ID: 945574953

View in Genome Browser
Species Human (GRCh38)
Location 2:211518998-211519020
Sequence CCTTCCAACTTCCAGTTGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 173}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945574948_945574953 15 Left 945574948 2:211518960-211518982 CCCTCTCTCTGTCTTCAGGGGAA 0: 1
1: 0
2: 4
3: 52
4: 368
Right 945574953 2:211518998-211519020 CCTTCCAACTTCCAGTTGTGAGG 0: 1
1: 0
2: 1
3: 18
4: 173
945574949_945574953 14 Left 945574949 2:211518961-211518983 CCTCTCTCTGTCTTCAGGGGAAG 0: 1
1: 0
2: 1
3: 23
4: 343
Right 945574953 2:211518998-211519020 CCTTCCAACTTCCAGTTGTGAGG 0: 1
1: 0
2: 1
3: 18
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945574953 Original CRISPR CCTTCCAACTTCCAGTTGTG AGG Intronic
901627903 1:10634185-10634207 CCTGCCTCCTTCCAGTGGTGTGG + Intergenic
902269620 1:15294066-15294088 GCTTCCATCTTCCTGTAGTGAGG + Intronic
902610756 1:17595922-17595944 CAGTCCTACTTCCAGCTGTGAGG - Intronic
902811612 1:18891161-18891183 CCTGCCACCTCCCAGCTGTGGGG + Intronic
903270570 1:22185703-22185725 CCTGCCACCTACCAGTGGTGAGG + Intergenic
905241603 1:36585061-36585083 TCTTCCACCTGCCAGCTGTGTGG + Intergenic
906864000 1:49395941-49395963 CCTACCTTCTTCCAGTTGAGAGG - Intronic
909584338 1:77272381-77272403 CATTCAAACTTCCAGTCATGGGG + Intergenic
915168154 1:153960023-153960045 CCTTCCCTCCCCCAGTTGTGGGG - Exonic
915357987 1:155268119-155268141 CCTGCCAACTTACAGGGGTGGGG - Exonic
915514097 1:156402610-156402632 CCCTCCAAATCCCAGTTTTGGGG + Intergenic
916445942 1:164871770-164871792 CCTTCCAACTCCGAGGTTTGGGG - Intronic
916948642 1:169757111-169757133 GCTTCCAGCTTCCAGTTTTGGGG - Intronic
917497645 1:175555854-175555876 CCTTCCAACCATGAGTTGTGTGG + Intronic
921245286 1:213232390-213232412 CCTCCCTACTTTGAGTTGTGAGG + Intronic
921250315 1:213291253-213291275 CCTTCCAACTTCTTTGTGTGAGG + Intergenic
1062910770 10:1210598-1210620 CCTTTCAACTTCCAGTTCCCAGG + Intronic
1063278773 10:4601769-4601791 CCTTTCACCTTCCAATTGTGAGG - Intergenic
1071447909 10:85766158-85766180 CCTTCCAAGTTTCTTTTGTGAGG - Intronic
1072047928 10:91675427-91675449 CCTTCTATCTTCCTGTTGTATGG - Intergenic
1072559140 10:96554013-96554035 CCTTTCCACATCCAGTTTTGAGG + Intronic
1075560644 10:123465909-123465931 TCTTCCAACTTCCATCTATGAGG + Intergenic
1076352409 10:129826113-129826135 CCTTCCCACTCCAAGGTGTGTGG + Intergenic
1078407679 11:11085393-11085415 CTTCCTATCTTCCAGTTGTGAGG - Intergenic
1078918778 11:15807208-15807230 CCCTACAAATTCCAGTTCTGGGG - Intergenic
1079776986 11:24544090-24544112 CATTCCAACTTCCGGTGCTGAGG + Intronic
1080238171 11:30096259-30096281 CTTTTCACCTACCAGTTGTGTGG + Intergenic
1083270393 11:61569369-61569391 CCTCCCTTCTTCCAGTTCTGTGG - Intronic
1085810891 11:79680116-79680138 TCTTCCAATTTCCAAATGTGTGG + Intergenic
1086606642 11:88703674-88703696 CCTACCAACTCCTAATTGTGTGG + Intronic
