ID: 945577136

View in Genome Browser
Species Human (GRCh38)
Location 2:211545730-211545752
Sequence GTACTTTCCCTGGCAAGAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 117}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945577136_945577142 28 Left 945577136 2:211545730-211545752 CCAGTTCTTGCCAGGGAAAGTAC 0: 1
1: 0
2: 0
3: 7
4: 117
Right 945577142 2:211545781-211545803 TTATACAATTAGCCTTGTCAAGG 0: 1
1: 0
2: 1
3: 10
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945577136 Original CRISPR GTACTTTCCCTGGCAAGAAC TGG (reversed) Intronic
904484742 1:30817234-30817256 GAACTTTCCCTGCCCAGAGCAGG + Intergenic
906550796 1:46665081-46665103 GTACTTTGCCTAGAAAGAGCAGG + Intronic
906682162 1:47735703-47735725 GTACTTTCCCTGTCTTGAGCAGG - Intergenic
908276460 1:62477585-62477607 GTAGTTTACTTGGCAAGATCTGG + Intronic
908554345 1:65242408-65242430 ATACTTTCCCTTTCAAGACCTGG + Intergenic
909433085 1:75612450-75612472 GTAATTTGCATGCCAAGAACTGG - Intergenic
910306273 1:85767803-85767825 CTACTTTACCAGGCTAGAACTGG + Intronic
910493413 1:87798514-87798536 GTACTTTCTCTAGCCAGAAGAGG + Intergenic
915772955 1:158448547-158448569 GGACTTTCCCTGGTAAGATCTGG - Intergenic
918162169 1:181911513-181911535 GTAATTTCTCTGGGAAGAAACGG + Intergenic
918371788 1:183868319-183868341 GGACTTTCCCTGGTAAGCAGTGG + Intronic
922231832 1:223693908-223693930 GGACTCTCCCTGGCAAAATCTGG + Intergenic
1069040661 10:63692459-63692481 TTACTTTCTCTGGCCAGGACTGG + Intergenic
1073911061 10:108345236-108345258 GTACTTTTCCTGGCAAGTCACGG + Intergenic
1074059939 10:109955879-109955901 ATACATTCCCTGGCAATAATTGG - Intergenic
1074871703 10:117582035-117582057 GACCTTTCCTTGGGAAGAACGGG + Intergenic
1080487269 11:32722386-32722408 GTACTTCCCCTGCCAATGACTGG - Intronic
1080652831 11:34236206-34236228 GTTTTTTCCCTGGAAAGAAGAGG + Intronic
1081584001 11:44371820-44371842 GTACTTTATCTGGCAACACCAGG + Intergenic
1084708051 11:70827221-70827243 GTAATTACCCTGGAAAAAACAGG + Intronic
1084788947 11:71461362-71461384 GCATCTTCCATGGCAAGAACAGG + Intronic
1084965873 11:72744223-72744245 GTGCTTTCTCAGGCAAGACCAGG + Intronic
1086356066 11:86001114-86001136 GTGTCTTCCCTGGCAAGCACTGG - Exonic
1087117845 11:94544004-94544026 GTACCTTCCCAGGGATGAACCGG + Exonic
1091721495 12:2817299-2817321 GACCATTCCCTGGCAGGAACAGG - Exonic
1093906847 12:24703169-24703191 GTACATTACATGGCAAGAGCAGG - Intergenic
1096117942 12:49066693-49066715 GTACTCATCCTGGCAAGAAATGG + Exonic
1099871230 12:88351834-88351856 GCACTTCACATGGCAAGAACAGG + Intergenic
1106140832 13:27009934-27009956 ATACTTTCTCTGGCTAGATCTGG + Intergenic
1110004506 13:70249515-70249537 GTACATTCCCTAACAAGGACAGG - Intergenic
1116101630 14:40445472-40445494 CTACTTTCTCTGTAAAGAACAGG + Intergenic
1117386785 14:55222713-55222735 GGAGTTTCCTTGGAAAGAACAGG - Intergenic
1117443164 14:55778854-55778876 GCACTTTCCATGGAAAGAGCTGG + Intergenic
1119758889 14:77137722-77137744 GTTCTATGCCTGGGAAGAACTGG + Intronic
1122233925 14:100321608-100321630 GTATTTGCCCTGCCCAGAACAGG + Intergenic
1122502747 14:102212258-102212280 GTACACTCCTTGGCAAAAACTGG - Intronic
