ID: 945586051

View in Genome Browser
Species Human (GRCh38)
Location 2:211664430-211664452
Sequence CTTTATGGGCAGTAGGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 348
Summary {0: 1, 1: 1, 2: 2, 3: 34, 4: 310}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945586045_945586051 5 Left 945586045 2:211664402-211664424 CCTATAGGCATTCACAATGGAGA 0: 1
1: 0
2: 0
3: 13
4: 107
Right 945586051 2:211664430-211664452 CTTTATGGGCAGTAGGAGGATGG 0: 1
1: 1
2: 2
3: 34
4: 310

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945586051 Original CRISPR CTTTATGGGCAGTAGGAGGA TGG Intronic
900394305 1:2446868-2446890 CTGCAGGGGCAGGAGGAGGAAGG - Intronic
901210191 1:7520251-7520273 GTTTTTAGGCAGGAGGAGGAGGG - Intronic
902755404 1:18546116-18546138 CTCTATGGCAAGTGGGAGGAGGG - Intergenic
906152041 1:43593030-43593052 TTTCATGGGGAGTATGAGGAAGG - Intronic
906860684 1:49355904-49355926 CTTTCTGGGCAGTACTGGGAAGG - Intronic
906869611 1:49463470-49463492 CTTTATGGGCAGTAAGCTGCTGG - Intronic
907480149 1:54740166-54740188 TTTTTTGGGTAGTGGGAGGAGGG - Intronic
907744160 1:57196032-57196054 GGTGATGGGGAGTAGGAGGAAGG + Intronic
908715956 1:67069160-67069182 CTTTATGAGCAGCATGAGAATGG + Intergenic
908748177 1:67395664-67395686 CTTTGTGGCCAGTTGGAGCAGGG - Exonic
909960505 1:81835051-81835073 GTTTGTGGGAAGGAGGAGGAAGG - Intronic
909984523 1:82144152-82144174 CTTTATAGGCAGCATGAGAATGG + Intergenic
910649987 1:89556275-89556297 ATTTGAGGGCAGTGGGAGGATGG - Intronic
911037869 1:93569419-93569441 CATGGTGGGCAGCAGGAGGAAGG - Intronic
912260605 1:108108504-108108526 CTTTGTGGCAAATAGGAGGAGGG - Intergenic
912816311 1:112831508-112831530 TTTTATGGGCAGTAGGAAAAAGG - Intergenic
915269303 1:154742291-154742313 GTGTGTGGGCAGTAGGTGGATGG - Intronic
915987566 1:160481749-160481771 CTTAATGGGCATTAAAAGGAGGG + Intergenic
920399396 1:205667872-205667894 CTATCTGGGCTGTAGGAGGATGG - Intronic
923915423 1:238497736-238497758 CTTTATAAGCAGTATGAGAATGG + Intergenic
1063521045 10:6741309-6741331 ATTAATGGCAAGTAGGAGGATGG + Intergenic
1063856234 10:10257324-10257346 CTGTCTGTGCAGCAGGAGGAGGG - Intergenic
1064716643 10:18183404-18183426 CTTTATTTGCAGTGTGAGGATGG - Intronic
1065292496 10:24245040-24245062 GTTTATGGGAAGCATGAGGATGG + Intronic
1067393577 10:45888989-45889011 CTTTATGTGGAGTAGTATGATGG + Intergenic
1067861901 10:49858132-49858154 CTTTATGTGGAGTAGTATGATGG + Intronic
1068878909 10:62027953-62027975 CTTTATGGGAGGAAGGAGAAAGG + Intronic
1069939526 10:71944988-71945010 TTTTATGGGCAGTAGGAAAAAGG - Intergenic
1070605923 10:77898550-77898572 CTCTATTGGCAGGAGGAGGCAGG - Intronic
1071087447 10:81879054-81879076 CTTTAAAGGCAGGAGGAGAAAGG + Intronic
1071169622 10:82848990-82849012 CTTTATTAGCAGTATGAGAATGG + Intronic
1071990427 10:91096232-91096254 CTTTATTAGCAGTATGAGAATGG - Intergenic
1072129827 10:92483636-92483658 CTTTCTGGACACTAGGAGGAAGG + Intronic
1072335165 10:94391396-94391418 CTTTATGGGCAGTAGGAAGAAGG - Intergenic
1072778648 10:98227339-98227361 TTTTATTGGGAGAAGGAGGAAGG - Intronic
1073070182 10:100788371-100788393 CTGGAGGGGCAGTGGGAGGAGGG + Intronic
