ID: 945586410

View in Genome Browser
Species Human (GRCh38)
Location 2:211669465-211669487
Sequence CTGGGAAATCAGACAGTTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 206}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945586410_945586416 22 Left 945586410 2:211669465-211669487 CCTGAAACTGTCTGATTTCCCAG 0: 1
1: 0
2: 0
3: 11
4: 206
Right 945586416 2:211669510-211669532 CCTCCTATACCTTTCTGGATAGG 0: 1
1: 0
2: 0
3: 9
4: 119
945586410_945586414 17 Left 945586410 2:211669465-211669487 CCTGAAACTGTCTGATTTCCCAG 0: 1
1: 0
2: 0
3: 11
4: 206
Right 945586414 2:211669505-211669527 TATTTCCTCCTATACCTTTCTGG 0: 1
1: 0
2: 1
3: 22
4: 222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945586410 Original CRISPR CTGGGAAATCAGACAGTTTC AGG (reversed) Intronic
901769643 1:11523842-11523864 CTGGGATCTGAGACAGTCTCAGG - Intronic
902314155 1:15604932-15604954 CTGTGAGATCAAACAGTTTCTGG + Intergenic
903221679 1:21872918-21872940 CGGGGAAATCAGGCAGCATCTGG - Intronic
904111212 1:28128031-28128053 CTGGGAAATCAGACAGCCCTAGG + Intergenic
905302097 1:36992361-36992383 TTGGGAAATCAGACAGCCTGAGG + Intronic
906331673 1:44890238-44890260 CTAGGAAAACATGCAGTTTCTGG - Intronic
906568633 1:46818046-46818068 CTGGGAGATCAGACAGGGTGGGG + Intronic
908178728 1:61582670-61582692 TAGGGAACTCAGCCAGTTTCTGG - Intergenic
908733423 1:67250860-67250882 CTAGGAAAACATGCAGTTTCTGG + Intronic
910176602 1:84437518-84437540 CTAGCAAATCAGGCAGTTTTCGG + Intergenic
914977460 1:152379426-152379448 CTGGAAAAGGAGACACTTTCAGG - Intergenic
917302059 1:173586288-173586310 CTGGGAAAACATAGAGTTTTAGG - Intronic
920540728 1:206776042-206776064 CTGGGAAATCAGAAGGTTGTGGG + Intergenic
924695584 1:246396431-246396453 CTGGACCATCAGACAGCTTCTGG + Intronic
1064200965 10:13284506-13284528 CTGGGAACACTCACAGTTTCAGG - Intronic
1064418470 10:15169581-15169603 CTGGGGGATTGGACAGTTTCAGG + Intergenic
1066319192 10:34283284-34283306 CTGGGATTTCAGTGAGTTTCTGG - Intronic
1070080722 10:73184019-73184041 CTGGGAAATAAGACGGTCACAGG + Intronic
1070152694 10:73814827-73814849 CTTGGAAATCAGACAGACTAGGG - Intronic
1071261208 10:83920685-83920707 CTGGGAAATGAGACAGACTGTGG - Intergenic
1073140961 10:101247376-101247398 GGGAGAAAGCAGACAGTTTCAGG + Intergenic
1074201685 10:111243191-111243213 CTTTGAAATCAGACAGGTTGAGG - Intergenic
1075676520 10:124299727-124299749 CTGGGAGAAGAGTCAGTTTCTGG - Intergenic
1079137162 11:17782043-17782065 CAGGGTAATCATACAGTTGCAGG - Exonic
1079180885 11:18192541-18192563 ACTGGAAATCAGACAGTTTTTGG - Intronic
1080321661 11:31016983-31017005 CTGGACAATCAAACAATTTCTGG - Intronic
1080392558 11:31861658-31861680 CAGGGAAAACAGACCGATTCCGG - Intronic
1080772119 11:35351335-35351357 CTGGGAAAGCAGAGATGTTCTGG - Intronic
1081261096 11:40961986-40962008 CTTGGAGATCAGTCAGTTTCTGG - Intronic
1082248503 11:49953772-49953794 TTGGGAAATCAGTGAGATTCTGG - Intergenic
1082620337 11:55412843-55412865 CTAGGAATTCAGGCAGTTGCTGG + Intergenic
1083016110 11:59455932-59455954 CTGAGAAATCAGAGAGTCTGGGG - Intergenic
