ID: 945574367

View in Genome Browser
Species Human (GRCh38)
Location 2:211512105-211512127
Sequence CAGACATCCTTGGGAAAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 229}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945574364_945574367 7 Left 945574364 2:211512075-211512097 CCATATTGTGGACTTGAAATTCA 0: 2
1: 0
2: 2
3: 22
4: 255
Right 945574367 2:211512105-211512127 CAGACATCCTTGGGAAAAACTGG 0: 1
1: 0
2: 1
3: 22
4: 229

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945574367 Original CRISPR CAGACATCCTTGGGAAAAAC TGG Intronic
900331054 1:2134866-2134888 CAGGCAGCCCTGTGAAAAACAGG - Intronic
902057844 1:13617307-13617329 CAGACATCATTGCAAAAAATGGG - Exonic
903799066 1:25953214-25953236 CAGACAGACTTGGGAACAGCTGG - Intergenic
904109607 1:28115367-28115389 CATACTTCCTTGTGAAAGACTGG + Intergenic
904594421 1:31634161-31634183 CTGACTTCCTTGGAAAAATCCGG + Intronic
904685271 1:32255118-32255140 CAGCCATACATGGGAAAATCTGG - Intronic
904869747 1:33609046-33609068 CAGACATCCTTGGGCAAGGCTGG + Intronic
905106960 1:35569436-35569458 CAGACAGCCTTGGGAACATGGGG - Intergenic
907212102 1:52832703-52832725 CTGGACTCCTTGGGAAAAACAGG - Intergenic
909941161 1:81613558-81613580 CAGACAGACTTCTGAAAAACTGG + Intronic
910938268 1:92504960-92504982 CAGACATTCTTGGTAAAATCTGG + Intergenic
911040827 1:93589413-93589435 CAGACACCTTTGGGACAAAAAGG + Exonic
913971544 1:143421376-143421398 CAGACAAGCTTGGGAACAAGGGG + Intergenic
914065921 1:144246989-144247011 CAGACAAGCTTGGGAACAAGGGG + Intergenic
914113230 1:144719365-144719387 CAGACAAGCTTGGGAACAAGGGG - Intergenic
915230814 1:154444109-154444131 CTGACATCCTTGTGCACAACTGG + Intronic
916533966 1:165685747-165685769 GGTACATCCTTGGGTAAAACTGG - Intronic
917401725 1:174656834-174656856 CAGAACTCCTTGGCAAAGACTGG - Intronic
917692776 1:177486306-177486328 AACACATGCTTGGGGAAAACAGG + Intergenic
917920462 1:179745314-179745336 CAGAGATTCTTGGGCCAAACAGG - Intronic
921959803 1:221022710-221022732 CTGGCATCCTAGGGTAAAACAGG - Intergenic
922759621 1:228119241-228119263 TGGAGCTCCTTGGGAAAAACAGG - Intergenic
924634568 1:245773757-245773779 AATACATCCTTGAGAAAAAATGG + Intronic
1062894338 10:1091397-1091419 CAGATAACTGTGGGAAAAACTGG - Intronic
1065736083 10:28753816-28753838 CAGACAGGCATAGGAAAAACTGG - Intergenic
1067333753 10:45345504-45345526 CATACATCATGGGCAAAAACTGG + Intergenic
1067350138 10:45468225-45468247 CATATATCCTTGGCAGAAACTGG + Intronic
1068094344 10:52471783-52471805 GAGAAAGCCTTGGGAAAAGCTGG + Intergenic
1070557583 10:77540397-77540419 CAAACTCCTTTGGGAAAAACTGG + Intronic
1072228912 10:93396512-93396534 CAGTCACCCTTTGGAAACACTGG + Intronic
1073619653 10:105033813-105033835 AAGCCATCCTTGGCCAAAACAGG - Intronic
1073704394 10:105966563-105966585 GAGAGATCCTTGGGAAAACTGGG - Intergenic
1077308334 11:1877651-1877673 CAGACAGGCTTGGGAACAAGGGG - Intronic
1078698449 11:13658472-13658494 CTGAGATCCCTGGGAAAAACAGG - Intergenic
1079148567 11:17876597-17876619 CAGACAGCCTTGGTTCAAACTGG - Intronic
1079790858 11:24737730-24737752 CTGACATCTTTTGTAAAAACAGG - Intronic