1073073594 10:100809760-100809782 CTCTCTGGGAAGCAGGAGGAAGG - Intronic
1073848341 10:107585627-107585649 ATTCATGCGCACTAGGAGGATGG - Intergenic
1074082945 10:110182231-110182253 CTGTCTGGGCAGGAGGAAGAAGG - Intergenic
1074094787 10:110301997-110302019 CTTCTTGGGCAGTGGGAGGAGGG - Intronic
1074558030 10:114509789-114509811 CTTTATTGGCAGTGTGAGAACGG - Intronic
1075643788 10:124084484-124084506 CTTGATGGGCAGCAGGAGCTGGG - Intronic
1075952454 10:126493278-126493300 CTCTCTGGGCAGTAGGATTATGG + Intronic
1077401728 11:2361845-2361867 GTCTAAGGGCAGTAGGAGGTGGG - Intergenic
1080115220 11:28614710-28614732 CTTTATTAGCAGTATGAGAATGG - Intergenic
1080949437 11:37013373-37013395 CTTTATTAGCAGTATGAGAATGG + Intergenic
1081299192 11:41429328-41429350 CTTTATTAGCAGCATGAGGACGG + Intronic
1081590848 11:44422087-44422109 TGTTATGGGCAGGGGGAGGAGGG - Intergenic
1081634980 11:44715054-44715076 CTTTATTAGCAGTGTGAGGATGG - Intergenic
1083887741 11:65581081-65581103 CTTTGTGAGGAGGAGGAGGAAGG + Exonic
1084684386 11:70685266-70685288 TTTTCTGGGCGGCAGGAGGAGGG - Intronic
1085169651 11:74438480-74438502 GATTATGGGGAGTAAGAGGAAGG + Intergenic
1085240093 11:75045935-75045957 TTTTATGGGCAGTAGGAAGAAGG - Intergenic
1086920041 11:92575804-92575826 GTTAATAGGCAGAAGGAGGAAGG + Intronic
1087226466 11:95606385-95606407 CTTTATTGGCAGTGTGAAGACGG - Intergenic
1087895098 11:103577903-103577925 TTTTATGGGCAGTAGAAAAAAGG - Intergenic
1087960938 11:104348071-104348093 CTTTATTAGCAGTATGAGAACGG + Intergenic
1089441904 11:118524586-118524608 GTTCATGGGCAAAAGGAGGAAGG - Exonic
1090441539 11:126728937-126728959 CTTTCGGGGCAGAGGGAGGAGGG + Intronic
1090974095 11:131667299-131667321 CTTTCTAGGCAGAAGGAGTAAGG - Intronic
1091060939 11:132461649-132461671 CTTTATTAGCAGTATGAGAATGG - Intronic
1091605632 12:1949164-1949186 CTGTATGGGCAGGAGGAGGCTGG + Exonic
1092752597 12:11732689-11732711 CTCTAGAGGCAGAAGGAGGACGG - Intronic
1093130154 12:15382106-15382128 ATTTCAGGGAAGTAGGAGGAAGG + Intronic
1093833688 12:23799312-23799334 ATTAATGGGCATTAGAAGGAAGG - Intronic
1093875896 12:24349025-24349047 CTTTATTGGCAGTGTGAGAATGG + Intergenic
1093932706 12:24970193-24970215 CTGCATGTGCATTAGGAGGATGG - Intergenic
1094046106 12:26168641-26168663 CATTCTGGGCAGCAGGAAGAAGG + Intronic
1094801031 12:34036275-34036297 CTTTATTGGCAGCATGAGAATGG - Intergenic
1095114170 12:38332287-38332309 CTTTATTGGCAGCATGAGAATGG - Intergenic
1095854345 12:46843855-46843877 CTTTTATGGCAGGAGGAGGAAGG - Intergenic
1096238179 12:49943719-49943741 CATTGTGGGCACTAGCAGGAGGG - Intergenic
1097385006 12:58940045-58940067 CTTTATTGGCAGTGTGAGAATGG + Intergenic
1097402655 12:59148317-59148339 CTTTATTGGCAGCATGAGAACGG + Intergenic
1097879183 12:64671646-64671668 CTTCCTTGGCAGGAGGAGGAAGG + Intronic
1097945892 12:65366958-65366980 CTTAAGGGACAGGAGGAGGAGGG + Intronic
1102397620 12:112600803-112600825 CTTTATTAGCAGCATGAGGACGG - Intronic
1102666259 12:114576012-114576034 CTTTCAGGGCATTTGGAGGAAGG - Intergenic
1102903536 12:116657479-116657501 GTTTATGAGGAGTCGGAGGAGGG - Intergenic
1104262679 12:127198905-127198927 CTTTATTAGCAGTATGAGAACGG - Intergenic