1086951308 11:92892885-92892907 CCTGTCAACTTTCAGTTTTGAGG - Exonic
1089308686 11:117543618-117543640 CCTGCCACCTACCAGCTGTGTGG + Intronic
1089752140 11:120659566-120659588 TCTTCCACTTGCCAGTTGTGTGG - Intronic
1090924344 11:131236332-131236354 ACTTCCAACTTGCAGTTGGAAGG - Intergenic
1091017281 11:132063395-132063417 CCTTCCCATTTCCAGCTTTGTGG - Intronic
1094307827 12:29040501-29040523 CCATCTTACATCCAGTTGTGTGG + Intergenic
1095929184 12:47608761-47608783 ACTTCCAACTTCCAGAACTGTGG - Intergenic
1096411044 12:51377360-51377382 CTTTCATACTTCCAGGTGTGTGG - Exonic
1099173997 12:79399749-79399771 CCTTCCCACTCCCAGATGTCTGG + Intronic
1102238510 12:111309457-111309479 CCATCCAAATGCCAGTTCTGGGG - Intronic
1102254739 12:111409043-111409065 TCTGCCAGCTTCCAGGTGTGAGG + Intronic
1102636917 12:114332652-114332674 ACCTCCAACTTCCAGCTTTGTGG - Intergenic
1103205707 12:119127288-119127310 ACCTCCAGCTTCCAGATGTGAGG + Intronic
1103226337 12:119291130-119291152 CCTGCCCACTTCCTGCTGTGTGG - Intergenic
1104196976 12:126549811-126549833 CCTCCCAACTTCCACTGTTGAGG + Intergenic
1106016536 13:25874238-25874260 GCTTCCCACTTCCTGGTGTGAGG + Intronic
1107380455 13:39851683-39851705 ACTTCCAACTTCCAACTATGTGG + Intergenic
1108573095 13:51769286-51769308 CCTTCCTTCTCCCAGGTGTGAGG - Exonic
1109282132 13:60369012-60369034 TCTTCCAGCTTCAAGTTGTTTGG + Intergenic
1109564280 13:64091022-64091044 CCTACCATCTACCAGTTGTACGG + Intergenic
1110129490 13:71989626-71989648 CCTCCCAACTTCCAGATTTCTGG - Intergenic
1110799671 13:79680359-79680381 GCTTCCAGCTTCCATTTTTGGGG - Intergenic
1113047953 13:106176183-106176205 CCTTTAAACTTCCAGTGATGTGG + Intergenic
1117442963 14:55777266-55777288 CCTTCCAAATTCATGATGTGGGG - Intergenic
1118139136 14:63060782-63060804 ACTTCCAGCTTCCAGCTATGAGG - Intronic
1120413146 14:84183992-84184014 CTTTCCAGCTTCCAGTGCTGTGG - Intergenic
1122374652 14:101249721-101249743 CCTGCCGACTTCAACTTGTGGGG + Intergenic
1124830424 15:33143716-33143738 CCTTCCAACTTACAGTGATAAGG - Intronic
1125985802 15:44050624-44050646 CCTCCCAAATTACAGGTGTGAGG + Intronic
1126316866 15:47379253-47379275 CCTTTCAAATCCCAGTTTTGAGG - Intronic
1126663386 15:51053786-51053808 CCATTCAACTCCCAGTTGGGAGG + Intergenic
1127216262 15:56825635-56825657 CCTTCTAACTTCCAGTATAGAGG + Intronic
1128440360 15:67701842-67701864 TCTTCTGACTTCTAGTTGTGGGG + Intronic
1130162498 15:81415182-81415204 CCTTGCCACTTCCACTTGTGAGG + Intergenic
1130183777 15:81658865-81658887 CCTGCTAACTTTCAGTTTTGGGG + Intergenic
1130188082 15:81704732-81704754 CCTGCTAACTTTCAGTTTTGGGG + Intergenic
1132256543 15:100381528-100381550 CCTTCCGTATTCCAGTTGTTGGG - Intergenic
1132940719 16:2506749-2506771 ACTTCCAACTTCCAGGTTTGAGG + Intronic
1134056199 16:11171204-11171226 CCTTCCCCCTTCCAGCTGAGAGG - Intronic
1134572826 16:15306254-15306276 CCTTCCACCTTCCACATATGAGG + Intergenic