1083188680 11:61034108-61034130 GTGGCAAGGCAGACAGTTTCAGG - Intergenic
1084624569 11:70296409-70296431 CTGGGATTGCAGACAGTGTCTGG - Intronic
1086901328 11:92371374-92371396 TTGGGACTTCAGACATTTTCAGG + Intronic
1087072132 11:94091477-94091499 CTTGGAAATCATACAGTCTAGGG + Intronic
1088929007 11:114330238-114330260 GTGGGAAATCAGAAAGTCACTGG - Intergenic
1089122429 11:116146730-116146752 CTGGAAAAGGAGACACTTTCAGG + Intergenic
1090628638 11:128627296-128627318 CCAAGAAATCAGACAGTTTACGG + Intergenic
1091262273 11:134244122-134244144 ATGGGACATCAGAGAGTGTCAGG - Intronic
1092827339 12:12413494-12413516 CTGAGAAATCAGATGGTTGCCGG - Intronic
1092932454 12:13329266-13329288 CTGGGAGATCAGACAATGACAGG + Intergenic
1093920915 12:24858101-24858123 CCGGGAAAACATGCAGTTTCTGG - Intronic
1095485918 12:42684446-42684468 TTGGGAAATCTGACAGTCTAAGG + Intergenic
1095493415 12:42759775-42759797 TGGAGAAATCAGATAGTTTCTGG + Intergenic
1095627282 12:44331016-44331038 CTGGGAAATCAAATAATTTGGGG - Intronic
1095743666 12:45633879-45633901 CTGGGAAATCTCTCAGTCTCAGG + Intergenic
1096328314 12:50686190-50686212 CTGTGGAATCAGACAGATTTGGG - Intronic
1105275569 13:18921170-18921192 ATGGGAAAACAAACAGTTCCAGG + Intergenic
1105429513 13:20324457-20324479 CTGGAAGATGAGACACTTTCAGG + Intergenic
1105755736 13:23462176-23462198 TTGGAAAATTAGCCAGTTTCAGG + Intergenic
1106321189 13:28641015-28641037 CAAGGAAATCAGACTGCTTCTGG + Intergenic
1106667728 13:31870264-31870286 CTGGGAAATCAGAATGGTCCAGG - Intergenic
1106775843 13:33008753-33008775 CTGGGAAATCTGACTGTTCCTGG - Intergenic
1107073045 13:36292808-36292830 CAGGGAAAACAGACAGTGTAGGG + Intronic
1108873912 13:55021254-55021276 ATCGGAAATCAGACTGTCTCAGG + Intergenic
1109284980 13:60398116-60398138 ATGCGAAATTAGGCAGTTTCTGG + Intronic
1109308204 13:60663252-60663274 CTGGGACATGAGACAGAGTCTGG - Intergenic
1110282865 13:73715467-73715489 CTGGGGATTCAGACCGTCTCTGG + Exonic
1110769027 13:79315527-79315549 CATGGAAATCAGACAGTGCCTGG + Intronic
1113986856 13:114324523-114324545 CCGGGAAATGAGACTGCTTCTGG - Exonic
1114595797 14:23910677-23910699 CAGAGAAATCACACAGTTGCTGG + Intergenic
1116181735 14:41543594-41543616 CTGGCAAAACAGAAAGTTTTGGG + Intergenic
1116789778 14:49327986-49328008 CTGGAAGATCAGACACTTGCTGG - Intergenic
1116913823 14:50501138-50501160 CAGTGCAATCAGAAAGTTTCTGG + Intronic
1117274667 14:54180534-54180556 CTGAGGAATCAGAAAGTGTCAGG + Intergenic
1117967401 14:61220089-61220111 CTGGGAAGGCAGACAGTCCCAGG + Intronic
1122186990 14:100006868-100006890 TTGGGAAATCAGAGATTCTCTGG + Intronic
1124709307 15:31992343-31992365 CTGGGAAATATCTCAGTTTCAGG + Intergenic
1125231166 15:37457931-37457953 CTGGGAAATGAGACAGTATTTGG + Intergenic
1126545589 15:49870760-49870782 ATGGTAAAACAGACATTTTCAGG + Intronic
1128268927 15:66292176-66292198 CTTGGAATTCAGTCAGATTCTGG + Intergenic
1128993525 15:72280014-72280036 CTTGGAATTCAGACAGTGTTGGG + Intronic
1129319079 15:74763826-74763848 CTGGGTAATCAGGCAGGTTTGGG + Intergenic
1129514019 15:76145576-76145598 CTGGGAAATGATACAGTTCAAGG - Intronic