1104300362 12:127559438-127559460 CTGTGTGGGGAGTGGGAGGAGGG + Intergenic
1104413030 12:128575088-128575110 CTTTCTCGGCAGTAGGATTATGG + Intronic
1105516053 13:21091758-21091780 CTTTATGGGCAGCGGGAGAATGG - Intergenic
1106061217 13:26294427-26294449 CTATATAGCCAGTAGTAGGATGG + Intronic
1106546000 13:30731707-30731729 CTTTCTGGGCAATGGGAGGGGGG + Intronic
1106570039 13:30918583-30918605 CATTCTGAGCAGGAGGAGGAAGG - Intronic
1107564632 13:41589577-41589599 CTTTGTGGGGAGAGGGAGGAAGG - Intronic
1108724995 13:53170968-53170990 CTTTTTTGGCAGTAGGGTGAGGG + Intergenic
1108729038 13:53213823-53213845 CGTCATAGGCAGAAGGAGGAAGG - Intergenic
1110034142 13:70657402-70657424 CTTTATCAGCAGTATGAGAAAGG + Intergenic
1110342934 13:74414004-74414026 CTTTATGGGCTTCAGAAGGAAGG - Intergenic
1110929328 13:81195298-81195320 CTTTATTGGCAGCATGAGAATGG - Intergenic
1112568343 13:100570235-100570257 CTTTATTAGCAGTATGAGAATGG - Intronic
1113220242 13:108092544-108092566 CTGTATGAGCAGAAGGGGGATGG - Intergenic
1113411893 13:110097388-110097410 CTCTTTGGCCAGTAGGAGCACGG - Intergenic
1113797100 13:113064870-113064892 CTTTCAGGGCAGCAGGAGGTGGG + Intronic
1114578142 14:23731662-23731684 CTTTATGAGCAGAAGAAAGAAGG - Intergenic
1115010756 14:28541417-28541439 CTTTATTAGCAGTATGAGAATGG + Intergenic
1115756215 14:36528017-36528039 CTTTATGACCAGTTGGATGAGGG - Intergenic
1117954942 14:61115566-61115588 TTTTATGGGCAGTAGGAAAAAGG + Intergenic
1119040283 14:71268553-71268575 CTTTATAGGCAGTGTGAGAATGG + Intergenic
1119090264 14:71774259-71774281 CTGCATGAGCACTAGGAGGATGG + Intergenic
1119764054 14:77177245-77177267 CTTTATCAGCAGCATGAGGACGG - Intronic
1120132237 14:80821809-80821831 CTTTATCTGCAGTGGGAGAATGG - Intronic
1120490077 14:85166343-85166365 CGTTATGGGGAGTACGAGCAGGG + Intergenic
1121637720 14:95465165-95465187 ATTAAAGGGCAGGAGGAGGAAGG + Intronic
1125095046 15:35841123-35841145 CCTGATGGGCATTAGGAGGAAGG + Intergenic
1126508815 15:49441854-49441876 CTCAGTGGTCAGTAGGAGGAGGG + Intronic
1127214592 15:56810974-56810996 CTTTATCGGCAGTATGAAAATGG + Intronic
1128898655 15:71398886-71398908 CTTTCTGGGCCATAGGAGGGAGG + Intronic
1129078911 15:73022530-73022552 TTTTATAGGCAGTTGGAGGTGGG + Intergenic
1129166946 15:73784072-73784094 CTTTATTAGCAGCAGGAGAATGG + Intergenic
1129924145 15:79347428-79347450 CTTAATGGGCAGAAGATGGAAGG + Intronic
1131964831 15:97830772-97830794 CTTTATGGGCAGCATAAGAATGG - Intergenic
1132465712 16:76631-76653 CTTGATGGGCAGGGAGAGGATGG - Intergenic
1135750817 16:25057531-25057553 CTGTAAGGGGAGTAAGAGGACGG + Intergenic
1137041359 16:35615814-35615836 TTTTATGGGTAGTAGGAAGAAGG + Intergenic
1137879063 16:52027265-52027287 CTTTGGGGGCAGTAGGACAATGG - Intronic
1139172874 16:64651685-64651707 CTTTATTGGCAGCATGAGAATGG - Intergenic
1139406352 16:66721531-66721553 CTTTTTGGGAGGTGGGAGGAAGG - Exonic
1139670969 16:68492423-68492445 TTTTATGGGCAAGGGGAGGAGGG - Intergenic
1141201606 16:81902716-81902738 CTTTATGAGCAGTGTGAGAATGG - Intronic
1141214097 16:82008254-82008276 CTTTATTAGCAGTATGAGAATGG + Intronic
1142982985 17:3682053-3682075 CTTTAGGGGCTGTTGCAGGATGG - Intronic
