1:60357735-60357757 CATGTAGCTGATGAGGTGGTAGG + Intergenic
908072333 1:60475494-60475516 CATATAGCAGATGCTATGCTAGG - Intergenic
908334752 1:63110476-63110498 CTTTCAGGGGATGCTGTGGTTGG - Intergenic
910303893 1:85739871-85739893 TATGGAGGAGATGCAGTTGTTGG - Intronic
913329920 1:117658825-117658847 CATGAAGGAGACCCTGTGCTGGG + Intergenic
917257631 1:173132566-173132588 CATGATGGAAATGATGTGGTGGG + Intergenic
918414496 1:184292440-184292462 CAAGTGGGAGTTGCAGTGGTGGG - Intergenic
919854531 1:201696170-201696192 CATGAAGGAGAGGGTGGGGTTGG + Intronic
920084678 1:203406616-203406638 CATGTGTCAGATGCTGAGGTTGG + Intergenic
920503256 1:206498824-206498846 CATGGAGGAGGTGCTATGCTAGG + Intergenic
921260916 1:213384483-213384505 TATGGAGGAGGTGCAGTGGTCGG + Intergenic
922751346 1:228071490-228071512 CATGTAGGGGATGCTGTAGGGGG + Intergenic
1063769297 10:9179129-9179151 CATGTATGAGTTGCTGTTTTAGG - Intergenic
1064099443 10:12451004-12451026 CATGTAAGAGGTGCGGTGCTGGG + Intronic
1065932510 10:30492113-30492135 CATGGATGAGATGCAGTGTTTGG - Intergenic
1066483625 10:35822735-35822757 CATGTGTCAGATGCTGTGCTGGG + Intergenic
1069567081 10:69470847-69470869 CATGTAGGAGATGAGGCAGTGGG - Intronic
1069831420 10:71284492-71284514 CAGGTAGAAGATGCATTGGTGGG + Intronic
1072250502 10:93578634-93578656 CATGTAGGAGATGCTACTGATGG + Intronic
1073597201 10:104812869-104812891 CTTGAAGGGGATGCTGTGGGTGG + Intronic
1075257251 10:120934994-120935016 AATGCTGGAGATGGTGTGGTGGG - Intergenic
1075464039 10:122638103-122638125 CAAGTGGCAGATGCTGTGATTGG + Intronic
1075638225 10:124044809-124044831 CACGTAGGAGTTGGTGAGGTAGG + Exonic
1077883980 11:6372261-6372283 CATGTGCAAGGTGCTGTGGTGGG - Intergenic
1078133639 11:8634565-8634587 GATGTAAGGGTTGCTGTGGTAGG + Intronic
1079012579 11:16841504-16841526 AGTGTAGGAGGTGCTGTGGCAGG + Intronic
1079214023 11:18490243-18490265 GATGAAGGAGATGCTGGGGAGGG - Intronic
1079377995 11:19911154-19911176 CATGTGCCAGATGCTGTGCTTGG + Intronic
1079392323 11:20033425-20033447 AAAGTAGGAGATGATGTGGGTGG + Intronic
1081984004 11:47288599-47288621 CATCTTGCAGATGCTGTTGTGGG - Intronic
1086487730 11:87326511-87326533 CATGAAGTACATTCTGTGGTTGG + Intergenic
1090277024 11:125427397-125427419 CATCTGGGGGATGCTGAGGTAGG + Intronic
1090966221 11:131599697-131599719 CATGTGACAGATGCTGTGATAGG + Intronic
1091123702 11:133078298-133078320 AATGTAGGTGATACTGTGTTGGG - Intronic
1093253790 12:16840746-16840768 CAGGTAGGAGATACAATGGTTGG + Intergenic
1094093899 12:26682142-26682164 CATGTGGGAGTTACTGTGTTCGG - Intronic
1094456220 12:30637101-30637123 CCTGCAGTAGATGCTGTGGTGGG - Exonic
1095234571 12:39781402-39781424 CGTGGAGGAGGTGCTGTGGAAGG - Intronic
1095461272 12:42446701-42446723 GATGTAGGAGATGGTCAGGTTGG + Exonic
1095629895 12:44363304-44363326 CATGTAGTAGATTCTGTACTAGG - Intronic
