ID: 945569101

View in Genome Browser
Species Human (GRCh38)
Location 2:211441743-211441765
Sequence TCTTCCACACAGCCCTAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 230}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945569094_945569101 12 Left 945569094 2:211441708-211441730 CCTTCCATCCTCCTTACCATGTC 0: 1
1: 1
2: 6
3: 34
4: 376
Right 945569101 2:211441743-211441765 TCTTCCACACAGCCCTAGGGAGG 0: 1
1: 0
2: 0
3: 14
4: 230
945569097_945569101 1 Left 945569097 2:211441719-211441741 CCTTACCATGTCAGTGCTCTGCT 0: 1
1: 0
2: 0
3: 10
4: 205
Right 945569101 2:211441743-211441765 TCTTCCACACAGCCCTAGGGAGG 0: 1
1: 0
2: 0
3: 14
4: 230
945569092_945569101 27 Left 945569092 2:211441693-211441715 CCATTGCAATTATGCCCTTCCAT 0: 1
1: 0
2: 0
3: 30
4: 202
Right 945569101 2:211441743-211441765 TCTTCCACACAGCCCTAGGGAGG 0: 1
1: 0
2: 0
3: 14
4: 230
945569093_945569101 13 Left 945569093 2:211441707-211441729 CCCTTCCATCCTCCTTACCATGT 0: 1
1: 0
2: 3
3: 42
4: 392
Right 945569101 2:211441743-211441765 TCTTCCACACAGCCCTAGGGAGG 0: 1
1: 0
2: 0
3: 14
4: 230
945569096_945569101 4 Left 945569096 2:211441716-211441738 CCTCCTTACCATGTCAGTGCTCT 0: 1
1: 0
2: 0
3: 12
4: 161
Right 945569101 2:211441743-211441765 TCTTCCACACAGCCCTAGGGAGG 0: 1
1: 0
2: 0
3: 14
4: 230
945569098_945569101 -4 Left 945569098 2:211441724-211441746 CCATGTCAGTGCTCTGCTGTCTT 0: 1
1: 1
2: 2
3: 36
4: 264
Right 945569101 2:211441743-211441765 TCTTCCACACAGCCCTAGGGAGG 0: 1
1: 0
2: 0
3: 14
4: 230
945569095_945569101 8 Left 945569095 2:211441712-211441734 CCATCCTCCTTACCATGTCAGTG 0: 1
1: 0
2: 0
3: 18
4: 243
Right 945569101 2:211441743-211441765 TCTTCCACACAGCCCTAGGGAGG 0: 1
1: 0
2: 0
3: 14
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945569101 Original CRISPR TCTTCCACACAGCCCTAGGG AGG Intronic
902005553 1:13229188-13229210 TCTTCCACTCAGGACTAGGAAGG + Intergenic
902024873 1:13375465-13375487 TCTTCCACTCAGGACTAGGAAGG + Intergenic
903587078 1:24424344-24424366 TGATCCACACAGCCGTTGGGAGG - Intronic
904294918 1:29513909-29513931 TCTTCCTCACAGCCCTCAGAAGG - Intergenic
904605325 1:31694994-31695016 TCTTCCACACAGTCCTGGCTTGG + Intronic
905019400 1:34798017-34798039 TCTCCCTCACAGCCCTCGGAAGG - Intronic
905367525 1:37461822-37461844 TCTTCCTTACAGCCCTCGGAAGG + Intergenic
905478122 1:38243149-38243171 TCTTCCTCACAGCCCTCAGAAGG + Intergenic
906656730 1:47553747-47553769 TCTTCCTCACAGCCCTCAGAAGG + Intergenic
907483655 1:54761826-54761848 ACTGCCACAGAGCCCTAGTGTGG + Intronic
913511969 1:119570405-119570427 GCTTCCACACAGCTCAGGGGAGG + Intergenic
913516192 1:119607568-119607590 ACTTCCACACAGCTCAGGGGAGG + Intergenic
914955031 1:152154442-152154464 TCTTGCACATAGTCATAGGGGGG + Exonic