1143659553 17:8316096-8316118 CTGGAAGGGCAGTAGCAGGAAGG - Exonic
1143954180 17:10655997-10656019 CCTTATGGCCGGTGGGAGGAGGG + Intronic
1144874020 17:18387612-18387634 CTTTATTCACAGTAGGAGGGGGG + Intronic
1146460328 17:33041109-33041131 CTGTGTGGGCAGGAGGAGGAGGG - Intronic
1147381331 17:40057976-40057998 CACTATGGGCAGCAGGTGGATGG + Intronic
1148577599 17:48722772-48722794 TTTTATGGGAAGAGGGAGGAAGG - Intergenic
1152567428 17:81106550-81106572 CTTCATGGCCAGGAGGAGGAAGG + Intronic
1155413664 18:25572640-25572662 CTTTATTTGCAGCATGAGGATGG - Intergenic
1157482732 18:48065959-48065981 CTTATTGGGAAGGAGGAGGAGGG - Intronic
1157619469 18:49007970-49007992 CTTTGGAGGCAGTAGGAGAATGG + Intergenic
1159618004 18:70604005-70604027 CTTTATTAGCAGTATGAGAATGG - Intergenic
1159664226 18:71138123-71138145 CTTTATGGGCTGTAAGAAGCCGG + Intergenic
1160206904 18:76842196-76842218 CTTTATGGGGGGTGGGGGGAAGG - Intronic
1160677468 19:399093-399115 TTTTATACGCAGCAGGAGGAAGG - Intergenic
1161627767 19:5337141-5337163 CTTAATGGGTAGCAGGGGGAAGG + Intronic
1162106151 19:8371044-8371066 CTTTCTGGGCAGATGGAGGCTGG + Exonic
1163096809 19:15064627-15064649 CTTTATTAGCAGAATGAGGATGG - Intergenic
1164130385 19:22356385-22356407 TTTTATGGGCAGTAGGAAAAAGG + Intergenic
1165578172 19:36839042-36839064 CTTTAAGGGCGATTGGAGGATGG - Intronic
924967328 2:90935-90957 CTTTATGGGCTGGCCGAGGACGG + Intergenic
925053476 2:835559-835581 GGTTATGGGCAGAGGGAGGAAGG + Intergenic
925684485 2:6457703-6457725 TTTTTTAGGCAGTATGAGGATGG - Intergenic
927827266 2:26317469-26317491 GTGTATGGACAGGAGGAGGAGGG - Intronic
929300248 2:40295904-40295926 CTTTGTGAGCAGGAGGAGAAGGG + Intronic
929871854 2:45765865-45765887 CTTGATTGGAAGTGGGAGGAGGG - Intronic
930310804 2:49736974-49736996 CTTTATTAGCAGTGTGAGGATGG + Intergenic
930575061 2:53136476-53136498 TTTAATGGGAAGTGGGAGGATGG + Intergenic
930613419 2:53568178-53568200 CATTATGTCAAGTAGGAGGATGG - Intronic
930909071 2:56608460-56608482 CATTATGGGCAGGAGGAAGAGGG - Intergenic
931008709 2:57882409-57882431 CTTTATGGGCACTGGGAGTAGGG - Intergenic
931874213 2:66494782-66494804 CTTTGTGGGTAGAAGAAGGAAGG + Intronic
932569319 2:72929940-72929962 TTTTAGGGGAAGTTGGAGGAGGG - Intronic
932777866 2:74539265-74539287 CTTTGTGGGCAGCATGGGGATGG + Intronic
933274383 2:80267829-80267851 GTCTAAGGGGAGTAGGAGGAAGG + Intronic
935891149 2:107679862-107679884 CTTTATAGGCAGAATGAGTAGGG + Intergenic
937111847 2:119372700-119372722 CTTTGTGGGGAGGAGGAGGATGG + Intergenic
938750127 2:134320486-134320508 CTTTATGGACTGGGGGAGGAAGG + Intronic
939684667 2:145184401-145184423 ATATATTGGCAGCAGGAGGAAGG + Intergenic
939692543 2:145283009-145283031 CTGAATGGGCAGTTGGAGGATGG + Intergenic
940133491 2:150410259-150410281 CTCTAAGGGAAGTAGGAGAATGG + Intergenic
941453577 2:165689931-165689953 TTTTATTGGCAGTAGGATGAAGG + Intergenic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
943408331 2:187515862-187515884 TTTTATGGGCACTAGGAAAAAGG - Intronic
943663371 2:190583179-190583201 CTTGATGGGCAGAAGGAGAGAGG + Intergenic
943787121 2:191889943-191889965 CTTTATGAGCAGTGTGAGAATGG - Intergenic