1095642849 12:44504636-44504658 CATGTAGAAGATGCTGTCAGAGG - Intergenic
1100376318 12:94019097-94019119 CATGTTGAAGATGCTGAGCTTGG - Intergenic
1101316318 12:103632396-103632418 CTTGTTGGAGAGGGTGTGGTGGG + Intronic
1102124216 12:110467576-110467598 CATTTAGGAGAAGTTGTGCTCGG - Intronic
1102916933 12:116761068-116761090 CGTGGAGGAGATGCTGCTGTTGG - Intronic
1103702383 12:122854734-122854756 CCTGTGGGAGACGCTGTGGGAGG - Intronic
1104221830 12:126792282-126792304 CATGAATGAGGTGTTGTGGTAGG - Intergenic
1104886367 12:132111556-132111578 CATGTGGGACATGCTCTTGTTGG - Intronic
1106768184 13:32936929-32936951 CCTGTGGGGGATGCTTTGGTTGG + Intergenic
1108274910 13:48797834-48797856 AATCTAGGAGATTTTGTGGTAGG + Intergenic
1109781749 13:67119769-67119791 CAACTAGGACATGCTGTGGTGGG + Intronic
1111633798 13:90877386-90877408 CATGCACGGGATGGTGTGGTCGG + Intergenic
1112921031 13:104613031-104613053 CATGTGTGAGCTTCTGTGGTTGG - Intergenic
1113909169 13:113834029-113834051 CAGGTAGGTCATGCTGTGATAGG + Intronic
1113909180 13:113834091-113834113 CAGGTAGGTCATGCTGTGATAGG + Intronic
1114912949 14:27223222-27223244 CATGTTGCTGAGGCTGTGGTTGG + Intergenic
1114996009 14:28352881-28352903 CATGTAGAAGATACTGAGTTAGG - Intergenic
1115170875 14:30505369-30505391 CAGGAAGCAGAGGCTGTGGTTGG - Intergenic
1116424595 14:44775270-44775292 CCTCTACTAGATGCTGTGGTGGG + Intergenic
1119265824 14:73262806-73262828 CCTGTAGGAGGAGCTGTGGAAGG - Exonic
1119739207 14:77003231-77003253 CATGTAGGAGATGATGGAATTGG - Intergenic
1120418130 14:84245672-84245694 GATGTGGGAGATGCTGTGTGGGG + Intergenic
1121983747 14:98478546-98478568 CACGCAGGACATGCTGAGGTAGG + Intergenic
1125545243 15:40498550-40498572 CATGCTGGAGATGCAGTGGTAGG - Intergenic
1126456815 15:48871602-48871624 CATGGAGGAAATGCTGAGCTGGG - Intronic
1127842916 15:62846103-62846125 CCAGTGGGAGATGCTGTAGTGGG + Intergenic
1130902704 15:88219095-88219117 CATGAAGGAAAGGCTGTGGAAGG + Intronic
1132731201 16:1362874-1362896 CGTGTAGGGGATGCCGTGCTGGG - Exonic
1134856379 16:17523342-17523364 CATGTATAAGATGCTGAGGAGGG + Intergenic
1135703919 16:24657891-24657913 AATGTAGGAAATGCTGTTTTAGG - Intergenic
1137554583 16:49462479-49462501 CATAAAGGAGATGCAGTTGTGGG + Intergenic
1137989474 16:53138985-53139007 CCTGGAGGAGGTGCTGTGGGAGG + Intronic
1139521430 16:67484680-67484702 CCTGTAGTAGAGGCTGAGGTGGG + Intergenic
1140143856 16:72286380-72286402 CATGAAGGAGATGGAGTGCTAGG - Intergenic
1144322515 17:14143500-14143522 CATCTCTGAGATGCTGTGTTGGG - Intronic
1144824735 17:18099521-18099543 TATGTGGCAGAGGCTGTGGTAGG + Intronic
1146675316 17:34769372-34769394 TGTCTAGTAGATGCTGTGGTGGG - Intergenic
1148953609 17:51335664-51335686 GATGTAAGAGAAGCTGTGGTAGG + Intergenic
1149188973 17:54035324-54035346 AATGTAGGAGATACAGTGATGGG - Intergenic
1150111307 17:62502920-62502942 TATGTAGTAGATACTGTGCTAGG + Intronic