1130833930 15:87630957-87630979 CTGGGAGATCAGAGTGTTTAAGG - Intergenic
1134761810 16:16721116-16721138 ATGGGAAATTTGATAGTTTCAGG + Intergenic
1134984248 16:18638054-18638076 ATGGGAAATTTGATAGTTTCAGG - Intergenic
1135053392 16:19210931-19210953 CTGGGACAAAAGACATTTTCTGG - Intronic
1135185546 16:20312570-20312592 CTGGGAAACCACACTGTTCCAGG + Intronic
1135472615 16:22744986-22745008 CTGGGATATCAGGCAGTTCATGG - Intergenic
1135604697 16:23813305-23813327 CTTGAAAATCAGACAGCATCCGG - Intergenic
1137623541 16:49892927-49892949 CTGGAAAGGGAGACAGTTTCAGG + Intergenic
1137809355 16:51338116-51338138 CTGGGAAATAAGAGATTTCCGGG + Intergenic
1138271946 16:55701913-55701935 GAGGGACATCAGACAGTTCCAGG + Exonic
1142477681 17:199238-199260 CTGGGAACTCAGCCAGTTGCTGG + Intergenic
1143320880 17:6068318-6068340 CTGGGAAGCCAGACATTTCCCGG - Intronic
1144080738 17:11761678-11761700 CTGGGAGATCAGCAAGTCTCGGG + Intronic
1147859893 17:43513002-43513024 CTGGGAAAGCAGAGATTTCCTGG - Intronic
1148744211 17:49909490-49909512 CTGGCAGCTCAGACAGTTCCTGG + Intergenic
1149472207 17:56926077-56926099 TTGGGAAATCAGAGATTCTCTGG - Intergenic
1150198083 17:63322035-63322057 CTGGGAAAACATGCTGTTTCTGG - Intronic
1152139021 17:78525434-78525456 CTGGGAAATCAGAAACTCTCAGG - Intronic
1152354270 17:79799166-79799188 CGGGGAAACCAGACACTTACAGG - Intronic
1152895265 17:82907287-82907309 CTTGGAAAACAGACAGGTCCAGG - Intronic
1154053205 18:10983282-10983304 CTGGAAACTCAGCCAGATTCTGG - Intronic
1159121860 18:64180169-64180191 CTGAGAACTCAGAAAATTTCTGG - Intergenic
1159963097 18:74570953-74570975 CTGAGGAATGAGTCAGTTTCAGG + Intronic
1160820446 19:1055298-1055320 CCAGGAAGTCAGACAGGTTCCGG - Exonic
1163068411 19:14816952-14816974 CAGAGAAATCAGACACTTACGGG + Intronic
1163724277 19:18913645-18913667 CTGGGAAGTCAGCCAGCCTCCGG - Intronic
1165253898 19:34561056-34561078 ATAGGAAAGCAAACAGTTTCAGG + Intergenic
1165293780 19:34909634-34909656 ATGGGAAATGAGACAGCTGCAGG - Intergenic
1166601602 19:44100625-44100647 CAGGGAAATCAGTCATTGTCAGG + Intronic
1167119803 19:47510012-47510034 CTGGGGAATCCGAGAGTTCCTGG - Intronic
1167476772 19:49705987-49706009 CGGGGAAAGCAGGCTGTTTCGGG - Exonic
925147898 2:1593361-1593383 CTGGGGAGTCAGACACTTTGAGG - Intergenic
925834328 2:7929327-7929349 CTGGAACGTCAGACAGATTCTGG - Intergenic
928084937 2:28340067-28340089 CTGGGAATTCCCAAAGTTTCAGG - Intergenic
931091114 2:58887464-58887486 CTGGGAAATCCTTCAGTTCCAGG - Intergenic
933685759 2:85140107-85140129 CTGTGACATCAGCCACTTTCTGG - Intronic
936676616 2:114723060-114723082 GTGGGAAGTCAGACAAGTTCTGG + Intronic
938080865 2:128369393-128369415 CTGGGAAATCAGACAAGTCCAGG + Intergenic
938947606 2:136227282-136227304 CTTCGAAATCAGACAGACTCGGG + Intergenic
938960905 2:136340756-136340778 CTGGGAAACCAAAAAATTTCTGG + Intergenic
940148566 2:150574230-150574252 CTTGGAAATCAGAAATTTTGGGG + Intergenic
940332140 2:152486479-152486501 CTTGGAGAAAAGACAGTTTCTGG + Intronic
942055756 2:172180688-172180710 AAGAGAAATGAGACAGTTTCTGG - Intergenic