915168478 1:153962113-153962135 TCTTCCACACAGTCATGGAGTGG + Intronic
915904955 1:159870984-159871006 TCTTCCCAAGACCCCTAGGGAGG + Intronic
916022652 1:160807767-160807789 TTTTCCACAGGGGCCTAGGGTGG - Intronic
916318781 1:163479786-163479808 TCTTCCATACTGCCCTAGCAGGG - Intergenic
917540077 1:175903391-175903413 TGCTCCAAACAGCCCTATGGTGG - Intergenic
921130080 1:212212204-212212226 TCTTCCTCATAGCCATAGGTTGG - Intergenic
923291356 1:232549133-232549155 TCCTCCACACAACCCAAGTGAGG + Intronic
923330631 1:232920777-232920799 TCTTCCCCACAGCCCTCAGAAGG + Intergenic
1062865400 10:847924-847946 TCTTCCACACAGCCATACACTGG - Intronic
1063570954 10:7214022-7214044 TCTTCTGCACAGTCCTGGGGTGG - Intronic
1066062573 10:31737027-31737049 AGTTCCACAAATCCCTAGGGCGG + Intergenic
1067174175 10:43930839-43930861 TCCTCCACACAGCCCCAAGCAGG - Intergenic
1067810071 10:49419210-49419232 TCTTCCCCACAGCCCTTGGCAGG - Intergenic
1069826933 10:71260301-71260323 CTTTCCCCACAACCCTAGGGAGG + Intronic
1070729821 10:78818897-78818919 TCTTCCTCACAGCCCTCAGATGG + Intergenic
1070744878 10:78927641-78927663 GCTCCCACACAGCCCCAGGAAGG + Intergenic
1070823858 10:79379749-79379771 TCCCGCACACAGCCCTGGGGTGG - Intergenic
1073215557 10:101834198-101834220 GCTGCCCCACAGCACTAGGGAGG - Intronic
1074777235 10:116775385-116775407 TCTTCTAGAGAGCCCTGGGGAGG + Intergenic
1076631738 10:131855936-131855958 TCTTCCCCATAGCCCTGGGAAGG - Intergenic
1078074684 11:8147690-8147712 TCTACCTAACAGGCCTAGGGAGG - Intronic
1078709337 11:13775817-13775839 TCTCCCTCACAGCCCTAAGAAGG - Intergenic
1079097978 11:17523123-17523145 TCTGCCACACACTCCCAGGGTGG - Intronic
1081153693 11:39663682-39663704 TCTTCCTCCCAGCCCAAAGGCGG - Intergenic
1081615332 11:44587478-44587500 TCGTCCACACAGCAGCAGGGAGG - Exonic
1083180330 11:60981190-60981212 TCCTCGTCACAGCCCTAAGGAGG + Intronic
1083233139 11:61335757-61335779 ACTTCCCAACAGCCCTATGGAGG - Intronic
1083312504 11:61791773-61791795 TCTTCCCTACAGCCTTAGGAAGG - Intronic
1084147380 11:67272253-67272275 TCTTCCACAGAGGTCAAGGGGGG + Intronic
1085534921 11:77212002-77212024 TCTTTCCCACAGTCCTAGGGAGG - Intronic
1087004332 11:93454218-93454240 TCTACCCCTCACCCCTAGGGTGG + Intergenic
1087385846 11:97467593-97467615 TCTCACACACAGCCCTAAGACGG - Intergenic
1089300453 11:117495600-117495622 TCTAGCACACAGCTCTAGGGAGG + Intronic
1089590094 11:119534464-119534486 TCTTCCACACTGCCTTGGGCAGG - Intergenic
1089686914 11:120156769-120156791 TCATCCCCATAACCCTAGGGTGG + Intronic
1090423586 11:126592063-126592085 CCTTGCTCACAGCCCTAGGTGGG + Intronic
1091170262 11:133514002-133514024 ACTTCTCCACAGCCCTAGAGGGG - Intronic
1092802147 12:12179618-12179640 TCTTCCACATAATCCTAGGATGG - Intronic
