ID: 945578774

View in Genome Browser
Species Human (GRCh38)
Location 2:211566022-211566044
Sequence TCATCTTGTTGCAGTCCTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 219}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945578774_945578781 23 Left 945578774 2:211566022-211566044 CCACCAGGACTGCAACAAGATGA 0: 1
1: 0
2: 2
3: 15
4: 219
Right 945578781 2:211566068-211566090 TTGAGGCGTCACGCCTAGCAAGG 0: 1
1: 0
2: 0
3: 2
4: 25
945578774_945578778 -6 Left 945578774 2:211566022-211566044 CCACCAGGACTGCAACAAGATGA 0: 1
1: 0
2: 2
3: 15
4: 219
Right 945578778 2:211566039-211566061 AGATGATGACTGGAAGTTCCGGG 0: 1
1: 0
2: 1
3: 30
4: 307
945578774_945578777 -7 Left 945578774 2:211566022-211566044 CCACCAGGACTGCAACAAGATGA 0: 1
1: 0
2: 2
3: 15
4: 219
Right 945578777 2:211566038-211566060 AAGATGATGACTGGAAGTTCCGG 0: 1
1: 0
2: 0
3: 28
4: 177
945578774_945578779 6 Left 945578774 2:211566022-211566044 CCACCAGGACTGCAACAAGATGA 0: 1
1: 0
2: 2
3: 15
4: 219
Right 945578779 2:211566051-211566073 GAAGTTCCGGGTGCACTTTGAGG 0: 1
1: 0
2: 0
3: 3
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945578774 Original CRISPR TCATCTTGTTGCAGTCCTGG TGG (reversed) Intronic