ID: 945576371

View in Genome Browser
Species Human (GRCh38)
Location 2:211534959-211534981
Sequence TTTCTATTGTTACCATCACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 209}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945576367_945576371 19 Left 945576367 2:211534917-211534939 CCAGTTCTCACTCACATTTCATT 0: 1
1: 0
2: 2
3: 35
4: 339
Right 945576371 2:211534959-211534981 TTTCTATTGTTACCATCACCAGG 0: 1
1: 0
2: 2
3: 18
4: 209
945576366_945576371 20 Left 945576366 2:211534916-211534938 CCCAGTTCTCACTCACATTTCAT 0: 1
1: 0
2: 2
3: 44
4: 290
Right 945576371 2:211534959-211534981 TTTCTATTGTTACCATCACCAGG 0: 1
1: 0
2: 2
3: 18
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945576371 Original CRISPR TTTCTATTGTTACCATCACC AGG Intronic
901939463 1:12651101-12651123 TTTCTTTTGTTACCTCCAACAGG + Exonic
904874728 1:33645269-33645291 TTGTTATTGTTACTATAACCCGG - Intronic
908690738 1:66776768-66776790 TTTCTATTTTTACAAACCCCAGG + Intronic
909116106 1:71538979-71539001 TTACTTTTGTTTCCATCACATGG + Intronic
909671574 1:78194955-78194977 TTTGTATTCTTATCATCTCCTGG + Intergenic
909876182 1:80806699-80806721 TTTCTATTTTTATCATGACTGGG - Intergenic
911095273 1:94049764-94049786 CTTGTATTAATACCATCACCAGG - Intronic
912094937 1:106127780-106127802 TTTTTATTGTCACCATTAGCTGG - Intergenic
913288595 1:117251081-117251103 TTTCTAGTGTTAGCATCATAAGG - Intergenic
913389517 1:118295030-118295052 TTTCTATTGTCACAATGACAAGG - Intergenic
913978349 1:143484591-143484613 TTGTTTTTGTTACAATCACCAGG + Intergenic
914072757 1:144310239-144310261 TTGTTTTTGTTACAATCACCAGG + Intergenic
914106397 1:144656121-144656143 TTGTTTTTGTTACAATCACCAGG - Intergenic
919537795 1:198809995-198810017 TTTCTATTTTTACCTTCAGATGG - Intergenic
920825789 1:209423259-209423281 TTTCTATTATCTCCAGCACCTGG + Intergenic
923353937 1:233135187-233135209 TTTCTTTTGTTTCCAACAGCTGG - Exonic
1063083576 10:2791739-2791761 TTTCTATCATTAGCATCACTAGG - Intergenic
1063468375 10:6263492-6263514 TCTGCACTGTTACCATCACCTGG - Intergenic
1065686815 10:28293810-28293832 TTTTTATTGTTTCCTTCACTAGG - Intronic
1069763676 10:70835247-70835269 TTTGTATTCTTATCAGCACCTGG + Intronic
1070304401 10:75231044-75231066 TTTCCATTGTGACCAGCAGCAGG + Exonic
1072237836 10:93468504-93468526 TTTCTCTTGATACCATCTCTTGG - Intronic
1072822827 10:98574999-98575021 TTTTTATTTTTACCATTTCCTGG + Intronic
1073310347 10:102535635-102535657 TTTCTTCTGATACCATCACTGGG + Intronic
1074737930 10:116455302-116455324 TTTCTAGTGTTGCCTTAACCTGG + Intronic
1076020448 10:127068009-127068031 TTTCCATTCTAACCATCACATGG + Intronic
1078598312 11:12708676-12708698 TGTTTAGTGTTGCCATCACCTGG + Intronic
1085191931 11:74633924-74633946 TTTATACTGTTAACATCAGCTGG + Intronic
1085953527 11:81362989-81363011 GTTTTAGTGTGACCATCACCTGG + Intergenic