1093582054 12:20794226-20794248 CCTTCCAGAGAGCCCTAGGAAGG - Intergenic
1096935462 12:55268953-55268975 CCTTCCACACTGCCCTACAGAGG - Intergenic
1099846152 12:88031056-88031078 CCTTCCACACTGCCCTAGCAGGG + Intronic
1101042382 12:100769738-100769760 TCTACCACACAGCTATGGGGTGG - Intronic
1104003220 12:124873693-124873715 TCCTCCCCTCAGCCCCAGGGTGG + Intronic
1107835666 13:44410743-44410765 TCTTCCACACAGCTCTCAGAGGG - Intergenic
1109655766 13:65388234-65388256 CCTTCCACACTGCCCTAGTAGGG - Intergenic
1110261483 13:73490299-73490321 TCTGCCTCACAGCCCTCGGAAGG + Intergenic
1111454422 13:88461799-88461821 TCTTCCTCACAGCCTTCAGGAGG - Intergenic
1113265102 13:108608177-108608199 TCGTGCACATAGGCCTAGGGCGG + Intronic
1113284947 13:108836403-108836425 CCTTCCACACTGCCCTAGCAGGG - Intronic
1113739411 13:112700970-112700992 TCTTCCCCACAGCGCTAACGTGG - Intronic
1117627403 14:57653905-57653927 TCTTCCTCACAGCCCTCAGAAGG - Intronic
1118973901 14:70661076-70661098 TCTTCCTCACAGCCCTCAGAGGG - Intronic
1119208361 14:72811435-72811457 TCTTCCTCACAGCCCTCAGAAGG + Intronic
1119387723 14:74268195-74268217 TCCTCCACACAGCCTCAGTGAGG + Intergenic
1119479724 14:74951850-74951872 TCTCCCACACACCCATAGCGGGG - Intronic
1120042231 14:79767205-79767227 TCTTCCTCCCAGCCCTACTGGGG + Intronic
1120636993 14:86965212-86965234 TCTTGCACACTGCCCTAGCAGGG - Intergenic
1121096258 14:91219978-91220000 TCTTCCCCTCAGCCCGATGGAGG + Intronic
1122156627 14:99753993-99754015 TCTTAGACACAGACCTGGGGTGG - Intronic
1122529364 14:102415109-102415131 TCCTCCACACAGCCCTGGTGAGG + Intronic
1122615931 14:103017995-103018017 TTTTCCACAGACCCGTAGGGGGG + Intronic
1129985830 15:79919266-79919288 TCTTCCACACAGAGCCAGGCTGG + Intronic
1132292365 15:100712544-100712566 TCTCCCACACAGCCCTCAGATGG - Intergenic
1132506446 16:311893-311915 TCTGCCACGCAGCCCTGGGTCGG - Intronic
1133406669 16:5529996-5530018 TCTTCCTCACAGCCCTGAGAAGG + Intergenic
1134295805 16:12944735-12944757 TTTTCCAAACAGTCTTAGGGAGG - Intronic
1134397853 16:13881953-13881975 TCTTCCCCAAAGTCCTAGGTGGG + Intergenic
1135119234 16:19751126-19751148 TCTTCCCCACAGCCCTGGTGAGG - Intronic
1135880233 16:26248528-26248550 TCTTCAACTCTGCCCTAGGATGG + Intergenic
1136276187 16:29180639-29180661 CCCTCCACACAGCACAAGGGTGG + Intergenic
1138061374 16:53894269-53894291 TCATCCACACAGCCATGGGCAGG - Intronic
1139573297 16:67826428-67826450 GCTTCCCCATAGCCCTAGGAGGG - Exonic
1141931582 16:87208158-87208180 ATTTCCAAACAGCCCTTGGGTGG + Intronic
1142080566 16:88146698-88146720 CCCTCCACACAGCACAAGGGTGG + Intergenic
1142941410 17:3382612-3382634 TCTGCCTTACAGCACTAGGGAGG + Intergenic
1143098177 17:4489649-4489671 TCCTCCCAACAGCCCCAGGGAGG + Intergenic
1144295787 17:13873701-13873723 TCTTCCTCACAGCCCTCCAGAGG + Intergenic