944516585 2:200518196-200518218 CTTTATTGGCAGCATGAGAACGG + Intronic
945123630 2:206485067-206485089 CTTTATGAGCAGCATGAGAATGG + Intronic
945245120 2:207711033-207711055 CTTTATGGAGAGTAGGACCAGGG + Intergenic
945586051 2:211664430-211664452 CTTTATGGGCAGTAGGAGGATGG + Intronic
946236962 2:218330095-218330117 ATTTAAGGGGTGTAGGAGGAAGG + Intronic
947546124 2:231011607-231011629 CTTCATGGCCAGTGGGAGGGTGG - Intronic
947618962 2:231576473-231576495 CTTTGTGGGGAGGAAGAGGATGG + Intergenic
948576106 2:238950657-238950679 CTTGATGGACCGGAGGAGGATGG - Intergenic
1169817930 20:9678253-9678275 CTTTATTAGCAGTATGAGAATGG - Intronic
1170444550 20:16412437-16412459 CTTTATTGGCAGTATGAGAATGG - Intronic
1170643161 20:18173990-18174012 ATTCATGGGCAGTAGGAATAGGG - Intronic
1170734936 20:19006396-19006418 CTTTCTTGGCAGGAGGAGGTGGG + Intergenic
1172066113 20:32221738-32221760 CTTTATGGGGGGTAGCAGTAGGG + Intronic
1172250523 20:33476025-33476047 CTTTCTGGGCTGTGGGCGGATGG - Intergenic
1173092248 20:39984357-39984379 CGTTATGGTGAGTAGGAGCATGG - Intergenic
1173826538 20:46051421-46051443 CTGTATGAGCAGTGGGAGGGTGG + Intronic
1173924435 20:46770342-46770364 CTTTATTAGCAGCATGAGGATGG - Intergenic
1173941427 20:46914395-46914417 CTTTATTGGCAGTGTGAGAATGG - Intronic
1174458788 20:50668329-50668351 CATCAGGGGCAGGAGGAGGAAGG - Intronic
1179032878 21:37735640-37735662 GTGTATGGGCTGTGGGAGGAAGG + Intronic
1180031095 21:45208517-45208539 CATTATGGGCAGGAAGAGCAAGG + Intronic
1180635163 22:17258134-17258156 CTTTCTGGGCAGGGGGAGGGAGG + Intergenic
1181940261 22:26470339-26470361 GTCTCTGGGCAGCAGGAGGAGGG + Intronic
1182799912 22:33023510-33023532 CTTTATTGGCAGCATGAGAATGG + Intronic
1183456189 22:37924609-37924631 CTTCATGGGCAGCAGGAGGTGGG - Intronic
1184425845 22:44408928-44408950 CTTACTGGGCTGTGGGAGGATGG - Intergenic
1184764078 22:46562428-46562450 CTTCATGGGGAGGTGGAGGAAGG + Intergenic
949198512 3:1342543-1342565 ATTTATGGGCCGTAGGAAGAGGG - Intronic
949419225 3:3847840-3847862 CCTAATGGGCAGTGGGAGGGTGG + Intronic
950608438 3:14106835-14106857 CTTTTTGGGAGGTGGGAGGAAGG + Intergenic
950851851 3:16069747-16069769 CTCTAGGGGCAGTGGGAGGGTGG + Intergenic
951379183 3:21962116-21962138 TATTATGGGCAATAAGAGGAAGG + Intronic
951586208 3:24217642-24217664 TTTTATTGGCAGTAGTGGGAAGG + Intronic
955038206 3:55289500-55289522 CTTTATCGGCAGCATGAGAATGG + Intergenic
955121256 3:56060823-56060845 CTTTGGGGGCAGTAGGGGCAGGG - Intronic
955935321 3:64097476-64097498 CATTAAGGGGAGGAGGAGGATGG + Exonic
956700928 3:71957841-71957863 CTTTATCAGCAGTGTGAGGATGG - Intergenic
956701367 3:71961897-71961919 CTTTTCGGCAAGTAGGAGGAGGG - Intergenic
958563959 3:95782660-95782682 CTTTATTAGCAGTATGAGAAAGG + Intergenic
958940090 3:100302171-100302193 TTTTATGGGCAGTGGCAGGGAGG + Exonic
960478167 3:118157253-118157275 CTTTATTAGCAGTATGAGAATGG - Intergenic
961155909 3:124679435-124679457 CTTGATTGGCAGCATGAGGAAGG - Intronic
962254738 3:133862627-133862649 CTCCAAGGGCAGTAGGAGCAGGG + Intronic
962434820 3:135356790-135356812 CTCCTTGGGCAGAAGGAGGAAGG - Intergenic
962436465 3:135371650-135371672 TTTAAAGGGCAATAGGAGGAGGG - Intergenic