1087570097 11:99915954-99915976 TTTCTATCGTTATCTTCACAAGG - Intronic
1088821566 11:113461505-113461527 TTACTATTATTACTATTACCTGG + Intronic
1090046199 11:123336044-123336066 TTTCTACTATTACTATGACCTGG + Intergenic
1090766537 11:129880924-129880946 TCTCTCTTTTCACCATCACCAGG + Intronic
1092779180 12:11969677-11969699 TTTGTATTATTACCATAGCCTGG - Intergenic
1092785474 12:12022610-12022632 TTTCCTTTGTTTCTATCACCGGG - Intergenic
1094428991 12:30346224-30346246 TTTCTATTATTAGCCTCACCAGG + Intergenic
1097091846 12:56511908-56511930 TTTCTATTGTCACCAAACCCTGG - Intergenic
1099063136 12:77937837-77937859 TTGCTATTATTATCATCACATGG - Intronic
1099889828 12:88578018-88578040 ATTCTAATGTTATCCTCACCAGG - Intronic
1100694075 12:97072206-97072228 TTTCTGTTGTTAAAATCACCCGG - Intergenic
1102078354 12:110077921-110077943 TTTATATTCTTTCCATCACGAGG - Intergenic
1102492688 12:113298375-113298397 GTTCTATTGCCACCACCACCAGG - Exonic
1102987746 12:117292227-117292249 TTTCTATTCTTATCATCACCTGG - Intronic
1104539564 12:129650831-129650853 GTTCAAAAGTTACCATCACCTGG - Intronic
1105220994 13:18326866-18326888 TTGTTTTTGTTACAATCACCAGG - Intergenic
1106433371 13:29703412-29703434 TTTCTGCTGATACCCTCACCTGG + Intergenic
1106708553 13:32307573-32307595 TTTCTATGGTAACCATCAAAAGG + Intronic
1106859063 13:33885417-33885439 CTTTTACTGTAACCATCACCTGG + Intronic
1108961695 13:56241506-56241528 TCTCTATCTTTATCATCACCAGG + Intergenic
1109490020 13:63085483-63085505 TTTCCCTTGCTACCAACACCAGG - Intergenic
1109820927 13:67652836-67652858 TTACTATTGTTGCCATCCACAGG + Intergenic
1112764593 13:102727514-102727536 TGTCTATTGTTCCCATCTTCAGG - Intergenic
1112978270 13:105348302-105348324 TTTTTATTATTACCATTGCCTGG - Intergenic
1116072182 14:40061347-40061369 TTCCTATTGTTACAATCTACTGG - Intergenic
1116540344 14:46094444-46094466 TTTCTATTGTTAACAATATCAGG - Intergenic
1118827074 14:69393709-69393731 CTTTTATTGTAGCCATCACCTGG - Intronic
1120386877 14:83857657-83857679 TTTTTATTGTAACCAACACCTGG + Intergenic
1122850894 14:104530172-104530194 TTTCCATTGTCACTGTCACCCGG - Intronic
1125427916 15:39568143-39568165 TTTCTATTGTTACCAGCCTGTGG - Intergenic
1126136380 15:45396485-45396507 TTTCTATTTCTACCATCAATAGG - Intronic
1126343761 15:47671735-47671757 GTTTTATTGCTACCACCACCAGG - Intronic
1127747688 15:61997313-61997335 CTTCTATTGTTACAATCAGAGGG - Intronic
1131346992 15:91659077-91659099 TTCTTATTGTTAGGATCACCGGG - Intergenic
1131362431 15:91805359-91805381 TTTCTATTGCTACCTACAGCTGG - Intergenic
1132307629 15:100827905-100827927 TTTTTATTGTTATAATCAACAGG + Intergenic
1134358107 16:13503422-13503444 GTTCTTTTGTTAGCATTACCTGG + Intergenic
1138579341 16:57930162-57930184 TTTATATTGTTTCCATCTCTTGG - Intronic
1141392384 16:83675569-83675591 TTGTTATTGATACCAACACCAGG + Intronic
1141698820 16:85633142-85633164 TTTCTGTTTTTAGCATCTCCGGG + Intronic