1144948256 17:18980773-18980795 TCTTACACACTGCCCTAGACAGG - Intronic
1146369819 17:32258640-32258662 TCAGCCACACAGCCCAAGCGAGG - Intergenic
1146866372 17:36338303-36338325 TGTTCCACACAGACTTAGAGTGG - Intronic
1147069242 17:37938915-37938937 TGTTCCACACAGACTTAGAGTGG - Intergenic
1147080770 17:38018452-38018474 TGTTCCACACAGACTTAGAGTGG - Intronic
1147096713 17:38142412-38142434 TGTTCCACACAGACTTAGAGTGG - Intergenic
1148587050 17:48788427-48788449 TCTTCCTCACAGCCCCCTGGGGG + Intronic
1148847879 17:50539850-50539872 TCTTGGACACTGACCTAGGGAGG + Intronic
1149845095 17:60004555-60004577 TGTTCCACACAGACTTAGAGTGG + Intergenic
1150650848 17:67009158-67009180 TCTCCCTCACAGCCCTCAGGAGG + Intronic
1150726212 17:67653421-67653443 TCCTCCTCACAGCCCTTGGAAGG + Intronic
1152830981 17:82496943-82496965 TCCTCCACACAGCCTTAGAGGGG + Intergenic
1155108260 18:22688473-22688495 ACTTCCACAAAGCCCTAGCATGG + Intergenic
1159244842 18:65792449-65792471 GCTAACACGCAGCCCTAGGGTGG - Intronic
1159781912 18:72669634-72669656 TCTACCTCACAGCCTTAGGGTGG - Intergenic
1160172650 18:76567681-76567703 TCTCCCACCCTGCCCTCGGGAGG - Intergenic
1160803049 19:979419-979441 CCTCCAACACAGCCCTGGGGAGG - Intergenic
1161028464 19:2047343-2047365 TCTTCCCCACGGCCCTGTGGAGG - Intronic
1163350021 19:16770674-16770696 TCTTCCCAGCAGCCCTAGGTGGG - Intronic
1166906956 19:46118047-46118069 CCATCCCCACAGCCCTAGGGTGG + Intergenic
1167663702 19:50811398-50811420 TTGTCCTCACAGCCCTAGAGTGG - Intergenic
1167873231 19:52390568-52390590 TCCTCCACACATTCATAGGGAGG - Intergenic
925061795 2:897196-897218 CCCTCCACACAGCCCTAGTAGGG - Intergenic
926841572 2:17086740-17086762 TATTCTACACAGCCCTGGGAAGG + Intergenic
927401869 2:22721177-22721199 CCTTCCACACTGCCCTAGCAGGG + Intergenic
927641110 2:24846109-24846131 CCTTCCACACTGCCCTAGCAGGG - Intronic
930120947 2:47760311-47760333 TCTTCCACACAGCCAAATGGAGG + Intronic
930333445 2:50016038-50016060 TGTTCTACAAAGCCCTAGAGAGG - Intronic
931714634 2:65019446-65019468 TCTTCCCCACAACCCTGGTGTGG - Intronic
932418908 2:71589984-71590006 TCTTCTCCCCAGCCCTAGGCTGG + Intronic
935795286 2:106635030-106635052 TCTTCCTCACAGCCCTCAGAAGG + Intergenic
936339455 2:111618315-111618337 TCCTCCAAAAAGCCCTGGGGAGG + Intergenic
937061426 2:118982804-118982826 TCTTCCACATTTTCCTAGGGGGG + Intronic
937935681 2:127242097-127242119 CCTTCCACACTGCCCTAGCAGGG + Intergenic
938292524 2:130157633-130157655 GCGCCCACACAGCCCTGGGGAGG + Intronic
938989908 2:136617061-136617083 TCTTCCTCACAGCCCTCAGAAGG - Intergenic
939857774 2:147381296-147381318 TCTTCCACACAGCCCTTCCTAGG + Intergenic
942323854 2:174759005-174759027 TCTTCCTCACAGCCCTCAGAAGG + Intronic
944250224 2:197574032-197574054 CCTTCCACACTGCCCTAGCAAGG - Intronic