1123865975 15:24519779-24519801 GAATTTACCCTGGCAAGGACTGG - Intergenic
1124507555 15:30291522-30291544 GCACTGTCCCTGACAAAAACGGG + Intergenic
1124736000 15:32247136-32247158 GCACTGTCCCTGACAAAAACGGG - Intergenic
1128280019 15:66386962-66386984 GCACTTTCCCCGGCAGGAGCTGG + Exonic
1136074928 16:27810535-27810557 GTATGTTCCCTGGGAAGTACAGG - Intronic
1142259190 16:89034666-89034688 GCACCTTCCCTGGCAAGGTCAGG + Intergenic
1143043204 17:4055044-4055066 GTACTGTCCCTGGCACTTACAGG + Intronic
1145959969 17:28881521-28881543 GGCCTTTCCCTGGCCAGAGCCGG - Intronic
1157027380 18:43861614-43861636 TTACTTTTACTGGCAAAAACCGG + Intergenic
1157977428 18:52341966-52341988 TTAATTTCCCAGGCACGAACTGG - Intronic
931264769 2:60650844-60650866 CTACATTGCCTGGCATGAACAGG + Intergenic
932142486 2:69292317-69292339 GTTCTTTCCTTAGGAAGAACGGG + Intergenic
935801347 2:106699712-106699734 CTACTTTCCATTGCAAGAAATGG + Intergenic
940437242 2:153669343-153669365 GTACTTACACTGGCAAGCAATGG - Intergenic
942961911 2:181840003-181840025 ACACTTTCCCTGGACAGAACTGG - Intergenic
945577136 2:211545730-211545752 GTACTTTCCCTGGCAAGAACTGG - Intronic
946398945 2:219458596-219458618 GTGCTTCCCCTGGCATGACCTGG - Intronic
1173966226 20:47114872-47114894 GTACTTCACCTGGCAAAAGCAGG - Intronic
1178165253 21:29967242-29967264 GAACAGTCCCTGGCAAGAAGAGG - Intergenic
1180152382 21:45956825-45956847 GCACATCCCATGGCAAGAACAGG + Intergenic
949511406 3:4770144-4770166 GTGCCTTCCCTGGCCAGATCTGG - Intronic
950039465 3:9910737-9910759 GCACTATTCCTGGCCAGAACAGG - Intronic
951049808 3:18081628-18081650 GTAATTTCACAGGCAACAACTGG - Intronic
951734632 3:25850783-25850805 GTAATTTACATGGCAAGACCAGG - Intergenic
951868075 3:27329581-27329603 CTACCTTCCCAGGAAAGAACTGG - Intronic
955873171 3:63461365-63461387 TTACGTTTCCTGGAAAGAACTGG - Intronic
958781961 3:98553286-98553308 GTACTTCAACTAGCAAGAACTGG - Intronic
964515160 3:157499741-157499763 ATACTTTCCCAGGGAAGAATGGG + Intronic
971685378 4:29759103-29759125 GTAATATTTCTGGCAAGAACTGG + Intergenic
971758919 4:30738297-30738319 GTACTTTCCCAGGAATGGACGGG - Intronic
973167485 4:47095410-47095432 GTACTGTCCCTGGCAAATAATGG + Intronic
979535721 4:121818341-121818363 CTACTTTCCCTGCCAGCAACAGG + Intronic
980700530 4:136423050-136423072 GTACTGGTCCTGGCAAGAAGTGG + Intergenic
981125574 4:141102452-141102474 CTACTTTCCCTGGCAACACAGGG + Intronic
990488317 5:56280323-56280345 GTCCTTTCCCTTGGAAGAATTGG + Intergenic
994940827 5:106321755-106321777 TTACTTTCCAGGGCAAAAACTGG + Intergenic
996041757 5:118822016-118822038 GCCCTTCCCCTGGCAAGACCAGG - Intergenic
997024086 5:130037335-130037357 GTACCTTCCTTGGCAAGAGGGGG - Intronic
997888014 5:137648716-137648738 GTCCTTTCCCTGAGAGGAACAGG - Intronic
999611746 5:153377325-153377347 GTAGTTTCCCTGGAAAAAATAGG - Intergenic
999988490 5:157027286-157027308 GTAGTTTCTCTGGAAAGACCTGG - Intergenic
1003755803 6:9118594-9118616 GTATTTTCCCAGGCCAGAGCTGG + Intergenic
1004265867 6:14148151-14148173 TTACATTTCCTGGCAAGAAGTGG + Intergenic
1005536359 6:26759951-26759973 ATTCTTTTCCTGGAAAGAACAGG - Intergenic
1007018626 6:38496114-38496136 GCTCTGTCACTGGCAAGAACAGG + Intronic