942993136 2:182227089-182227111 CTTTGAAATCAGACAGATTTGGG - Intronic
943703286 2:191009901-191009923 CATGGAAATCAGACAGTACCTGG - Exonic
945586410 2:211669465-211669487 CTGGGAAATCAGACAGTTTCAGG - Intronic
946066345 2:216990753-216990775 CAGGGAAGTCAGGCAGTTTAGGG - Intergenic
1170139744 20:13113453-13113475 CAGCCAAATCAGAAAGTTTCAGG + Intronic
1170487352 20:16832360-16832382 ATGGGAAAACAGACAGGTACAGG + Intergenic
1171565321 20:26179161-26179183 CGGGGAAATCTTACAGTATCAGG + Intergenic
1172462690 20:35132105-35132127 CTGAGAAATCAGACAGATTGCGG - Intronic
1172719790 20:36990944-36990966 CTGGTAAATTACCCAGTTTCAGG + Intergenic
1173442363 20:43089503-43089525 CTGGGATATCAGTGAGTTTTGGG - Intronic
1173577437 20:44122145-44122167 CTTGGACATCAGACAGCTCCAGG - Intronic
1173644481 20:44625198-44625220 CTTGGAAATCAGACCTATTCAGG + Intronic
1174927985 20:54782489-54782511 CTGGGAATAAAGACAGTTTGAGG + Intergenic
1176886611 21:14264128-14264150 GTGGGAAATATGACAGTTTGTGG - Intergenic
1176992029 21:15508473-15508495 CTGGGAAATACGAAAATTTCAGG + Intergenic
1177075960 21:16573759-16573781 CTGGGAATTCACACAGTTTGGGG - Intergenic
1181264760 22:21624462-21624484 CTGGGGACTCAGAGTGTTTCTGG - Intergenic
1181435339 22:22907140-22907162 CTGGGACAGGAGGCAGTTTCAGG + Intergenic
1181805796 22:25373790-25373812 TCGGGAAATCACACACTTTCAGG - Intronic
1183468859 22:37994981-37995003 TTGAGAAATCAGAGAGTTTAGGG + Intronic
1183620503 22:38969247-38969269 CTGGGATGTCTGACAGTCTCCGG + Intronic
1185130581 22:49036359-49036381 CGGGGAAATCAGAGAGACTCCGG - Intergenic
949824110 3:8146472-8146494 CTGGCAATTCAGAGAGTTTTAGG + Intergenic
951069757 3:18313400-18313422 CTGTGAAGGCAGATAGTTTCTGG - Intronic
955488264 3:59456867-59456889 GTGGGAAATCAGACAAGTTTAGG - Intergenic
955612384 3:60771455-60771477 ATGGGAAATGGGACAATTTCTGG - Intronic
955710336 3:61772178-61772200 CTGGGAAATTATACAGTTGAGGG + Intronic
955730729 3:61982826-61982848 CTGGGAAATTAGACAGATAATGG + Intronic
955921354 3:63960012-63960034 GTGTGAAATCAGATTGTTTCAGG + Intronic
958726985 3:97917876-97917898 CAGGGAAATGAGACAGAATCTGG - Intronic
961935333 3:130576850-130576872 CAAGGAAATCAGACAGTAGCTGG + Intronic
962574631 3:136745456-136745478 GTGGGGAATCAGAAGGTTTCAGG + Intronic
962709040 3:138070192-138070214 CTGGGAAATCAGCCAGGACCAGG - Intronic
965320850 3:167249899-167249921 CTGGAAAAGAAGACACTTTCAGG + Intronic
965586507 3:170323438-170323460 CTGGGAAATCAGACAGATCACGG + Intergenic
967752267 3:193128262-193128284 GGGGGCAATCAGACAGGTTCAGG + Intergenic
969532771 4:7739053-7739075 CCGGGAAGTCAGACGGTGTCTGG - Intronic
973220735 4:47723258-47723280 CCTGGAAGTCAGAGAGTTTCAGG + Intronic
975453424 4:74557899-74557921 CTAGGTAATCTGACAGCTTCTGG + Intergenic
978358028 4:107898441-107898463 CTGAAAAAACAGGCAGTTTCAGG - Intronic
979608206 4:122661811-122661833 CTTGGAAGTCAAACAGTTACAGG + Intergenic
982689593 4:158532770-158532792 TTGGGAACTCAGGCAGATTCGGG + Intronic
982709827 4:158747204-158747226 CTGGGATTGCAGACAGTGTCTGG - Intergenic