1143811460 17:9475044-9475066 TTTCTATAGATACTATGACCTGG + Intronic
1144530100 17:16029809-16029831 TTACTTTATTTACCATCACCTGG - Exonic
1146056204 17:29582568-29582590 TGTCTACTGTTACCCTGACCTGG + Intronic
1148408513 17:47443431-47443453 TTTTTATTGTTACTATCATTTGG + Intergenic
1149857712 17:60097136-60097158 TTTCAATAGTTACCATCATCTGG - Intergenic
1152390350 17:80000565-80000587 TTTCTCTTGTTTCAAGCACCCGG + Intronic
1153494122 18:5680340-5680362 TTTTTATTGTTACTATCATGAGG + Intergenic
1153615129 18:6927155-6927177 TTTCCATTGTCACTACCACCAGG - Intergenic
1156139257 18:34085014-34085036 TTTTTGTTTTTACTATCACCTGG - Intronic
1156210279 18:34932598-34932620 TTATTATTGTTACCTTCAACAGG + Intergenic
1156941947 18:42778589-42778611 ATTCTATTGTTCACAGCACCAGG + Intronic
1158638316 18:59180528-59180550 TTTCTATTGGCACCAGCCCCAGG + Intergenic
1158988528 18:62844519-62844541 CTTCCACTGTTACCATCTCCTGG + Intronic
1162774539 19:12971197-12971219 TTCCTACTGGTACCATCATCAGG + Intronic
1163914595 19:20229647-20229669 TCTCTTTTGGTACCAACACCAGG - Intergenic
1165038821 19:33054503-33054525 TTTCTCTTGTTACAATCAAATGG + Intronic
1167309111 19:48726524-48726546 TTTCCTTTGTAATCATCACCTGG - Intronic
1167535583 19:50049175-50049197 TTTCTATTACTACCATGAGCAGG - Intronic
925455107 2:4009427-4009449 TTTCACTTGTTACCATCCCCAGG + Intergenic
927684887 2:25163565-25163587 TTAATCTTGTTGCCATCACCTGG - Intronic
930878238 2:56244210-56244232 TTTCTATGGTTTCCAACTCCAGG - Intronic
931737127 2:65206045-65206067 TTTCCATTGTGACCAGCAGCAGG + Intergenic
931974302 2:67626213-67626235 TTGCCATTTTTACCATAACCAGG - Intergenic
934093327 2:88574383-88574405 TTTCTTTTTTTTCCCTCACCTGG + Intronic
934293347 2:91719781-91719803 TTGTTTTTGTTACAATCACCAGG + Intergenic
935529831 2:104218851-104218873 TTTCTGTTGTTTAAATCACCTGG - Intergenic
935714029 2:105924356-105924378 TTCCTTTTGTTTCCATCTCCTGG - Intergenic
940913465 2:159229274-159229296 TTAATATTGTTACCATCCCATGG - Intronic
941807495 2:169723740-169723762 TTCATATTGTTTCCATCATCTGG - Intronic
944241527 2:197490237-197490259 TTTCTATTGTCACCAAACCCTGG + Exonic
945576371 2:211534959-211534981 TTTCTATTGTTACCATCACCAGG + Intronic
945728589 2:213504327-213504349 TTTGTTTTATTACCATAACCAGG - Intronic
946176639 2:217926239-217926261 TTTCTATTGTTTAAGTCACCCGG + Intronic
946852549 2:223921109-223921131 TATCCATGGTTACCAACACCCGG - Intronic
948904803 2:240973843-240973865 TTTCCACTTTTTCCATCACCTGG + Intronic
1168804874 20:666423-666445 TAGCTATTATTATCATCACCAGG - Intronic
1169571187 20:6907853-6907875 TTACTATTGTTGTAATCACCTGG - Intergenic
1169592775 20:7163724-7163746 TTTCTTTTGACCCCATCACCAGG - Intergenic
1177048916 21:16206552-16206574 TTTTTTTTGTTAACATCAGCCGG + Intergenic
1178064393 21:28888067-28888089 TTTCTATTGTCACCAAACCCTGG + Intergenic