1080405438 11:31974669-31974691 AAAAAATCCTTGGGAAAATCAGG + Intronic
1081184539 11:40025979-40026001 CAGAAATCCTTTGGCAAAATAGG + Intergenic
1081771779 11:45654563-45654585 AAGGCTTCCTTGGGAACAACAGG - Intronic
1082561918 11:54628378-54628400 CAGACAGCTTTGGGAGAGACTGG + Intergenic
1083198054 11:61102679-61102701 GAGTCAGCCTTGGGTAAAACTGG - Intronic
1083679696 11:64345429-64345451 CAGGCATCCTTCTGTAAAACAGG + Intronic
1084698227 11:70768940-70768962 CAGACACCTTTGGGGAAAGCTGG - Intronic
1085826009 11:79847573-79847595 TACACATCCTTGGGAAGAAAGGG + Intergenic
1086067069 11:82756888-82756910 CAGACATCCTAGAGCCAAACAGG + Intergenic
1087227061 11:95613278-95613300 CTGGTCTCCTTGGGAAAAACAGG - Intergenic
1087913784 11:103783829-103783851 CAGACATCCCTATGAAAAAGTGG - Intergenic
1087965479 11:104407732-104407754 CATACATCTTTTGGAGAAACAGG - Intergenic
1088172067 11:107009579-107009601 AAAACATCCTCGGGAAAAACGGG + Intronic
1088626952 11:111736385-111736407 CAGACTTCTTTGGGAAGAAAGGG - Intronic
1091187047 11:133656456-133656478 CTGACATCCTCTGGAAAAAGGGG + Intergenic
1092642535 12:10531407-10531429 CAGACATTCATGGGAAAAATGGG + Intergenic
1093805770 12:23431372-23431394 CAGCCATGCATGGGAAAAAAGGG + Intergenic
1097254313 12:57660820-57660842 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1097421993 12:59391434-59391456 CAGACAAGATTGGGAAAAAAAGG + Intergenic
1099363153 12:81731681-81731703 CAGACAACCTTGGGTAGAATTGG + Intronic
1100783790 12:98057628-98057650 CAGACTTCCTTAGGAAGCACAGG + Intergenic
1101188549 12:102307063-102307085 CTGGATTCCTTGGGAAAAACAGG + Intergenic
1103144672 12:118584510-118584532 AAGACAGCCTTAGGAAAAATTGG + Intergenic
1104087329 12:125487984-125488006 CAGACCACCTTGGGAATATCAGG - Intronic
1104678935 12:130735601-130735623 GAGACAGCCTTGGGAGAAGCCGG - Intergenic
1105783730 13:23727048-23727070 CAGAAATGTTTGGGAAATACTGG + Intergenic
1105930218 13:25045519-25045541 CAGAAACCCTGGGGAAAAAAAGG + Intergenic
1106984993 13:35336016-35336038 CAGAGTTCCTTAGGAAAATCTGG + Intronic
1107022205 13:35763920-35763942 CAGGCATCCTTGGGAACTGCAGG + Intergenic
1107807317 13:44165662-44165684 CACACATCCTTGGGGAACAAGGG + Intergenic
1109566418 13:64121351-64121373 CAGACAGCCTTTGGAAAATCAGG - Intergenic
1112357206 13:98683682-98683704 CAATCATCCCTGGGGAAAACAGG + Intergenic
1113153741 13:107293680-107293702 CTTACATCCTTGTGAAAAACGGG + Intronic
1113444231 13:110353198-110353220 CAGACCTTATAGGGAAAAACAGG + Intronic
1114196282 14:20479418-20479440 AAGACATTCTTGAAAAAAACTGG + Intergenic
1114357779 14:21931677-21931699 CAAACAGTGTTGGGAAAAACTGG - Intergenic
1115656228 14:35446223-35446245 CAGAGAGGCTTGGGAAATACTGG + Intergenic
1119181090 14:72605751-72605773 CAGACCCCCTTGGCAAAAGCCGG + Intergenic
1119754669 14:77107088-77107110 CAGACAGGTTTGGGAAACACTGG + Intronic
1120929214 14:89831263-89831285 CAGAAAACCATGGGAAAAGCAGG + Intronic
1121964457 14:98291166-98291188 CAGCCATCCTGGGGACACACCGG - Intergenic
1121985831 14:98504660-98504682 GAGACAAGCTTGGGAAATACTGG - Intergenic
1124873871 15:33572485-33572507 CACACATGCTCGGGAAAAACTGG - Intronic
