ID: 945576046

View in Genome Browser
Species Human (GRCh38)
Location 2:211530537-211530559
Sequence GTTTTTGCTTAGGTTAGCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2197
Summary {0: 1, 1: 0, 2: 13, 3: 338, 4: 1845}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945576046_945576048 -9 Left 945576046 2:211530537-211530559 CCATAGCTAACCTAAGCAAAAAC 0: 1
1: 0
2: 13
3: 338
4: 1845
Right 945576048 2:211530551-211530573 AGCAAAAACAACAAAACTGAAGG 0: 1
1: 110
2: 1232
3: 7423
4: 17296
945576046_945576050 27 Left 945576046 2:211530537-211530559 CCATAGCTAACCTAAGCAAAAAC 0: 1
1: 0
2: 13
3: 338
4: 1845
Right 945576050 2:211530587-211530609 GACTTCAACTTACACTACCAAGG 0: 1
1: 0
2: 0
3: 28
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945576046 Original CRISPR GTTTTTGCTTAGGTTAGCTA TGG (reversed) Intronic
Too many off-targets to display for this crispr