962637501 3:137346144-137346166 CATTATGGGCAGTGGGACAAAGG - Intergenic
963839471 3:150090904-150090926 CTTTGTGGGGAGTAGGAAGGGGG + Intergenic
965485319 3:169271881-169271903 TTTTATGGGCAGTTGCACGATGG - Intronic
965539235 3:169855695-169855717 TTTTATGCTCAGTAGTAGGAAGG - Intronic
965627008 3:170691486-170691508 ATTTATGAAAAGTAGGAGGACGG - Intronic
965902354 3:173657733-173657755 CTTTATTCTCAGTAGCAGGATGG + Intronic
966509810 3:180749322-180749344 CTTTAAGAGCAGAAGGAGGGTGG + Intronic
967474941 3:189905921-189905943 ATTTATGGGCAGTAGGTATATGG - Intergenic
968584051 4:1407752-1407774 CTGCGTGGGCAGGAGGAGGAGGG - Intergenic
968811051 4:2799811-2799833 CTTGAGGGGGAGCAGGAGGAGGG + Intronic
968887152 4:3341157-3341179 CTTTAGGGGCTGTGGGCGGAGGG + Intronic
969409603 4:7019495-7019517 CTTTATGGGCATGTGGAGGAGGG + Intronic
969452208 4:7280964-7280986 CTCTTTGGGCAGTGGGAGAAAGG - Intronic
970348006 4:15172677-15172699 TTTTAAGGGCAGTAGCAGAAGGG - Intergenic
970839678 4:20452745-20452767 CTTGATGGGCAGAAGGAAAATGG - Intronic
970905425 4:21210721-21210743 CTTCATGGGCTGAAGGTGGAAGG - Intronic
971111776 4:23592939-23592961 CTTTATTAGCAGTGGGAGAATGG + Intergenic
971278561 4:25221669-25221691 CTTTATTAGCAGTGGGAGAATGG - Intronic
973860776 4:55062594-55062616 CTTTATTGGCAGTGTGAGAATGG + Intergenic
974143348 4:57917216-57917238 CTTTATGAGCAGTGTGAGAACGG + Intergenic
975663995 4:76716032-76716054 TTTTGTGGGCAAGAGGAGGAGGG - Intronic
976150234 4:82084238-82084260 CTTTATTGGCAGTATGAGAATGG - Intergenic
976656825 4:87497412-87497434 CTGCTTGGGCAGTAGGCGGATGG - Intronic
976708206 4:88041159-88041181 CTTTCAGGGCAATAGGAAGACGG - Intronic
977216508 4:94291328-94291350 TTTTAAGGGTAGGAGGAGGAAGG - Intergenic
977331321 4:95641108-95641130 ATCTATGGGCTGGAGGAGGAGGG - Intergenic
979695312 4:123606570-123606592 GATCATGGGGAGTAGGAGGAGGG + Intergenic
980073365 4:128266486-128266508 TTTTATGGGCAGTAGGAAAAAGG - Intergenic
981265044 4:142772536-142772558 CAGTGTGGGCAGTAGCAGGAAGG + Intronic
982213643 4:153061467-153061489 CTTTCTGGGAGGTGGGAGGAGGG + Intergenic
982236564 4:153256277-153256299 CTTTGGTGGTAGTAGGAGGAGGG - Intronic
984279942 4:177658292-177658314 CTTTATTAGCAGCACGAGGATGG + Intergenic
986411424 5:7484482-7484504 CTTTCTGGGCAGTTCCAGGAAGG - Intronic
987137890 5:14916879-14916901 CTTTATCAGCAGCAGGAGAATGG + Intergenic
988181872 5:27806082-27806104 CTTTATGGTGAGAAGGAGTAGGG - Intergenic
988291102 5:29288070-29288092 CTTTATCAGCAGTATGAGAACGG - Intergenic
990390871 5:55319028-55319050 CATTATGGGAAGAAAGAGGAAGG - Intronic
992590168 5:78286433-78286455 CTTACTGGGCAGAAGGTGGAAGG - Intronic
992619302 5:78576518-78576540 CTTTAAGGGCAGTGGAGGGAGGG + Intronic
992770465 5:80042597-80042619 TTTAATGGGCAGTAGGTAGAGGG + Intronic
995971840 5:117982150-117982172 TTTTATGGAGGGTAGGAGGAGGG + Intergenic
996007799 5:118443913-118443935 CTTTATGGGCCTTAAGTGGATGG + Intergenic
996345112 5:122478972-122478994 CTTTGTGGGGACTTGGAGGAGGG - Intergenic
997992940 5:138561256-138561278 CTTTAGGGGCAGTAGCAGGGAGG - Intronic
999206364 5:149851099-149851121 CTTTGCGGGCAGGAGAAGGAAGG + Exonic