1126448270 15:48775599-48775621 CAGACATGCTTGAGAAGAAATGG + Intronic
1128741337 15:70085870-70085892 CAGAAGTCCTGGGGAAAGACAGG - Intronic
1129705685 15:77792868-77792890 CATTCATCCTTGGGAGAAACAGG + Intronic
1129930973 15:79411140-79411162 CAGGCATCCAGGGGAAAAACAGG + Intronic
1130075020 15:80681189-80681211 CAGACAAGCTTGGGAACCACTGG + Intronic
1130920805 15:88342936-88342958 CAGCCATGGTTGGGAAACACTGG + Intergenic
1131588965 15:93727911-93727933 AAAGCAGCCTTGGGAAAAACTGG + Intergenic
1131651027 15:94399892-94399914 AAGACATCCTTGTTAAAAAAGGG - Intronic
1131687481 15:94785864-94785886 CAGACATGCTTCAGTAAAACTGG + Intergenic
1133330476 16:4970203-4970225 CATTCATCATGGGGAAAAACAGG + Intronic
1136630195 16:31485476-31485498 GGGACAACATTGGGAAAAACGGG + Intronic
1138012499 16:53396147-53396169 CAGAGGCCCTTGGCAAAAACTGG + Intergenic
1138121072 16:54401516-54401538 CGGGCATCCTTGGGAAGAAAAGG + Intergenic
1139324607 16:66142577-66142599 CAGACCTCGTTGGCAAAAGCTGG + Intergenic
1140354028 16:74288890-74288912 CAGACATCCTTGGGAATGTCTGG - Intergenic
1141804717 16:86335086-86335108 CAGGGATCCTTGGGAGATACAGG - Intergenic
1144266067 17:13570996-13571018 AAGACAGCCTTGGTAACAACAGG - Intronic
1144595157 17:16563615-16563637 CAGACATGCTTGGCTAAAAATGG - Intronic
1145114555 17:20197185-20197207 CTGAACTCCTTGGGAAAAACAGG - Intronic
1145166212 17:20614884-20614906 CAGATCTCCTTGGGTAAATCTGG - Intergenic
1147924081 17:43935985-43936007 CACAGATCCTAGGGAGAAACTGG - Intergenic
1152138051 17:78517462-78517484 AAGAAATACTTGGGAAAAAGAGG + Intronic
1152718294 17:81910443-81910465 CAGACATGCTGGGTAAAATCTGG + Intronic
1153290772 18:3499435-3499457 AGGACAAGCTTGGGAAAAACTGG + Intronic
1153374770 18:4363355-4363377 CAGGGATCCTTGGGAAAAGGTGG + Intronic
1154273771 18:12942188-12942210 CTAAAATCCTTGGGACAAACTGG + Intergenic
1155458396 18:26047072-26047094 CAGACATCCTATGGAAATACAGG - Intronic
1158346298 18:56520174-56520196 CAGACTTTTTTGGGAAAAAGCGG + Intergenic
1159242844 18:65765282-65765304 CATATATCCTTGGAAAAAAATGG + Intronic
1161482943 19:4519745-4519767 CAGCCACCCTTGGGAAGCACTGG - Intergenic
1164308200 19:24023472-24023494 AAGACAACCTTGGGCAACACAGG + Intergenic
1165316840 19:35060910-35060932 CAGGCATCCTTGGCAATAAGGGG + Intronic
1166419017 19:42620127-42620149 CAGTCATCCTTGGAGTAAACAGG + Intronic
1166476706 19:43132924-43132946 AAGATGTCCTGGGGAAAAACTGG + Intronic
1166900910 19:46062081-46062103 TGGAACTCCTTGGGAAAAACAGG - Intronic
926784996 2:16509735-16509757 CAGGCTTCCTTGGGAAATGCTGG + Intergenic
927429650 2:23016613-23016635 CACACTTCATTAGGAAAAACAGG + Intergenic
928420597 2:31135478-31135500 CATACATACAAGGGAAAAACAGG + Intronic
928767183 2:34661314-34661336 CAGACAGCTTAGGGAAAGACAGG + Intergenic
928891049 2:36203633-36203655 CAGACATCCTGGAAAAAAAAAGG + Intergenic
929533281 2:42765211-42765233 CAAACATCCCTGGGAGAAGCAGG + Intergenic
929618763 2:43334046-43334068 CAGACCCCCTAGGGAAGAACTGG + Intronic
930887911 2:56349210-56349232 GAGTCATACTTGGGAAAAAATGG + Intronic