1185016850 22:48348656-48348678 TTTCTATTGTTTCCATCTCTTGG - Intergenic
954730397 3:52656259-52656281 TTTCTTTTTTCAGCATCACCAGG + Intronic
955919699 3:63942704-63942726 TTTCTATTTTTACTATCAGTGGG - Intronic
956151265 3:66245455-66245477 TTTCTATTATGCCCATCACAAGG - Intronic
956357586 3:68411081-68411103 TATCTATTGTCCCCATCAGCTGG - Intronic
957013540 3:75036470-75036492 CCTCTATTGATTCCATCACCTGG + Intergenic
959341513 3:105137463-105137485 TTTTTATTGTTACCTTCACTCGG - Intergenic
960387267 3:117035501-117035523 TTTCCATTTTTCCCATCCCCTGG + Intronic
960580762 3:119276659-119276681 TTTCTATTGTTTAAACCACCTGG - Intergenic
962055363 3:131865825-131865847 TTTCTATTCTTCCCATCCACAGG - Intronic
962349443 3:134645902-134645924 ATTCTATTTTTACCATCTTCCGG - Intronic
963201969 3:142595576-142595598 TTTCTATTGTTACCATCTCAGGG + Intergenic
964919572 3:161880166-161880188 TTTCTATTATTACCATCTTTAGG - Intergenic
965886852 3:173456686-173456708 TTTCTACTGTTACTATTACCTGG - Intronic
968840047 4:2996729-2996751 TTTCTTTTCTTACCATCAACTGG + Intronic
970742755 4:19256877-19256899 CTGCTATTCTTACCATCAGCAGG - Intergenic
970802113 4:19985122-19985144 TTTATATAGATACCATAACCAGG - Intergenic
971594641 4:28513964-28513986 TTTCTTTTGTTATCATCCCCAGG - Intergenic
974484883 4:62492512-62492534 CTTCTTTTAATACCATCACCTGG - Intergenic
976550829 4:86393502-86393524 TTTCTAATGGAACCATTACCAGG + Intronic
980447766 4:132933148-132933170 TTTTTATTTTTACCATCACAAGG - Intergenic
981446606 4:144846533-144846555 TTTCTATTGTCACCAAACCCTGG - Intergenic
981898107 4:149828651-149828673 AATGTATTGTTACCTTCACCAGG - Intergenic
983104030 4:163663014-163663036 TTTGTATTGTTTGCATGACCTGG - Intronic
983519473 4:168692006-168692028 TTTGTATTTTTCCCATCAGCAGG + Intronic
986115307 5:4768128-4768150 TTTTTCTTCTCACCATCACCTGG + Intergenic
986909720 5:12540215-12540237 TTTCTAGTGTATCCATCACCTGG - Intergenic
987141764 5:14953660-14953682 TTTCCATTGTCACAATAACCAGG + Intergenic
987539348 5:19234251-19234273 TTTCAATTGTCACCAAAACCTGG - Intergenic
987739177 5:21883497-21883519 TTTCTATTGTCACCAAACCCTGG - Intronic
987885036 5:23801629-23801651 TTTTTAGTGTAACAATCACCAGG - Intergenic
988368399 5:30333311-30333333 TTACTATTGTTAAAATGACCAGG + Intergenic
989357520 5:40561234-40561256 CTTTTAGTGTAACCATCACCTGG - Intergenic
990166926 5:53004588-53004610 TTTCCATTTCTAGCATCACCTGG + Intronic
991182670 5:63771574-63771596 TCTCTGTAGTTTCCATCACCAGG - Intergenic
993057138 5:82994407-82994429 TTTCTTTTCTTACCTTCACTTGG + Intergenic
993278585 5:85895113-85895135 TTTCTATCTTTACCATAACCTGG - Intergenic
994389537 5:99175250-99175272 TTTTTTTTTTTACCAGCACCAGG + Intergenic
995352989 5:111203577-111203599 TTGCTTTTGTCATCATCACCTGG - Intergenic
996095891 5:119398791-119398813 TCTATATTGTTACCATTATCTGG + Intronic
996191395 5:120547139-120547161 TTCCTTTTGTCACCATCTCCAGG + Intronic