1150927884 17:69553210-69553232 TATGTAGGTCATTCTGTGGTGGG + Intergenic
1151293029 17:73164319-73164341 CATGTAGGAGAGACTGTGCTGGG + Intergenic
1152497893 17:80687286-80687308 CATGTGAGGGATGGTGTGGTGGG - Intronic
1155003025 18:21704764-21704786 CAGGCAGGAGACACTGTGGTCGG - Exonic
1155994992 18:32321776-32321798 AAAGTGAGAGATGCTGTGGTTGG - Intronic
1156354760 18:36331653-36331675 CTTGTTGGAGAAGGTGTGGTTGG + Intronic
1159002990 18:62989443-62989465 CATGAAGGAGATGCTCCCGTGGG - Intergenic
1159964192 18:74579819-74579841 TGTGTGTGAGATGCTGTGGTTGG + Intronic
1165150146 19:33755439-33755461 CCTGGGGAAGATGCTGTGGTGGG + Intronic
926443796 2:12919877-12919899 CATGTGGGAGGTACTGTGCTTGG - Intergenic
928066134 2:28166302-28166324 GAAGTAGGAGATGCTGCAGTAGG + Intronic
928256280 2:29725712-29725734 CATGTAGGACATGCTTTGCAGGG + Intronic
931905329 2:66836516-66836538 AATGTAGGAGATGCTGGGAGGGG + Intergenic
932120053 2:69090432-69090454 CATGGAGGAGATGCTGGGGCAGG - Intronic
932288722 2:70557362-70557384 CAGGGAGGAGAGGCTGTGATTGG - Intergenic
932411529 2:71550626-71550648 CATGCAGGACATGCTGGGGGTGG + Intronic
935526193 2:104170793-104170815 CTTGTATGACATGCTCTGGTGGG - Intergenic
937473370 2:122192275-122192297 TATATAAGAGATGCTGTTGTAGG - Intergenic
937803806 2:126113836-126113858 CATGTAGTAGATCTTGTGTTTGG - Intergenic
939033137 2:137100531-137100553 TATGTATGAGATGATGTGTTGGG - Intronic
941783436 2:169474061-169474083 CATAGAGGAGAAGCTGGGGTAGG + Intergenic
942213773 2:173697818-173697840 GATGTTGGAGATGCTGATGTTGG - Intergenic
942213774 2:173697833-173697855 GATGTTGGAGATGCTGATGTTGG - Intergenic
942828962 2:180215588-180215610 AATGTAGGTGCTGCTGTGTTGGG - Intergenic
942855016 2:180535046-180535068 CATGTAGGAGAAGATGTGATGGG + Intergenic
944235970 2:197441705-197441727 CCTGTAGAGGATGCTATGGTGGG - Intergenic
945133270 2:206597592-206597614 AATGTAACAGATGCTGTAGTAGG - Intronic
945568870 2:211439043-211439065 CATGTAGGAGATGCTGTGGTGGG + Intronic
945919640 2:215742661-215742683 CATGTTGGAGATGAGCTGGTGGG + Intergenic
946639865 2:221772793-221772815 ATTGTAGGAGATGATGTGGGAGG + Intergenic
948062911 2:235054794-235054816 CTTATTGCAGATGCTGTGGTTGG + Exonic
948180077 2:235972762-235972784 CTTGTAGGAGGTGCTGTGAAAGG - Intronic
948713020 2:239836906-239836928 CAGAGAGGAGATGCTGGGGTGGG - Intergenic
1169519170 20:6352520-6352542 CATGTCAGAGCTGCTGTGTTTGG + Intergenic
1170004126 20:11646956-11646978 CATGGGGGAGAAGCTGAGGTGGG + Intergenic
1171091614 20:22290725-22290747 CCTGGAGCAGATGCTGTGGGAGG + Intergenic
1171162959 20:22945051-22945073 CATGTGGGAGACACTGTGGGAGG + Intergenic
1172600978 20:36182796-36182818 CATGTAAAAGCTGCTGTGCTGGG + Intronic
1172881421 20:38202328-38202350 GATGTAGGAGAGGCTTGGGTAGG + Intergenic
1173843955 20:46176563-46176585 CATGTACGAGGTACTGTGCTGGG + Intronic
1174188515 20:48723545-48723567 CAAGTAGGAGATTGTGGGGTGGG - Intronic