999410246 5:151344129-151344151 CTTTATGGTCAGTTGCAGAAGGG - Intronic
999738910 5:154534392-154534414 GTTTGCGGGCAGTGGGAGGAAGG + Intergenic
1000413044 5:160954219-160954241 CTCTAAGGGCAGTAGGTGAAAGG + Intergenic
1001143445 5:169164208-169164230 CTTGATGGGGAGTCCGAGGATGG - Intronic
1001734113 5:173984802-173984824 CTGTATGAGCAGTATGAGAATGG - Intronic
1001837144 5:174842060-174842082 ATCTATTGGCACTAGGAGGATGG + Intergenic
1002954488 6:1848414-1848436 CTTTAAAGGCAGTAGGAGCCAGG - Intronic
1003122278 6:3328422-3328444 CTTTATGTGACGGAGGAGGAAGG + Intronic
1003788640 6:9516652-9516674 CTTCCTTGGCAGGAGGAGGAAGG + Intergenic
1003887662 6:10535758-10535780 CTTTGTGGGCGGTGGGAGGAAGG + Intronic
1004900436 6:20188677-20188699 CTGCATGTGCATTAGGAGGAGGG - Intronic
1005400170 6:25423895-25423917 ATTTATGGGCAGGAAGAGGCAGG - Intronic
1006056703 6:31390577-31390599 CTGCATGGGCACTAGGAGGATGG - Intergenic
1006069423 6:31487492-31487514 CTGCATGGGCACTAGGAGGATGG - Intergenic
1006427383 6:33974901-33974923 GTTCAGGGGCAGTAGGAGCAGGG - Intergenic
1008123832 6:47646933-47646955 TTTTATGGGCAGTAGGAAAAAGG - Intergenic
1008851735 6:56030435-56030457 CTTTATTAGCAGCATGAGGATGG + Intergenic
1009569643 6:65367920-65367942 CTTTATTAGCAGTATGAGAATGG - Intronic
1010712913 6:79196100-79196122 CTTTATTAGCAGCAGGAGAATGG - Intergenic
1011129644 6:84040342-84040364 CTTTATTGGCAGCATGAGAATGG + Intronic
1011129925 6:84042317-84042339 CTTTATTAGCAGTATGAGAATGG + Intronic
1011161856 6:84399899-84399921 CTTTAGGGGGAGTTGGAGGTGGG + Intergenic
1011565738 6:88669751-88669773 TTTTATGGGCAGCAGGAAAAAGG - Intronic
1011737874 6:90330986-90331008 CTTGGTGGGGAGGAGGAGGATGG + Intergenic
1012020292 6:93909294-93909316 CTTTCAGGGGAGTAGGGGGAGGG + Intergenic
1012133878 6:95531235-95531257 TCTTATGGGCATTAGGAGGAGGG - Intergenic
1012391135 6:98741319-98741341 CTTTATGAGCAGCATGAGAATGG + Intergenic
1012867272 6:104633349-104633371 CTTTATTAGCAGTATGAGAAGGG - Intergenic
1013147104 6:107404448-107404470 CTTTATTAGCAGTGGGAGAACGG - Intronic
1014062091 6:117083224-117083246 CTTTATTGGCAGCATGAGAATGG + Intergenic
1014882781 6:126743909-126743931 CTTTATTAGCAGTATGAGAATGG + Intergenic
1015213718 6:130725758-130725780 CTATATTCCCAGTAGGAGGAAGG + Intergenic
1015633738 6:135255709-135255731 CTTTATTGGCAGCATGAGAATGG + Intergenic
1018900258 6:168048364-168048386 CTTCAAGGTCAGAAGGAGGACGG - Intergenic
1020928800 7:14367567-14367589 CTTTATTAGCAGTATGAGAATGG + Intronic
1021085093 7:16413241-16413263 CTTCATGGGCCATAGTAGGAAGG - Intronic
1021341199 7:19464372-19464394 CTTTATTAGCAGCATGAGGACGG + Intergenic
1021849086 7:24790460-24790482 TTTTATGGGCAGTAGGAAGAAGG + Intergenic
1022417156 7:30188343-30188365 CTTTATTGGCAGCATGAGAAAGG - Intergenic
1023008675 7:35905066-35905088 CTTTATGGTAAGTAGCAGGGGGG + Exonic
1024888263 7:54169592-54169614 CTGCATGTGCATTAGGAGGATGG + Intergenic
1025823317 7:64991671-64991693 TTTTAGGGGCATTAGGAAGAAGG + Exonic
1026621664 7:71955007-71955029 CTTTATTAGCAGTATGAGAAGGG - Intronic
1028305427 7:89257757-89257779 CTTGATGGAGAGTTGGAGGAAGG - Intronic
1031564194 7:123274650-123274672 CTGAATGGGCACAAGGAGGAAGG - Intergenic