1134729560 16:16449782-16449804 CCTTCCAACTTCCACATATGAGG - Intergenic
1134937876 16:18262124-18262146 CCTTCCACCTTCCACATATGAGG + Intergenic
1135509645 16:23071361-23071383 CCTTCCAGCTCCCAGTACTGTGG + Intronic
1137380671 16:47996301-47996323 TCCTCCACCTCCCAGTTGTGAGG + Intergenic
1137578070 16:49617075-49617097 CCTTCCTACTTCCACTGCTGGGG + Intronic
1138413165 16:56855421-56855443 CCCTCAAACTTCCTGCTGTGGGG + Intergenic
1141201423 16:81901206-81901228 GATTGCAGCTTCCAGTTGTGTGG + Intronic
1144692127 17:17274198-17274220 TCTTCCAATTTTGAGTTGTGGGG + Intronic
1146135347 17:30315570-30315592 CCTACAAGCTCCCAGTTGTGTGG + Intergenic
1148015296 17:44517630-44517652 ACTTCCAGGTTCCAGGTGTGAGG + Intergenic
1150229376 17:63541770-63541792 TCTTCCCACTCCCAATTGTGGGG - Intronic
1154083776 18:11282134-11282156 CCTGCCACCTTTCAGTAGTGTGG - Intergenic
1156539856 18:37898739-37898761 GCCTCCTACTTCCAGCTGTGGGG - Intergenic
1163256880 19:16161320-16161342 CCTCCCATCTTCCAGTTTTAAGG + Intergenic
1164558159 19:29269290-29269312 GCTTCCAGCTTCCAGTGGCGGGG - Intergenic
1164911943 19:32020033-32020055 CCTTCAAACTTACAGGTGTAAGG + Intergenic
926372804 2:12197405-12197427 GCTTCCAGCTTCCAGGTTTGTGG - Intergenic
930604430 2:53478208-53478230 TCTTCTAACTTCAAGTTCTGTGG - Intergenic
931867953 2:66432434-66432456 GCTTCCAAGTTCATGTTGTGGGG + Intergenic
934969555 2:98751878-98751900 CCTTCCTCCTTCCTGTTGTGTGG + Intergenic
936625251 2:114141577-114141599 CCTTCCAGTTTCCTGTTGTAAGG - Intergenic
937128139 2:119487602-119487624 CCTTCCACCTGCCAGCTCTGAGG + Intronic
937487700 2:122332943-122332965 CCTTCCAATTCCTAGCTGTGTGG - Intergenic
940840677 2:158577293-158577315 CCTTTCCACTTCCAGTTCTCGGG - Exonic
942045713 2:172098111-172098133 CTTTCCAACTTCACTTTGTGTGG - Intergenic
942403825 2:175631503-175631525 CCTTGCCTCTTACAGTTGTGGGG + Intergenic
945239003 2:207659623-207659645 CCCTTCCACTTCCAGATGTGGGG - Intergenic
945574953 2:211518998-211519020 CCTTCCAACTTCCAGTTGTGAGG + Intronic
946460326 2:219863173-219863195 CCTCCCACTTTCTAGTTGTGGGG - Intergenic
948037488 2:234870569-234870591 CCTTCTAACATCCACTTGGGTGG + Intergenic
1168956671 20:1838934-1838956 CCTGTCATCTTCCAGCTGTGGGG - Intergenic
1169918006 20:10702908-10702930 CCTTTCATTTTCCAGTTGTGTGG + Intergenic
1169950639 20:11039677-11039699 CCCTGCTACTTCCAGATGTGAGG - Intergenic
1172042798 20:32057841-32057863 CCTTCAAACTCCCAGTCCTGTGG - Intronic
1175262365 20:57682572-57682594 CCTTTCGTCTTCCAGGTGTGGGG - Intronic
1178607384 21:34051615-34051637 CTTTCCTACTTCCACTTTTGGGG + Intergenic
1178718243 21:34986306-34986328 CCTTTCAACTTTCAGGTTTGAGG - Intronic
1179710869 21:43212251-43212273 CCTCCCAACCTCTAGTTGTGTGG + Intergenic
1180624658 22:17186184-17186206 TCTGCCAATTTCCAGCTGTGTGG + Intronic
1180671857 22:17559814-17559836 CCTTTTAACCTCCAGTTGTTTGG + Intergenic
1182102906 22:27670362-27670384 CCTTCCAAGGTCAAGCTGTGTGG + Intergenic