944301163 2:198126490-198126512 CCCTCCACACAGCCCCTGGGTGG - Intronic
945569101 2:211441743-211441765 TCTTCCACACAGCCCTAGGGAGG + Intronic
946281804 2:218671474-218671496 TCTCTCACACAGCACTAGTGAGG - Intronic
948784582 2:240345713-240345735 TCTTCCCCACAGCCCCCAGGAGG - Intergenic
1169292185 20:4362186-4362208 TCTTCCTCACAGCCCTCAGATGG + Intergenic
1169318088 20:4609588-4609610 CCTTCCACACAGGCCCAGGGAGG - Intergenic
1171133608 20:22677438-22677460 TCTTCCTCACAGTCCTCGGAAGG + Intergenic
1177998489 21:28131809-28131831 AGTTCCACAGATCCCTAGGGTGG + Intergenic
1178765323 21:35445488-35445510 TCTTCCTCACATCCGTCGGGAGG - Intronic
1182330153 22:29545927-29545949 CCTTCCACACTGCCCTAGCAGGG + Intronic
1182895423 22:33855509-33855531 TGTACCACACAGCCCTGGTGAGG - Intronic
1183492009 22:38121816-38121838 TCTTCCACAGGGTCCAAGGGCGG - Intronic
1183776771 22:39971305-39971327 CCTTCCACACACCCCTGAGGGGG - Exonic
1184321027 22:43742346-43742368 TATTCCACTCAGCCCTTGGAAGG - Intronic
1184679386 22:46061969-46061991 TCCTCCAGGCAGCCCCAGGGCGG - Intronic
1184807583 22:46805502-46805524 TCTTCCTCACAGCTCTAAAGGGG + Intronic
950860074 3:16140223-16140245 TCTGCCACAGAGCCCTGGGAGGG + Intergenic
951456515 3:22898282-22898304 TCTCCCTCACAGCCCTCAGGAGG + Intergenic
952054701 3:29430610-29430632 GCTTACAAAGAGCCCTAGGGGGG + Intronic
953379872 3:42461371-42461393 TCTTCTACAAAGCAATAGGGAGG - Intergenic
953793915 3:45968317-45968339 ACTACCACACAGCCCTGCGGCGG - Exonic
954979442 3:54731026-54731048 TCTACCACACAGAACTAGGTTGG + Intronic
955390796 3:58520971-58520993 TAATCCACACAGCCCTGGGAGGG - Intronic
955863125 3:63353509-63353531 TTGTCCACACAGCCCTAAAGTGG + Intronic
956742607 3:72286883-72286905 TCTTGGGCACAGCCCTTGGGAGG - Intergenic
959052990 3:101542140-101542162 TCTGTGACACAGCCCTTGGGAGG + Intergenic
963610519 3:147461477-147461499 ACTTCCACATATCCTTAGGGAGG - Intronic
964589111 3:158341000-158341022 TCATCCACAAATCTCTAGGGTGG - Intronic
964623814 3:158739893-158739915 TCTCCCTCACAGCCTTAGAGAGG - Intronic
965839970 3:172893438-172893460 TCTTCTGCACAGCCCTCGGAGGG + Intronic
967149589 3:186636464-186636486 TCCTCCACAAATCCCTATGGCGG - Intronic
967732053 3:192916318-192916340 TCTTCCTCACTGCCCAAGGACGG - Intronic
967781026 3:193439773-193439795 TCTTCCACACTGCCATATGGAGG + Intronic
968291489 3:197542947-197542969 TCTTCCACAGGGCCTTGGGGAGG - Intronic
969477365 4:7429172-7429194 CCTTCCCCAAAGCCCTAGGCAGG - Intronic
971009375 4:22416189-22416211 TCTTCCACCTGGCCCGAGGGTGG + Intronic
971021966 4:22546150-22546172 CCTTCCACACTGCCCTAGCAGGG + Intergenic
972780924 4:42286314-42286336 TCTACCACAGAGCCCTAGACCGG - Intergenic
975210618 4:71695881-71695903 TCTTCCTCATAGCCCTCAGGAGG - Intergenic