1033024035 7:137755402-137755424 GTTTAAGGGCAGAGGGAGGAGGG + Intronic
1033066916 7:138164811-138164833 CTACATGTGCATTAGGAGGATGG - Intergenic
1033095917 7:138430594-138430616 CTTTATTAGCAGTGGGAGAACGG + Intergenic
1034525114 7:151654442-151654464 CTATATGGACAGTGGGAGGAAGG - Intronic
1034709570 7:153178970-153178992 CTTTTTGAGCAGCAGGAGAATGG - Intergenic
1037743179 8:21623266-21623288 ATTTATGGGCAAGAGGGGGAGGG + Intergenic
1038657692 8:29469119-29469141 CTTTAAGGGCTGAAGCAGGAAGG + Intergenic
1040384978 8:46908871-46908893 CTTTATTAGCAGTATGAGAAAGG + Intergenic
1041746916 8:61217356-61217378 CTTTAAGGGGAGAAGGAGGAGGG + Intronic
1041758695 8:61340689-61340711 CTATATGCCCAGTAGTAGGATGG + Intronic
1045820722 8:106334868-106334890 ATTTATTAGCAGTAGTAGGATGG - Intronic
1048058851 8:130896482-130896504 CTTTAGGGGCAGAAAGAAGAAGG + Intronic
1048776255 8:137949876-137949898 CTATATTGGCATTAGGAGGTGGG - Intergenic
1050022000 9:1293971-1293993 GTTGATGGCCAGTAGGAGTAGGG + Intergenic
1050216930 9:3337075-3337097 CCTTATGGGTAGGAGGAGGTAGG + Intronic
1050595352 9:7199456-7199478 CTGGATGGGCAGGAAGAGGAGGG + Intergenic
1051414585 9:16825608-16825630 CTTCCTGGGGAGGAGGAGGAGGG + Intronic
1056983658 9:91341193-91341215 CATTGTGGGCAGTGGGAGGCTGG - Intronic
1058218185 9:102261054-102261076 ATTTATGGAAAGTAGAAGGAAGG - Intergenic
1058464899 9:105217409-105217431 CTTTATTAGCAGTATGAGAATGG - Intergenic
1058583839 9:106485919-106485941 CTTTATTAGCAGTGTGAGGATGG + Intergenic
1058656528 9:107226980-107227002 ACTTATGTGCAGAAGGAGGATGG + Intergenic
1059140413 9:111847652-111847674 CTAAAGGGGCAGTTGGAGGACGG + Intergenic
1059399288 9:114058912-114058934 CTTTCTGGGCAGAAGCAGGTGGG - Intergenic
1059628455 9:116092720-116092742 CTTTATTAGCAGTATGAGAATGG + Intergenic
1059868601 9:118545647-118545669 CTTTATTGGCAGTATGAAAATGG - Intergenic
1061260753 9:129479716-129479738 CCTTGTGGGCAGTGGAAGGAAGG + Intergenic
1186505886 X:10091787-10091809 AGTCAGGGGCAGTAGGAGGATGG - Intronic
1188749413 X:33886273-33886295 CTTTATTAGCAGTATGAGAATGG + Intergenic
1190314391 X:49140697-49140719 TTTTATGGGCAGTAGGAAAAAGG + Intergenic
1194106841 X:89780137-89780159 CTTTATTAGCAGTATGAGAATGG - Intergenic
1195935590 X:110123083-110123105 CTTTATGTGTAGTGTGAGGAAGG + Intronic
1195936993 X:110134939-110134961 CTCTCTGGGGAGTAGGAGGTGGG - Intronic
1196732523 X:118955289-118955311 CTTTGTGGGCTGTTGGACGAAGG - Intergenic
1196869638 X:120100486-120100508 TTTTATGGGCAGTAGGAAAAAGG - Intergenic
1197625877 X:128801955-128801977 CTTTCTGGGGAGAATGAGGATGG - Intergenic
1197804200 X:130383716-130383738 CAGTAAGGGCAGGAGGAGGAGGG + Intergenic
1197995349 X:132366877-132366899 CTTTATTAGCAGCATGAGGATGG - Intergenic
1198039298 X:132834071-132834093 CTTTTTAGGGAGTGGGAGGATGG - Intronic
1199203961 X:145125378-145125400 CTTTATTAGCAGTATGAGAATGG - Intergenic
1199544159 X:148989768-148989790 CATTGTGGGCAGTATGAGGCAGG - Intronic
1200458803 Y:3428002-3428024 CTTTATTAGCAGTATGAGAATGG - Intergenic
1200912567 Y:8544036-8544058 TTTCATGGGCAGTAGGAAAAGGG - Intergenic
1200983290 Y:9281617-9281639 TTTCATGGGCAGTAGGAAAAAGG + Intergenic