996649168 5:125852579-125852601 TTTCTATTCTTAACATACCCTGG + Intergenic
997043897 5:130290551-130290573 TTGCTACAGTTACCATCAACGGG + Intergenic
1004752566 6:18578391-18578413 TTTTTATTCTAACCTTCACCAGG - Intergenic
1006267238 6:32935646-32935668 TTTCTATTTTTTGCAGCACCTGG - Exonic
1008467585 6:51847834-51847856 TTTCCATTTCTTCCATCACCAGG - Exonic
1010051969 6:71515546-71515568 TTTATATTCTTACCAACAGCTGG - Intergenic
1011160894 6:84389307-84389329 TTTCTGTTATTACCACCGCCTGG + Intergenic
1011879228 6:92002895-92002917 CTTCTAATGGTGCCATCACCAGG - Intergenic
1016683772 6:146858892-146858914 TTTCTATTGTAAACATCACTAGG + Intergenic
1017917884 6:158846760-158846782 TTTCTATTGTTTCAGCCACCTGG - Intergenic
1021828661 7:24580328-24580350 TTTATATTGTTAAAATCCCCAGG + Intronic
1022221159 7:28315203-28315225 TTTGTATTGTCACCACCAACAGG + Intronic
1023278988 7:38550623-38550645 CTTCCAGTGTAACCATCACCTGG + Intronic
1025323117 7:58169771-58169793 TTTCTATTGTTGGCATCAAATGG - Intergenic
1025323332 7:58173855-58173877 TTTCTATTGTTGGCATCAAATGG - Intergenic
1025323450 7:58175900-58175922 TTTCTATTGTTGGCATCAAATGG - Intergenic
1025325231 7:58207908-58207930 TTTCTATTGTTGGCATCAAATGG - Intergenic
1025344594 7:58550594-58550616 TTTCTATTGTTGGCATCAAATGG - Intergenic
1025378086 7:59144169-59144191 TTTCTATTGTTGGCATCAAATGG - Intergenic
1025378176 7:59145871-59145893 TTTCTATTGTTGGCATCAAATGG - Intergenic
1025382950 7:59230360-59230382 TTTCTATTGTTGGCATCAAATGG - Intergenic
1025384725 7:59262028-59262050 TTTCTATTGTTGGCATCAAATGG - Intergenic
1025392497 7:59400323-59400345 TTTCTATTGTTGGCATCAAATGG - Intergenic
1025406696 7:59651582-59651604 TTTCTACTGTTAGCATCAAATGG - Intergenic
1025410202 7:59713587-59713609 TTTCTATTGTTGGCATCAAATGG - Intergenic
1025417216 7:59838287-59838309 TTTCTATTGTTGGCATCAAATGG - Intergenic
1025417830 7:59849189-59849211 TTTCTATTGTTGGCATCAAATGG - Intergenic
1025428748 7:60043372-60043394 TTTCTATTGTTGGCATCAAATGG - Intergenic
1025441042 7:60261758-60261780 TTTCTACTGTTAGCATCAAATGG - Intergenic
1025446606 7:60360561-60360583 TTTCTATTGTTGGCATCAAATGG - Intergenic
1025453373 7:60480827-60480849 TTTCTATTGTTGGCATCAAATGG - Intergenic
1025454725 7:60505022-60505044 TTTCTATTGTTGGCATCAAATGG - Intergenic
1025455595 7:60520357-60520379 TTTCTACTGTTAGCATCAAATGG - Intergenic
1025457629 7:60556800-60556822 TTTCTATTGTTGGCATCAAATGG - Intergenic
1025470902 7:60793600-60793622 TTTCTATTGTTGGCATCAAATGG - Intergenic
1025537579 7:61974717-61974739 TTTCTATTGTTGGCATCAAATGG - Intergenic
1026371659 7:69705725-69705747 TTTCTATTGTTTAAGTCACCTGG - Intronic
1026480101 7:70771303-70771325 TTTCTAATGATGCCCTCACCCGG + Intronic
1028534928 7:91881430-91881452 CTTCCATTGTCACCATCACTAGG - Intergenic
1028736940 7:94225025-94225047 CTTTTAGTGTAACCATCACCTGG + Intergenic