977395740 4:96468677-96468699 TCTTCTGCACTGCCCTAGAGAGG + Intergenic
979360349 4:119756557-119756579 ACTTCCACAAAGCCCAAGGAGGG - Intergenic
980767081 4:137321003-137321025 TCTTCCACGCTGCCCTAGCAGGG + Intergenic
981748837 4:148074515-148074537 TCTTCCACAGAGCCACAGGAGGG - Intergenic
987649348 5:20720104-20720126 TCTTCCTCACAGCCCTTAGAAGG + Intergenic
988471905 5:31547467-31547489 CCTTCCACACTGCCCTAGCAGGG + Intronic
988746210 5:34141429-34141451 TCTTCCTCACAGCCCTTAGAAGG - Intergenic
989203284 5:38786897-38786919 CCTTCCACACTGCCCTACAGAGG - Intergenic
990079583 5:51897032-51897054 CCTTCCTCACAGCCCTTGGAAGG - Intergenic
991251233 5:64563610-64563632 TCTTCCTCACAGCCCTCAGTAGG + Intronic
991939970 5:71841273-71841295 TCTTCCTCACAGCCCTTGGAAGG + Intergenic
993565536 5:89470478-89470500 TTTTCCTCACAGCCCCAGAGTGG - Intergenic
993871209 5:93256534-93256556 TCTCCCTCACAGCCCTCAGGAGG + Intergenic
995141497 5:108740492-108740514 TGCACCACAGAGCCCTAGGGTGG + Intergenic
995312670 5:110731411-110731433 CCTTCCACACTGCCCTAGCAGGG + Intronic
998326130 5:141281468-141281490 TCTTCCTCACAGCCCTCAGAAGG - Intergenic
998534759 5:142919359-142919381 TCTTCCTCACAGACCTCAGGAGG + Intronic
999333128 5:150691718-150691740 TCTTCCACAGAGCCCCAGAGTGG + Exonic
999435462 5:151559883-151559905 ACATGCACACAGCCCTATGGAGG - Intronic
999829285 5:155303653-155303675 TCATCTCCATAGCCCTAGGGTGG - Intergenic
1001470043 5:172005950-172005972 GCATCCACACAGACCTAGGCTGG + Intronic
1003818258 6:9865744-9865766 TCTTCCACACATTCCTTTGGTGG - Intronic
1005544362 6:26849662-26849684 TCTTCCTCACAGCCCTTAGAAGG - Intergenic
1005860787 6:29898295-29898317 AGTTCCACAGATCCCTAGGGAGG - Intergenic
1007311086 6:40946487-40946509 TCTCCCTCCCAGCCCTAAGGAGG - Intergenic
1009015150 6:57891290-57891312 TCTTCCTCACAGCCCTTAGAGGG - Intergenic
1010102699 6:72128118-72128140 TCTTCCTCACAAACCTAGAGAGG + Intronic
1014614100 6:123581383-123581405 TCTTCAACAAGGCCCTAGGTAGG + Intronic
1015159652 6:130138358-130138380 CTTTCCTCACAGCCCTCGGGAGG - Intronic
1017644757 6:156528625-156528647 TCTTCTGCACAGCCTTAAGGAGG - Intergenic
1017787637 6:157769605-157769627 TCTCCCACGCTGCCCTCGGGAGG - Intronic
1019167667 6:170109371-170109393 ACGTCCACACACCCCTGGGGCGG + Intergenic
1019556677 7:1635034-1635056 TCTGCCACACATCCCCAGAGTGG + Intergenic
1021754053 7:23833901-23833923 CCTTCCACACTGCCCTAGCAGGG - Intergenic
1023861756 7:44220956-44220978 CCCTCCACACAGCCCAGGGGAGG + Intronic
1023877025 7:44292092-44292114 TCTCCCTCCCAGCCCTAGGAAGG - Intronic
1027535531 7:79395516-79395538 TCTTCCAGAGAGCCCCAGAGAGG + Intronic
1031298821 7:120039099-120039121 CCTTCCACACTGCCCTAGCAGGG + Intergenic
1032460033 7:132103405-132103427 TTTTCAACAAAGCCCTAGTGTGG - Intergenic