1007961910 6:45967763-45967785 GCACTTTCCATGGCAAAAGCAGG + Intronic
1008806210 6:55431734-55431756 GCACTTTACATGGCAAAAACAGG - Intergenic
1009007258 6:57802350-57802372 ATTCTTTTCCTGGAAAGAACAGG - Intergenic
1009321920 6:62301986-62302008 GTAATTTCCCTGGCTAGAATTGG - Intergenic
1010210301 6:73357683-73357705 GTTCTTTCCTTGGCAAGGTCGGG - Intergenic
1016647956 6:146431998-146432020 GTGGTGTCCCTGGCAAGAACAGG - Intronic
1018929514 6:168231417-168231439 GTTCTTTCCCTTGGAGGAACAGG + Intergenic
1019119973 6:169794591-169794613 GTTCTTTCCCTTCCAAGAGCAGG + Intergenic
1020215522 7:6187188-6187210 GTACTTTCCCCCGCAACAACGGG + Intronic
1020371716 7:7439273-7439295 ATACATGCCTTGGCAAGAACTGG - Intronic
1022108169 7:27211520-27211542 GTGCTTCCCCTGGGAAGAACTGG + Intergenic
1022685074 7:32589486-32589508 GAACTTTCCTTGGAAAGAACAGG - Intergenic
1027856365 7:83516841-83516863 GTAGTTTCCCTGGAAGGTACTGG - Intronic
1030691496 7:112539547-112539569 GTACTTTCTCTGGTAAAAAGAGG - Intergenic
1031741100 7:125431933-125431955 GCACTTTATGTGGCAAGAACTGG - Intergenic
1033543924 7:142382526-142382548 TTATTTTCCCTTGGAAGAACAGG + Intergenic
1037348771 8:17927012-17927034 GTACTTTTCCTGACAGTAACTGG - Intronic
1037720669 8:21441058-21441080 GTATTTCCCCTGGGAACAACGGG + Intergenic
1038276407 8:26125073-26125095 AAACTTTTCCTGGAAAGAACTGG - Intergenic
1039081900 8:33741670-33741692 GTACTTGCCCAGGCCAAAACTGG - Intergenic
1039302041 8:36220125-36220147 GTGATTTCCCTGGGAAGAAATGG - Intergenic
1039841358 8:41295554-41295576 GTACCTTCCCTGGAAAGACCTGG + Intronic
1040384720 8:46906595-46906617 GTGCTTTGCCTGGCAAAAGCTGG - Intergenic
1041055934 8:53985947-53985969 GTACTTTCCTTTTCAATAACAGG + Intronic
1042633034 8:70842349-70842371 CTACTTTCCTTGCCAAGACCTGG + Intergenic
1042674072 8:71299195-71299217 GTACTGACCCTGGCCAAAACTGG + Exonic
1044261300 8:90125951-90125973 GTACTTTTCCTGACCAAAACTGG - Intergenic
1049784320 8:144443397-144443419 GCTCTTTCCTTAGCAAGAACAGG - Intronic
1050572642 9:6957428-6957450 TTCTTTTCCCTGGAAAGAACAGG - Intronic
1051209555 9:14727287-14727309 GTTCTCTCCATGGCAAGGACAGG - Intergenic
1052838274 9:33267695-33267717 GTACTTCCCCTCCCAAAAACAGG - Intronic
1053397342 9:37786789-37786811 TTAGTTTCCCTGGCAAGAGTGGG + Intronic
1056578930 9:87876416-87876438 GTGCTTTCCCTGACAAGGGCAGG + Intergenic
1057971408 9:99561737-99561759 GTACTTTCCCTGGCATTCAATGG + Intergenic
1061203064 9:129148266-129148288 GAACTTTCCCTGGCAGGGAGGGG + Exonic
1061237753 9:129352243-129352265 GTCGTTTCCCTGGCAACAGCCGG + Intergenic
1061826755 9:133262593-133262615 CTCCTCTCCCTGGCAGGAACTGG - Intronic
1062383940 9:136301143-136301165 TTACTTCCCTTTGCAAGAACAGG - Intronic
1188183434 X:27085035-27085057 GTATTATTCCTGGGAAGAACTGG - Intergenic
1188215021 X:27465167-27465189 TTGCTTTCCCTTGCAATAACAGG - Intergenic
1188820719 X:34771440-34771462 TAACTTTCCCTGGTCAGAACAGG - Intergenic
1190769985 X:53506143-53506165 CTACCTTGCCTGGCAAGAATAGG - Intergenic
1198303958 X:135361590-135361612 GTCATTTGCCTGGTAAGAACTGG + Exonic
1199308242 X:146292718-146292740 CTAGTTTCCCTGGCACCAACGGG + Intergenic