1175191427 20:57214573-57214595 CATGTGTGAGGGGCTGTGGTGGG - Intronic
1176245525 20:64094918-64094940 CATGGGGGAGATGGTGTGGGGGG + Intronic
1177607157 21:23395576-23395598 ACTGTTGGAGATGCTGAGGTAGG + Intergenic
1178016513 21:28352362-28352384 CATGTGGGACATGGTGTGGCAGG - Intergenic
1179051079 21:37889055-37889077 AAGGTAGGAGATGCTGAGGGTGG + Intronic
1179962050 21:44773060-44773082 CATGTAGGTGTTGATGAGGTAGG - Intronic
1180182214 21:46123157-46123179 CTTGTGGGGGATGCTGTGGGGGG - Intronic
1180593513 22:16959597-16959619 CATGTGGGTGATGCTGTGCCAGG + Intergenic
1182234384 22:28864058-28864080 CATGAAGGAGAGGCTGCAGTGGG + Intergenic
1183237969 22:36634304-36634326 CATCTAGGAGAGGCTGTAATGGG - Intronic
1183552435 22:38498138-38498160 CAGGCAGGAGATACTGTGGAGGG + Exonic
1184003361 22:41691197-41691219 TATGGAGGATAGGCTGTGGTTGG - Intronic
1184969270 22:48003523-48003545 CAAGGAGCAGATGCTGTGCTTGG + Intergenic
949433517 3:4003895-4003917 CATTGAGGAAAAGCTGTGGTGGG + Intronic
950430639 3:12948994-12949016 CAGGTACAAGATGCCGTGGTGGG + Intronic
950508011 3:13407683-13407705 CATGGAAGAGTTGCTGTGTTTGG - Intronic
951760818 3:26145648-26145670 AGTGTAGCAGATGCTGGGGTGGG + Intergenic
951908255 3:27724015-27724037 GATGTTGGTGCTGCTGTGGTTGG - Intergenic
952477090 3:33721187-33721209 CATTTCTGAGATGCTGTGATAGG + Intergenic
952738045 3:36709775-36709797 CATGCAAGAGATGCTGGGGTGGG + Intergenic
961272140 3:125697262-125697284 CATGAAAGAGTTGCTGTTGTTGG - Intergenic
961277914 3:125742126-125742148 CATGAAAGAGTTGCTGTTGTTGG - Intergenic
963284364 3:143418625-143418647 CATGGAGAAGTGGCTGTGGTTGG + Intronic
963290744 3:143484649-143484671 CATGTTAGACATGCTGGGGTTGG + Intronic
963577557 3:147080202-147080224 TATTTGGGAGATGGTGTGGTTGG + Intergenic
965814880 3:172626061-172626083 AATGGAGGAGAAGTTGTGGTGGG - Intergenic
966079101 3:175977962-175977984 CATCAAGGAGAAGCTGTGCTAGG - Intergenic
966740853 3:183231988-183232010 AATTTAGGGGATGCTGTGGAAGG + Intronic
969323076 4:6424733-6424755 CGTGTGGGAGATGCAGGGGTGGG + Intronic
970471878 4:16387113-16387135 GATGGAGGTGATGCTGGGGTGGG + Intergenic
970551200 4:17182899-17182921 CATGTTGGAAATGCCATGGTTGG - Intergenic
973746204 4:53965689-53965711 CAAGTAGGAGATGCTCAGGTGGG + Intronic
975510844 4:75192777-75192799 CATGTAGGGGAGGCTGTGGAGGG - Intergenic
976560719 4:86497494-86497516 CATATAGAAGGTGCTGAGGTTGG + Intronic
978350214 4:107813316-107813338 CATGTAGGAGGGGCAGTGGGAGG + Intergenic
982282830 4:153703086-153703108 AATGTAGGTGATCCTGTTGTTGG - Exonic
987700119 5:21386961-21386983 TATGTAGCAGGTACTGTGGTAGG + Intergenic
987940600 5:24531070-24531092 CATGTGGGAAATCCTGAGGTTGG - Intronic
988752288 5:34201116-34201138 TATGTAGCAGGTACTGTGGTAGG - Intergenic
989248746 5:39282905-39282927 AATTTAGGAGATGCTATTGTTGG + Intergenic