1033598817 7:142874783-142874805 TCATACACACAGCACTAGAGAGG + Intronic
1034672513 7:152869313-152869335 TTTTCCACCCATCCCCAGGGTGG + Intergenic
1034884013 7:154783812-154783834 TCTTCCTCACAGTCCTGGGTTGG - Intronic
1035259359 7:157651953-157651975 TCTTCCAGACAGTCCAAGGCAGG + Intronic
1040801914 8:51351488-51351510 TCTCCCACACAGCCCTCAGTTGG + Intronic
1042026734 8:64431982-64432004 TCTGGGACACAGCCCTTGGGAGG - Intergenic
1042383740 8:68149836-68149858 TAATCCACACAGACCTAGAGTGG - Intronic
1044281525 8:90362534-90362556 TCTCCCACACTCCCCTAGTGTGG + Intergenic
1044953696 8:97458033-97458055 TCTCTCTCACAGCCCTTGGGAGG + Intergenic
1047650182 8:126912038-126912060 TCTTCCACACAGCCTAATAGTGG - Intergenic
1047891905 8:129321921-129321943 TTTTCCACAAAGCCCTTGGTTGG - Intergenic
1051667005 9:19475098-19475120 TCTTCCTCACAGCCCTCAGAAGG - Intergenic
1053437068 9:38082945-38082967 TCCCGCACTCAGCCCTAGGGAGG - Intergenic
1053619847 9:39803709-39803731 TCTTCCTCACAGCCCTCAGAAGG - Intergenic
1054264310 9:62903734-62903756 TCTTCCTCACAGCCCTCAGAAGG + Intergenic
1055141320 9:72880351-72880373 TCTCCCTCACAGCCCTCTGGAGG + Intergenic
1055667580 9:78567900-78567922 CATTCCCCACAGCCCTAGTGAGG - Intergenic
1056108900 9:83375109-83375131 TCCTCCTCACAGCCCTGGTGTGG - Intronic
1058414111 9:104767274-104767296 TCTTTCATACTACCCTAGGGAGG + Intronic
1058634177 9:107020313-107020335 TCTTCCAAACAGCCCCCTGGAGG - Intergenic
1060880412 9:127114104-127114126 TCTTCCCAACAGCCCTCGGAAGG + Intronic
1061362938 9:130155224-130155246 TCCTCCAAGCAGCCCTAGGAGGG - Intergenic
1061665265 9:132157007-132157029 TCTTCCCAACAGCCCTGGGAGGG - Intergenic
1187028173 X:15457405-15457427 TCTTCCACACAGCCCTCATCAGG + Intronic
1187206403 X:17185860-17185882 TCTTCCAGCCAGGCCTTGGGAGG + Intergenic
1188016530 X:25112989-25113011 ACTTCCACAGATCCCTAGGATGG + Intergenic
1188128395 X:26399601-26399623 TGTTCCACATTGCCCTAGTGGGG - Intergenic
1189025440 X:37389038-37389060 AGTTCCACAGATCCCTAGGGTGG + Intronic
1189578717 X:42383157-42383179 ACTTCCCCACACCCCTATGGAGG + Intergenic
1192046342 X:67678123-67678145 TGTTCCACAAAGCCCTGGGGTGG + Intronic
1192220317 X:69193510-69193532 TCTTCCACACTGCCATGGGAAGG + Intergenic
1193140027 X:78017710-78017732 TATTCCACAGATCTCTAGGGTGG + Intronic
1195427289 X:104748650-104748672 TCTTGCCCACAGCCCTGGGTGGG + Intronic
1196368364 X:114947703-114947725 AGTTCCACAAATCCCTAGGGTGG + Intergenic
1198270001 X:135047759-135047781 ACTTCCCCACACCCCTATGGTGG - Intergenic
1198497139 X:137204111-137204133 CCTTCCACATTGCCCTAGTGAGG + Intergenic
1198710055 X:139491648-139491670 CCTTCCTCACAGCCCTTAGGAGG - Intergenic
1200226452 X:154420319-154420341 TCTCCCACTCAGCACTATGGAGG + Intronic