931546955 2:63399266-63399288 GAGACCTTCTTGGGAAAAAGAGG + Intronic
931559620 2:63545771-63545793 CACACCTCCTTGGCAAAAAACGG + Intronic
932531085 2:72533299-72533321 CTGACTTGCTTGGGAAAATCAGG - Intronic
933189604 2:79319698-79319720 CAGAAATTCCTGGGAAAAAATGG - Intronic
933865027 2:86508454-86508476 CTGACATCCCTGGGCAGAACAGG + Intronic
934176238 2:89582309-89582331 CAGACAGGCTTGGGAACAAGGGG + Intergenic
934286548 2:91656670-91656692 CAGACAGGCTTGGGAACAAGGGG + Intergenic
936660510 2:114537814-114537836 CAGAAATTCTTAGAAAAAACTGG - Intronic
936792270 2:116164381-116164403 CAGAGGCCCTGGGGAAAAACTGG + Intergenic
938048806 2:128148505-128148527 CAGAGACCCTTGGGGAAAACTGG - Intronic
941610211 2:167652228-167652250 CAGACATCCTGGGAAAAGAGTGG + Intergenic
944447288 2:199804486-199804508 AAGACATCCTTTGGAAAACCTGG + Intronic
944538193 2:200731829-200731851 CAAACATTCCTGGGGAAAACTGG + Intergenic
945574367 2:211512105-211512127 CAGACATCCTTGGGAAAAACTGG + Intronic
947549096 2:231033626-231033648 CAAACATCTTAGGGAAAAAGCGG + Intergenic
948405494 2:237715329-237715351 CAGAGAGCCTCGGGAAGAACTGG + Intronic
1171377616 20:24704112-24704134 TGGACATCCTTAGGAAAAGCCGG - Intergenic
1172409849 20:34712881-34712903 CAGACTTACTGGGGAATAACTGG - Exonic
1175038320 20:56021374-56021396 CATACAGCCTTGGGATATACAGG - Intergenic
1178240525 21:30894359-30894381 CAAATATCCTTAGGAAATACTGG + Intergenic
1182527286 22:30928291-30928313 CAGGCATCCTTGGGTAAAGCGGG - Intronic
949215943 3:1567396-1567418 AAGAAATCCCTGAGAAAAACTGG - Intergenic
949601155 3:5599279-5599301 CAGTCATCCCTGGGAGAAAATGG - Intergenic
949962827 3:9328420-9328442 CTGGACTCCTTGGGAAAAACAGG - Intronic
950605716 3:14078215-14078237 CTGGACTCCTTGGGAAAAACAGG - Intronic
955505990 3:59633676-59633698 CACACATGCTTAGGAGAAACAGG - Intergenic
955865387 3:63377035-63377057 CAGTTGTACTTGGGAAAAACGGG - Intronic
956554859 3:70508901-70508923 CAAACCTCCTAGGGAAAAAAAGG - Intergenic
957038190 3:75314218-75314240 AAGGCATGCTTGAGAAAAACAGG + Intergenic
957284010 3:78192835-78192857 CAAATATCCTAGAGAAAAACTGG + Intergenic
958689811 3:97449389-97449411 CAGACATCTTTATGAAAAAGTGG + Intronic
960379905 3:116947230-116947252 CAGTCAAGCTTGGGAAACACTGG + Intronic
962493049 3:135911954-135911976 CAGGGATCCTTGAGAAAAACAGG - Intergenic
963502726 3:146148163-146148185 AAGACATACTTGAGAAAAAGAGG + Intronic
965501593 3:169462652-169462674 AAAACATCCTTACGAAAAACTGG + Intronic
965588456 3:170340511-170340533 CTGGACTCCTTGGGAAAAACAGG - Intergenic
966179363 3:177173676-177173698 AAGACATTCGTGGAAAAAACCGG + Intronic
966389880 3:179441150-179441172 CATTCATCCATTGGAAAAACAGG + Intronic
968296061 3:197577448-197577470 CAAACATCTTTGAGGAAAACGGG - Intergenic
969366857 4:6700616-6700638 CAGTCATCCTAGGTAAAAAATGG - Intergenic
972824016 4:42735724-42735746 AAAACATCATTGGAAAAAACAGG - Intergenic
974558635 4:63487730-63487752 CCAGCATCCTGGGGAAAAACTGG - Intergenic
976054540 4:81048062-81048084 CAAAAATCCTTGGGAAAGAAGGG - Intronic
978449657 4:108818491-108818513 CATAAATATTTGGGAAAAACTGG + Intronic
979724898 4:123949192-123949214 CAGAAATCTATGGGATAAACAGG + Intergenic