990567736 5:57046626-57046648 AATGTATGTGTTGCTGTGGTTGG + Intergenic
991454520 5:66788446-66788468 CATGCAGGAGATGATGTTGGAGG + Intronic
991740050 5:69661943-69661965 TATGTAGCAGGTACTGTGGTAGG - Intergenic
991757450 5:69891241-69891263 TATGTAGCAGGTACTGTGGTAGG + Intergenic
991791625 5:70241684-70241706 TATGTAGCAGGTACTGTGGTAGG - Intergenic
991819513 5:70538060-70538082 TATGTAGCAGGTACTGTGGTAGG - Intergenic
991836853 5:70767123-70767145 TATGTAGCAGGTACTGTGGTAGG + Intergenic
991884074 5:71242022-71242044 TATGTAGCAGGTACTGTGGTAGG - Intergenic
993683384 5:90907788-90907810 CACCTAGCAGATACTGTGGTAGG - Intronic
993921133 5:93803881-93803903 CATGAAAGAGATGCTGGGTTAGG + Intronic
994768791 5:103955358-103955380 CATTTAGCAGATTCTGTGGAAGG - Intergenic
996447362 5:123571068-123571090 CATCTAAGAGTGGCTGTGGTAGG + Intronic
998528823 5:142866728-142866750 CATTTAGGAAATGCTGTTTTAGG + Intronic
999511356 5:152255962-152255984 CATGCATGTGATGCAGTGGTAGG + Intergenic
1001145432 5:169179880-169179902 CATGTGCTAGATGCAGTGGTAGG + Intronic
1001146003 5:169185339-169185361 CATGTATGAGATGGTGAGGCTGG + Intronic
1001823315 5:174726199-174726221 CAGGTAGGGGATGGCGTGGTGGG - Intronic
1003488618 6:6601232-6601254 CATTTGGGAGAAGCAGTGGTAGG + Intronic
1004183496 6:13401013-13401035 CAAGTATGTGATGCTGTTGTTGG - Intronic
1004550924 6:16646436-16646458 CATATATCAGATTCTGTGGTTGG - Intronic
1005550453 6:26907838-26907860 TATGTAGCAGGTACTGTGGTAGG - Intergenic
1006632185 6:35437452-35437474 CATGTAGTAGATGGGGAGGTTGG + Intergenic
1008877021 6:56340340-56340362 CTTGAAGGAGAAGTTGTGGTGGG + Intronic
1012306633 6:97666873-97666895 GATGTAGGAGATGATGTAGGGGG - Intergenic
1012642945 6:101644526-101644548 CCTGTAGAAGAGGCTGTGGCTGG + Intronic
1013481924 6:110560399-110560421 CATGCAGAAGGTGCTGTGATAGG - Intergenic
1016373702 6:143399218-143399240 CATGTATGTGATGAAGTGGTGGG + Intergenic
1016546057 6:145225624-145225646 CATGTGGGTTATGCTGTGTTAGG + Intergenic
1017619306 6:156279274-156279296 CATTTAGGATAAACTGTGGTTGG - Intergenic
1017750434 6:157486330-157486352 CAGGTAGGAGATGCTGTGCTTGG - Intronic
1018845417 6:167552058-167552080 CAGGAAGCAGGTGCTGTGGTGGG + Intergenic
1021439170 7:20658851-20658873 ACAGAAGGAGATGCTGTGGTTGG + Intronic
1021918093 7:25455616-25455638 CATGCAGGAGACGCTGGTGTAGG - Intergenic
1023119591 7:36895855-36895877 TATGTGCCAGATGCTGTGGTAGG + Intronic
1024470776 7:49767224-49767246 TATGTAGGGGATGCTTTGCTTGG - Intergenic
1024544570 7:50506244-50506266 CACAGAGGAGATGCTGGGGTAGG + Intronic
1024888683 7:54176561-54176583 GCTGTAGGTGATGCTATGGTTGG + Intergenic
1024974295 7:55099274-55099296 TATGTAACAGATGCTGTGCTGGG + Intronic
1032001073 7:128265665-128265687 CAAGTGGGAGATGGTGTGATTGG - Intergenic
1032040508 7:128556833-128556855 TATGTAGTAGATACTGTGCTAGG + Intergenic
1032658292 7:133955325-133955347 CATAGAGGAGACCCTGTGGTGGG + Intronic