1182141269 22:27960724-27960746 CCTGCCAACTACCAGAAGTGAGG - Intergenic
1182275997 22:29189030-29189052 TCCTCCAACTTCAAGTTGTTTGG - Intergenic
1184425433 22:44406497-44406519 CCTTCCAGCTGCCTGCTGTGTGG + Intergenic
1184833871 22:47008844-47008866 CCTTCTAACTTCCCGGTGGGAGG - Intronic
952500582 3:33957857-33957879 CCTTCCAACTTCCAGTGATTGGG + Intergenic
953167981 3:40482300-40482322 CCTTCCATCTTCCAGTTCCCTGG + Exonic
953942056 3:47108648-47108670 CCTTCCAACTTCCTGATGTGGGG - Intronic
954613281 3:51957322-51957344 CCTTCCACATGCCAGTTCTGGGG - Exonic
954824857 3:53363828-53363850 CCTTCCAAAGTCCAGTTCTGTGG - Intergenic
956608035 3:71092707-71092729 CCTTCAAACTTCCAGGTCTTGGG + Intronic
959615404 3:108341889-108341911 GCTTCTATCTTACAGTTGTGAGG - Intronic
960759333 3:121054921-121054943 CCTTCAACATTCCAATTGTGAGG - Intronic
963601684 3:147384504-147384526 CCTTCCAAGTTCTAATTGCGAGG - Intergenic
965140188 3:164823075-164823097 CCCTACAACTTCCAGTTCTTGGG + Intergenic
966631713 3:182083428-182083450 CCTTTCCACTTCCAATTGTTTGG - Intergenic
969086189 4:4658274-4658296 CCTTCCTCCTTCCAGGTGTCTGG + Intergenic
969240099 4:5892079-5892101 CCTTCCAGCTTTAAGCTGTGTGG + Intronic
969525592 4:7702424-7702446 TCTGCCACCTTCCAGCTGTGAGG + Intronic
973193656 4:47415246-47415268 GCTTCCACCTTTCAGTTGTGTGG - Intronic
975661827 4:76696353-76696375 CATTCCAGCTGCCAGTAGTGAGG - Intronic
975791983 4:77963167-77963189 CTTTTCAAGTTACAGTTGTGTGG - Intergenic
976117414 4:81742932-81742954 CTTTACAACTTCCAGATGGGTGG - Intronic
976422703 4:84864717-84864739 CCTTCCAACTCCCAGTTAAGTGG + Intronic
977648253 4:99439009-99439031 CCTCCCATCTTCCAGTTTTTAGG - Intergenic
979530471 4:121764809-121764831 CCTCCCAGCTTCCAGGTGCGGGG - Exonic
983241674 4:165240443-165240465 GCTTAGAAGTTCCAGTTGTGAGG + Intronic
983301745 4:165934448-165934470 TCTTCCAACTTCTAGTTGTCAGG - Intronic
983653302 4:170054987-170055009 CCTTCCAAATTCATGTTTTGAGG + Intergenic
985046644 4:185947516-185947538 CCTTCCAATTGCCAGCTCTGTGG + Intronic
986230618 5:5861601-5861623 ATCTCCAACTTCCAGTTGTATGG + Intergenic
988853368 5:35200976-35200998 CCTTCCAATTTTTAGTTGTATGG + Intronic
989425923 5:41295466-41295488 CCTTCCAACTTGCACATGTGTGG + Intergenic
990165240 5:52987463-52987485 CCTGCCTAGTTGCAGTTGTGAGG - Intergenic
997381997 5:133444859-133444881 CCTTCCAGCTTCCATTTCTGGGG + Intronic
998597996 5:143554365-143554387 CCTGCCAACTTCTAGCTGAGTGG + Intergenic
1000913116 5:167046158-167046180 CCTTCCAAATCACAGTTATGTGG + Intergenic
1001763591 5:174227081-174227103 CCTCCCAACTTCCCTCTGTGAGG + Intronic
1003761648 6:9185205-9185227 TCTTGCAATTTACAGTTGTGGGG + Intergenic
1009585566 6:65597508-65597530 CTTTCCAACTTACAGTTTGGGGG - Intronic
1009649302 6:66452649-66452671 CTTTCCAACTGGCAGCTGTGCGG - Intergenic
1013279833 6:108625725-108625747 CCTACCACCTGCCAGCTGTGTGG + Intronic