979772132 4:124540104-124540126 CAGACATCCTTGAGTGAAGCTGG + Intergenic
979936061 4:126697909-126697931 CAGACATCATTGTGCAAGACTGG - Intergenic
981246044 4:142539767-142539789 AAGAGTTCCTTGGGACAAACAGG + Intronic
981576837 4:146214360-146214382 CTGACATCCTTGGCAGAAGCTGG - Intergenic
983813329 4:172091512-172091534 AAAATCTCCTTGGGAAAAACTGG - Intronic
985394490 4:189527480-189527502 CAGACAACTGTGGAAAAAACTGG - Intergenic
985942161 5:3145528-3145550 AAGTAATCCTTGGGCAAAACAGG - Intergenic
986092457 5:4523601-4523623 CAGGCATCCTTGAGAAAAACAGG + Intergenic
986578109 5:9233707-9233729 CAGACATCCCAGGGAAACAAGGG + Intronic
987786467 5:22506604-22506626 CAGAGATCCTTGAAAAAAAAAGG - Intronic
987970095 5:24931253-24931275 CAGACATTCTTGGGAGAATGGGG + Intergenic
988050710 5:26027291-26027313 GAGACATACTAGGAAAAAACTGG - Intergenic
988694231 5:33603701-33603723 CAGAGATCCATGTGAAAAACTGG - Intronic
989017837 5:36960280-36960302 CAGCCATCACTGGGACAAACTGG - Intronic
990253771 5:53943795-53943817 CAGACAGCCATGGGAAGAAGAGG + Intronic
990512736 5:56503481-56503503 GAGACATCCTTGGTTAAAAAGGG - Intergenic
993027069 5:82659636-82659658 CAGATAACTTTGGGAAATACTGG - Intergenic
993960164 5:94288061-94288083 AAGACATCCTCTGGAAAAAATGG + Intronic
995952212 5:117729804-117729826 CAGACATCCTGGTGAGAAAGTGG - Intergenic
995982005 5:118115763-118115785 CAAACATCCTTTGGAAGAAGGGG - Intergenic
997306169 5:132838232-132838254 CACACATCCTTGGACAAAAGAGG + Intergenic
999030373 5:148284045-148284067 CAGATCTCCTTGGCAAAAATGGG + Intronic
1001069386 5:168571218-168571240 CTGACTTCCTTGGGAACAATTGG - Intronic
1001534151 5:172486826-172486848 CAGACAGACTTGGGAAAGCCAGG + Intergenic
1004026224 6:11821823-11821845 CACACAGCCTTGAGAAAAGCAGG + Intergenic
1004482058 6:16030442-16030464 CAGAAATCTTGGGGAAAAAAAGG - Intergenic
1006819465 6:36880266-36880288 CTGGAATCCATGGGAAAAACAGG + Intronic
1008373206 6:50760244-50760266 CATTCCTCCTTGGGAAAAAGAGG - Intronic
1009716783 6:67408063-67408085 TGGAACTCCTTGGGAAAAACAGG + Intergenic
1015134710 6:129854433-129854455 CAGACTTCCTGGGGATAAAAAGG + Intronic
1016297016 6:142584289-142584311 TAAATCTCCTTGGGAAAAACTGG + Intergenic
1016854464 6:148652668-148652690 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1017019099 6:150126017-150126039 GAGACAGCCATGGGAAACACAGG + Intergenic
1017404752 6:154107209-154107231 CTGGACTCCTTGGGAAAAACAGG - Intronic
1017406867 6:154128867-154128889 CAGAGATCTTTGTAAAAAACAGG + Intronic
1017856294 6:158352191-158352213 CAGATATCCATTGGAAAGACTGG + Intronic
1017887086 6:158608295-158608317 CAGAAATCCATGTGGAAAACAGG - Intronic
1018498141 6:164371109-164371131 CAGACATACATGGGAAAACTAGG - Intergenic
1019124795 6:169830965-169830987 GACACATCCTTGGCAAACACAGG - Intergenic
1019836008 7:3384531-3384553 CAGACAAGCTTGGGAAACACTGG - Intronic
1020350549 7:7214286-7214308 TGGAACTCCTTGGGAAAAACAGG - Intronic
1022174899 7:27863393-27863415 CAGCCACCCATGAGAAAAACTGG - Intronic
1022810831 7:33866900-33866922 AACACATCCTTGGGTAAAAATGG - Intergenic