1034057613 7:148052353-148052375 TTTTTTTTTTTTCCATCACCTGG - Intronic
1034839493 7:154382536-154382558 TTTTTATTGTTACCATCCCATGG - Intronic
1035489693 7:159262974-159262996 CTTCTATTGTATCTATCACCAGG - Intergenic
1036047270 8:5157880-5157902 TTTGTTTAGTTACTATCACCTGG - Intergenic
1036283300 8:7419752-7419774 TTTCTATTGTCACCAAACCCTGG - Intergenic
1036338170 8:7891769-7891791 TTTCTATTGTCACCAAACCCTGG + Intergenic
1036413293 8:8522626-8522648 TGCCTATTGTTACTATCGCCTGG - Intergenic
1039016884 8:33159535-33159557 TTTCTCTGTATACCATCACCAGG + Intergenic
1041618131 8:59932176-59932198 TTTCTTTTGTTACTATTACGTGG - Intergenic
1042127140 8:65549595-65549617 TTTATATAGTAATCATCACCAGG + Intergenic
1042214814 8:66420192-66420214 TTCATATTGTTACCATCTACTGG + Intergenic
1042486174 8:69347920-69347942 TTTCAAAGGTTACCATCACAAGG + Intergenic
1043482547 8:80668000-80668022 TCTCAATTTTCACCATCACCAGG + Intronic
1043938948 8:86174775-86174797 TTTCTTCTGTTACCATCTCAAGG + Intergenic
1044170324 8:89043431-89043453 TTTCTCTTGTTACCAAAAACGGG + Intergenic
1045759140 8:105582965-105582987 TTTTTCTTGTTAGCAACACCTGG + Intronic
1049262754 8:141648617-141648639 TTGCTATTGTCACCATAACCAGG - Intergenic
1051103119 9:13545634-13545656 TTACTATTATTATCATCATCAGG - Intergenic
1052242245 9:26288093-26288115 TGTCTATTGTTCCCATCCCTCGG + Intergenic
1054910421 9:70450221-70450243 TTTCAATGGCTACCATCTCCTGG - Intergenic
1055428332 9:76218270-76218292 TTTTTATTATTAGCATCGCCTGG - Intronic
1056121130 9:83490214-83490236 TTTCCATTGCAACCATCCCCAGG - Intronic
1060392233 9:123287480-123287502 ATACTATTATTACCATCAACAGG - Intergenic
1060926045 9:127456011-127456033 TTTCTATTATTACTAACACCGGG - Intronic
1186360483 X:8836143-8836165 CTTCTATTGTTCCCATAAGCAGG - Intergenic
1186360931 X:8840827-8840849 TTTCTATAGGTACCATGACTTGG - Intergenic
1188058836 X:25575521-25575543 TTTGTATGGTTGCCATCAACAGG - Intergenic
1188712764 X:33421919-33421941 TTTTTGGTGTAACCATCACCTGG - Intergenic
1191235720 X:58132213-58132235 TTTCTATTGTTAGAATGCCCAGG - Intergenic
1193897009 X:87127085-87127107 TTTCTATTGTTACCATACCTGGG - Intergenic
1194692856 X:97009068-97009090 TTTCTAAGGTTACCAACTCCAGG - Intronic
1195301358 X:103533206-103533228 TTTTTATTTTTGCCATCAACTGG - Intergenic
1195573683 X:106425275-106425297 TTCATACTGTTCCCATCACCTGG + Intergenic
1195910722 X:109886232-109886254 TTTCTTTTTTTTCCATCACTGGG - Intergenic
1196799951 X:119533455-119533477 TTTCTAATGCCATCATCACCTGG + Intergenic
1197128600 X:122977206-122977228 TTTCTATTGAGAACATCACAAGG + Intergenic
1201851648 Y:18489568-18489590 TTTCTATTGTTCACATGGCCAGG + Intergenic
1201881672 Y:18830812-18830834 TTTCTATTGTTCACATGGCCAGG - Intergenic
1202346971 Y:23941398-23941420 TTTCTATTGTTCACATGGCCAGG - Intergenic
1202523800 Y:25728692-25728714 TTTCTATTGTTCACATGGCCAGG + Intergenic