1033327619 7:140392515-140392537 CAGGTAGGAGATGCTGCTGGTGG - Intronic
1036913603 8:12782929-12782951 TATGTAGGTGATCCTGTGTTGGG + Intergenic
1037057551 8:14461165-14461187 AATGTAGGAGATGCTTTTGATGG - Intronic
1041290988 8:56308293-56308315 CCTCTAGGGGATGCTGTGGTAGG + Intronic
1042873042 8:73415239-73415261 CATGAAGGAGATTTTGTGGCAGG + Intergenic
1044261626 8:90131455-90131477 CAGGTAGTAGATCCTGTGGGAGG + Intergenic
1045811071 8:106220706-106220728 CAAGTGGGAGATACTGTGTTGGG + Intergenic
1046058087 8:109102451-109102473 CATGTACCAGATACTGTGCTAGG - Intronic
1046176287 8:110579251-110579273 CATATATGACATGCTGTGCTAGG + Intergenic
1046475665 8:114739952-114739974 CATGTATGAGACACTGTGGTAGG + Intergenic
1046661410 8:116951540-116951562 CATGTGGTAGATGCTGTCATAGG - Intronic
1046661451 8:116951944-116951966 CATGTGGTAGATGCTGTCTTAGG + Intronic
1047438357 8:124854661-124854683 CATGTCCAAGATACTGTGGTAGG + Intergenic
1048868018 8:138775125-138775147 CATGTCTGAGATGCTTTGCTGGG - Intronic
1049023701 8:139974448-139974470 CATGTGGGTGTTTCTGTGGTGGG - Intronic
1049355274 8:142184647-142184669 CCTGGACGAGGTGCTGTGGTTGG - Intergenic
1049812928 8:144583697-144583719 CATGTTGGCGGTGCTGTTGTGGG + Intronic
1050104400 9:2150483-2150505 CAGGCAGCAGATGCTGTGGGTGG + Intronic
1052046914 9:23804705-23804727 AATGTAGGTTATGCTTTGGTGGG - Intronic
1053365265 9:37518302-37518324 GTTGCAGGAGATGCTGTTGTTGG + Exonic
1053506012 9:38643741-38643763 GATGCAGGAGATGCTGGGGAGGG + Intergenic
1056779600 9:89539222-89539244 CATGCAGGAGCTGGTGTCGTGGG + Intergenic
1057200134 9:93135262-93135284 CATGAAGGAGGAGCTGTCGTGGG + Intergenic
1058782684 9:108354045-108354067 CTGGTGGGAGATGCTGTGCTTGG + Intergenic
1058893170 9:109378728-109378750 CATGTAGGAGATTCAGTAGTCGG + Exonic
1061119265 9:128633228-128633250 CATGTGGGAGACGCAGTAGTCGG - Exonic
1061252469 9:129434636-129434658 CAGCTGGGAGATGCTGGGGTGGG - Intergenic
1062733441 9:138121569-138121591 CTTGTAGGTGATGCTGGGGCGGG - Exonic
1186289004 X:8076417-8076439 CATGTTTCAGATACTGTGGTAGG + Intergenic
1186515805 X:10165399-10165421 CATGAAGGAGAGGCTGTGGGTGG + Intronic
1187764141 X:22620919-22620941 AATGTTGCAGATACTGTGGTAGG - Intergenic
1189692129 X:43627629-43627651 CCTGTAGTGGATGCTATGGTTGG + Intergenic
1192448162 X:71225630-71225652 CTTGTAGGGGATGCTGAGTTTGG - Intergenic
1193822981 X:86188942-86188964 CATGTGCTAGATGCTGTGGAGGG - Intronic
1195743286 X:108088514-108088536 CATACAGGAGAGGCTGAGGTAGG - Intronic
1196984663 X:121254654-121254676 CATGCTGGTGATGCTGGGGTGGG + Intergenic
1197304238 X:124820980-124821002 CTTGTGGTAGATGCTGTGGAGGG - Intronic
1197518610 X:127469883-127469905 GATGTAGGATATGCTGAGGCAGG - Intergenic
1198757322 X:139995310-139995332 CATTTAGGAGAAGGTATGGTGGG + Intergenic
1199340108 X:146667654-146667676 CCTATAGGAGAGGCTTTGGTGGG + Intergenic