ID: 945579250

View in Genome Browser
Species Human (GRCh38)
Location 2:211572346-211572368
Sequence ACGCTAACAATCTGTGACAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 60}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945579250 Original CRISPR ACGCTAACAATCTGTGACAT TGG Intronic
902546565 1:17194106-17194128 ACCCTAACATTCAGTGTCATTGG + Intergenic
911805063 1:102195446-102195468 ACTCCTACAATGTGTGACATAGG - Intergenic
912770174 1:112456614-112456636 ACGGGAAAAATCTGTGGCATTGG + Exonic
913586250 1:120278178-120278200 ACCTTAACAACCTGTGACCTTGG + Intergenic
913621936 1:120620191-120620213 ACCTTAACAACCTGTGACCTTGG - Intergenic
914568259 1:148890036-148890058 ACCTTAACAACCTGTGACCTTGG + Intronic
914604566 1:149240213-149240235 ACCTTAACAACCTGTGACCTTGG - Intergenic
915907757 1:159891304-159891326 ACTCTTACAATCTTTGATATTGG + Intronic
922474555 1:225898324-225898346 TCGTTAACAATCTGCGACCTCGG - Intronic
924620174 1:245653507-245653529 ATTCTGACAACCTGTGACATAGG + Intronic
1063193179 10:3717217-3717239 ACGGTATTAATCTGAGACATAGG + Intergenic
1064087988 10:12359949-12359971 ACACTAACATCCTGTGACCTGGG - Intronic
1068954538 10:62810678-62810700 ACGCCAACAAGCTGGGAAATAGG + Intergenic
1083616030 11:64027141-64027163 CTGCTAACCCTCTGTGACATCGG - Intronic
1085652052 11:78277299-78277321 ACTCTAACAATGTGAGAAATGGG - Intronic
1091055255 11:132412091-132412113 AGGCTAACACTCTGTGATGTAGG - Intergenic
1091882571 12:3991307-3991329 ACGTTGACAATGTGTGACAGAGG + Intergenic
1092074025 12:5657989-5658011 AGGCCAGCAATCTGTGAAATGGG + Intronic
1098090421 12:66895032-66895054 AGGCTGACAATCTGGCACATTGG - Intergenic
1106971571 13:35147223-35147245 ATGCTAACAATCTGTCATCTGGG - Intronic
1109612955 13:64790761-64790783 ACTCTTACAATCTGTGAACTTGG - Intergenic
1113217262 13:108056776-108056798 ATTCTAATCATCTGTGACATAGG + Intergenic
1121490291 14:94353898-94353920 ATGCTCACAATCTGAGATATTGG + Intergenic
1126168334 15:45672852-45672874 ACGTTCACCATCTGTGAAATGGG - Intronic
1130019439 15:80215611-80215633 AATCTAAAAAGCTGTGACATTGG - Intergenic
1133491176 16:6270271-6270293 ACTCTAACAATCTCTTACAAAGG - Intronic
1153672808 18:7428668-7428690 ACACTCAGCATCTGTGACATGGG - Intergenic
1167850760 19:52199773-52199795 ACACTAACAATCACTGACCTGGG - Intronic
926923976 2:17968228-17968250 ACACTAAAAATCTGTGGCAGAGG + Intronic
927415259 2:22872679-22872701 ACTTTAACAAGCTGTGACTTGGG - Intergenic
929630034 2:43450326-43450348 AAGATATAAATCTGTGACATCGG + Intronic
930410561 2:51020622-51020644 TCGCAAACAATCTGTGAAGTAGG + Intronic
932786614 2:74610436-74610458 AGGGAAACAATTTGTGACATTGG - Intronic
945401566 2:209388685-209388707 ATGCACACAATCTGTGACCTAGG - Intergenic
945579250 2:211572346-211572368 ACGCTAACAATCTGTGACATTGG + Intronic
1181137753 22:20780862-20780884 ACCCTAGCAATCTGTTAAATTGG + Intronic
951095446 3:18624497-18624519 ATACTACCAATCTTTGACATAGG - Intergenic
953682365 3:45049374-45049396 ATGCTGGCAATCTGTGAGATAGG - Intergenic
956204526 3:66741629-66741651 ATGGTAAAAATCTGTGACAGGGG + Intergenic
959577212 3:107947343-107947365 ACTCTAATCTTCTGTGACATGGG - Intergenic
962039504 3:131690957-131690979 TCTCTCACAATCAGTGACATTGG - Intronic
964018834 3:151982184-151982206 AGGCTAAAAGTTTGTGACATTGG - Intergenic
966927571 3:184655392-184655414 ACGCTCAGAATCAGAGACATGGG + Intronic
974389399 4:61245972-61245994 ATGCTAACAAACTGTGGCAGGGG - Intronic
977143901 4:93411458-93411480 ACTCTATCACTCTGTCACATAGG + Intronic
980113903 4:128660986-128661008 ACTCTAACATTCTGTGACTCTGG - Intergenic
980202967 4:129678823-129678845 AACCTACCAATCTGTGACATTGG - Intergenic
982277541 4:153651878-153651900 TCACTTACAAGCTGTGACATAGG - Intergenic
985524130 5:393287-393309 AAGACAAGAATCTGTGACATCGG - Intronic
985854611 5:2415342-2415364 ATGCTTACAAGCTGTCACATGGG - Intergenic
987582043 5:19806527-19806549 ACGATATAAATCTTTGACATTGG - Intronic
994112593 5:96023585-96023607 ATGCTAAAAACCTGTGAAATGGG + Intergenic
1016702513 6:147069621-147069643 ACGGGTACAATCTGTAACATAGG + Intergenic
1021025990 7:15667417-15667439 ATGGTGACAATCTGTGACAGAGG - Intronic
1024969618 7:55056493-55056515 ATTCTAACAATATGTGAAATGGG - Intronic
1030568464 7:111190629-111190651 TCACTAACAATATGTGACCTTGG + Intronic
1033956256 7:146852099-146852121 ATGGTAACATTCTGAGACATTGG + Intronic
1036007338 8:4681121-4681143 AAGCAAACAATTTTTGACATAGG + Intronic
1043394139 8:79820241-79820263 ACACTGATAAGCTGTGACATCGG - Intergenic
1051286177 9:15499282-15499304 ACTCTTACAAGCTTTGACATTGG - Intronic
1054994993 9:71375806-71375828 ATGCTAACAATCTGAGCCATTGG - Intronic
1058060293 9:100488373-100488395 ACGTTAACAATCTTGGACATAGG + Intronic
1061847389 9:133395304-133395326 ATGCTCACACTCTGTGAAATGGG + Intronic
1189843008 X:45102113-45102135 ACACTACAAATCTGAGACATTGG + Intronic