1015966806 6:138702452-138702474 CTTACCACCTACCAGTTGTGTGG + Intergenic
1019398191 7:834639-834661 CGCTCCACCTTCCAGCTGTGCGG - Intronic
1022466987 7:30658586-30658608 TGTTCCAATTTGCAGTTGTGTGG + Intronic
1022950975 7:35337563-35337585 CCCTCCAACTCCCTGGTGTGTGG - Intergenic
1023490310 7:40732647-40732669 CCTTCTGAGTTCCAGCTGTGTGG - Intronic
1025785147 7:64637167-64637189 CCTCCCATCTCCCAGTGGTGGGG + Intergenic
1027704957 7:81518789-81518811 CCTGCCAATGTCCAGTTTTGAGG - Intergenic
1028368900 7:90068668-90068690 CCTTCCAACTCCAAGGTGTAGGG + Intergenic
1029567747 7:101350174-101350196 CCTGCTAACTTCGAATTGTGTGG + Intergenic
1030238132 7:107289950-107289972 CCTTCCATCTTGCAGCTGTTTGG - Intronic
1030649536 7:112102389-112102411 CCTGCCATTTTCTAGTTGTGTGG + Intronic
1032672429 7:134097676-134097698 CCCTCCCACATCAAGTTGTGGGG - Intergenic
1034826449 7:154269236-154269258 CTTTCCACTTACCAGTTGTGTGG - Intronic
1034992206 7:155555085-155555107 CCTGTCAACTTCCATTTGTAAGG + Intergenic
1035252218 7:157604954-157604976 CCTCCCAACTCCCTGGTGTGTGG + Intronic
1038310708 8:26444281-26444303 CCTTCCACCTTCCAGAACTGTGG - Intronic
1041110962 8:54481902-54481924 ACTTGCAACTTCCAGTTCTTGGG - Intergenic
1042034961 8:64522822-64522844 TCTTCCTACTTCCAATAGTGAGG + Intergenic
1045409887 8:101906281-101906303 ATTTCGAACTTCCAGTTGTTTGG - Intronic
1048354877 8:133645243-133645265 CCTTCCACCTTCCATGGGTGGGG - Intergenic
1048742453 8:137576789-137576811 CCTTCCAGCTTACACTTATGGGG - Intergenic
1049296208 8:141840991-141841013 CCTTTCCACTTCCAGTCATGAGG - Intergenic
1052580600 9:30349674-30349696 CGTTGGAACTACCAGTTGTGCGG - Intergenic
1053651691 9:40176161-40176183 CTTTCCATCTTCCAGGTATGGGG + Intergenic
1053902082 9:42805483-42805505 CTTTCCATCTTCCAGGTATGGGG + Intergenic
1054532893 9:66200041-66200063 CTTTCCATCTTCCAGGTATGGGG - Intergenic
1056262518 9:84862946-84862968 CCAACCACCTTCCAGATGTGAGG - Intronic
1056735201 9:89203563-89203585 CCCTGCATCTTCCAGTTGTGGGG + Intergenic
1057996994 9:99828075-99828097 CCCTCCAGGTTCCAGTTATGCGG + Exonic
1060867159 9:127009641-127009663 CCTTCCCACTTACTGTTCTGTGG + Intronic
1062073444 9:134571755-134571777 CCCTCCAACCTCCACTTCTGTGG + Intergenic
1062432627 9:136532831-136532853 CCTTCCCCCTTCCAGGTGTGGGG - Intronic
1185652450 X:1658237-1658259 CTCTCCAAGGTCCAGTTGTGAGG + Intergenic
1187160123 X:16756995-16757017 CCTTCTAACTTGCAGTTGCTTGG - Intronic
1188146190 X:26616701-26616723 CATTCCAATTGCCTGTTGTGGGG + Intergenic
1190990180 X:55540525-55540547 CCTTTCAACTTCTACTAGTGTGG + Intergenic
1192726735 X:73761825-73761847 CCTTGTAGATTCCAGTTGTGTGG + Intergenic
1193809839 X:86038378-86038400 CCTCCCCACTTCGAGTTGTCTGG + Intronic
1197994135 X:132354108-132354130 CCTTGGACTTTCCAGTTGTGTGG + Intergenic
1198513260 X:137375586-137375608 GCTTCCACCTACCAGTTGTGTGG + Intergenic
1199501088 X:148506714-148506736 ACTTCCCACCTCCAGTTTTGAGG - Intronic