1023440315 7:40178688-40178710 AAGACATCATTGTGAAAATCTGG - Intronic
1023588597 7:41757621-41757643 CTGAGCTCCTTGGGAAAAACAGG - Intergenic
1024688800 7:51777426-51777448 CAAACATCCTAGGGAAAGAAGGG + Intergenic
1024902800 7:54340757-54340779 CAGACATTCTTAAGTAAAACTGG + Intergenic
1025768865 7:64484654-64484676 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1026328930 7:69335389-69335411 CAGACATGGGTGGGAGAAACAGG - Intergenic
1027557454 7:79683734-79683756 CACACATCCCTGGTAAACACTGG + Intergenic
1027830437 7:83170289-83170311 CAGACATCCTGAGGAAAGATGGG + Intergenic
1030021063 7:105275747-105275769 CAGACATCCTAGGAGAAAAACGG + Intronic
1030120812 7:106109065-106109087 CAGACATTCTTAAGTAAAACTGG - Intronic
1031396374 7:121279214-121279236 CAAAAATGCTGGGGAAAAACTGG - Intronic
1033856464 7:145567339-145567361 CAGATATCATTAGGAAAAAAAGG - Intergenic
1035519339 8:264653-264675 TCTACATCCTTGGGACAAACTGG + Intergenic
1036644827 8:10606391-10606413 CAGAAATACTTGGGCAAAGCAGG - Exonic
1040121734 8:43691364-43691386 GAGACCTTCTTGGGAAACACGGG + Intergenic
1041450963 8:58006503-58006525 TAGACCTCCTAGGGTAAAACTGG + Intronic
1041656451 8:60355577-60355599 CAGAAACCCTTGGTGAAAACTGG + Intergenic
1043092425 8:75922917-75922939 CACACATCCTTGGCAAAACTTGG + Intergenic
1043109622 8:76163708-76163730 CATAAATACTTGGGAATAACTGG + Intergenic
1044266518 8:90188526-90188548 CTGAAATTCTTGGAAAAAACAGG + Intergenic
1044327349 8:90874734-90874756 CAACCTTCCATGGGAAAAACAGG + Intronic
1044749966 8:95406622-95406644 CACACATCCTTGGGATGACCAGG + Intergenic
1044932649 8:97264828-97264850 CATACACCCTTGTTAAAAACAGG + Intergenic
1047765884 8:127989604-127989626 GAGACAGCCTTGGGGAAAAGAGG + Intergenic
1050045544 9:1540640-1540662 CAGATAACCAAGGGAAAAACAGG - Intergenic
1052202070 9:25794793-25794815 CTGTCATCATTGGCAAAAACTGG - Intergenic
1052652419 9:31321468-31321490 CAGACACCCTTGTCACAAACAGG - Intergenic
1052663631 9:31467972-31467994 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1054090670 9:60844061-60844083 CAGCCAGCCTGGGGAAAGACGGG - Intergenic
1054112081 9:61119618-61119640 CAGCCAGCCTGGGGAAAGACGGG - Intergenic
1055789103 9:79902369-79902391 CAGAGATTCTTTGGAAAAACAGG - Intergenic
1055970845 9:81911319-81911341 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1060344421 9:122803911-122803933 CAGACAACCTGGGGAAAACAAGG + Intronic
1061294194 9:129667955-129667977 CAGGCATGCTTGGGACACACTGG + Intronic
1186591844 X:10938908-10938930 CACACATCTTTGGGAAATGCTGG - Intergenic
1187196833 X:17094863-17094885 AAAATATCCATGGGAAAAACAGG - Intronic
1188581688 X:31722015-31722037 CACACATCCTTTAGCAAAACAGG - Intronic
1189203892 X:39221322-39221344 CAGAGCTGCTTGTGAAAAACTGG + Intergenic
1190962784 X:55268819-55268841 CAAGACTCCTTGGGAAAAACAGG + Intronic
1193465252 X:81840746-81840768 CAAACATCTTTGTGAAAAACAGG - Intergenic
1193740007 X:85205603-85205625 CAAAAATCCTTAGGAAAAAATGG + Intergenic
1198320460 X:135514517-135514539 CAGACACCCCTTGGAAAAAAAGG - Intergenic
1201240674 Y:11954387-11954409 GAGACACCCAAGGGAAAAACAGG + Intergenic