988636560 5:32990639-32990661 CTGGGAACCCAGACAGCATCAGG - Intergenic
988925531 5:35987524-35987546 CTGAGAAATCAGACACTATAAGG + Intronic
989112348 5:37918645-37918667 CTGGGAAGTCTTCCAGTTTCTGG - Intergenic
992022194 5:72635588-72635610 CTGTGAGATCAAACATTTTCTGG + Intergenic
995351919 5:111187405-111187427 CTGGGAAAACAGGCAGTAACAGG - Intergenic
997192328 5:131948686-131948708 TTGGGAAAACAGCCAGTTTGTGG + Intronic
998254163 5:140572050-140572072 CTTGGAAATCAGACAGATCAGGG + Intronic
1000457893 5:161474679-161474701 TTGGGAAATCATTCATTTTCAGG + Intronic
1001737862 5:174021627-174021649 CTGGTATATCAGAGACTTTCAGG + Intergenic
1005508516 6:26491526-26491548 ATGGGAAAACAAACAGTTCCAGG + Intergenic
1008426218 6:51360258-51360280 CTGGGAAATTTGTCAGTCTCAGG - Intergenic
1012965566 6:105669415-105669437 CTGAGAAAGCAAACAGTCTCAGG - Intergenic
1013525699 6:110971860-110971882 CTGGGTAATCTCACAGTATCAGG - Intergenic
1014481711 6:121947159-121947181 CTGGTAAATGAAAAAGTTTCAGG - Intergenic
1017328695 6:153170769-153170791 GTAGGAAATCAGGCTGTTTCTGG + Intergenic
1020478838 7:8632483-8632505 GTGGGAAATCAGTCACTTTAAGG + Intronic
1023196203 7:37642103-37642125 CTGGGAACTCAGTCTGTCTCAGG + Intergenic
1024473943 7:49791126-49791148 CTCTGAAATCACACAGTTACAGG + Intronic
1025096887 7:56102945-56102967 CTATGAGATCAAACAGTTTCTGG - Exonic
1027137918 7:75638227-75638249 CTGGGAAAACCTGCAGTTTCCGG + Intronic
1027893914 7:84015835-84015857 CAGGGAAATTATACAGATTCTGG + Intronic
1028383986 7:90232543-90232565 CTGGGAAAAGAGCCAATTTCTGG + Exonic
1029632439 7:101761404-101761426 CTGGGCCACTAGACAGTTTCAGG - Intergenic
1031564249 7:123275471-123275493 ATGGGAATTCAGAAAGTTGCTGG - Intergenic
1031968101 7:128042631-128042653 TTAGGAAATCAAACAGGTTCAGG - Intronic
1032004043 7:128285866-128285888 CAGGGAAATGAAACACTTTCTGG - Intergenic
1032101811 7:128985972-128985994 CTGGTAAATCAGAGAGATTGAGG - Intronic
1036520089 8:9483707-9483729 CTGGGAAAGAAGTCAGGTTCAGG - Intergenic
1037182897 8:16028431-16028453 CTGAGAAATAGGACAGGTTCTGG - Intergenic
1039659934 8:39450381-39450403 CTGGAAGAGGAGACAGTTTCAGG + Intergenic
1039930449 8:41982664-41982686 CTGGGTTATCAGACTGTTGCTGG + Intronic
1041935199 8:63325372-63325394 CTGGAAAAAGAGACACTTTCAGG + Intergenic
1043243407 8:77965935-77965957 CTGAGAAATAAGTCATTTTCAGG - Intergenic
1044165129 8:88972591-88972613 CTGGAAGATCAAACAATTTCTGG - Intergenic
1044785106 8:95785069-95785091 CTGGGAAATCACCCAGTTTTAGG - Intergenic
1045186261 8:99841630-99841652 CTGGGAAACCACACAGTCCCAGG - Intronic
1047412409 8:124634653-124634675 CAAGGAAATCAGAAGGTTTCTGG - Intronic
1051672907 9:19530102-19530124 CTAGGAAATCAGCCGGATTCTGG + Intronic
1057895861 9:98908224-98908246 TTGGGAAATCAGAAAGCTCCTGG - Intergenic
1058080807 9:100699341-100699363 CTAGGAATTCTGTCAGTTTCTGG + Intergenic
1058170650 9:101677216-101677238 TTAGGAAATCAGAGAGTTTAGGG - Intronic
1058339046 9:103871864-103871886 CTGGGAAAACATGCAGTCTCAGG + Intergenic
1058747225 9:108003455-108003477 GTGGGGAATCAGACAGCTTGGGG - Intergenic
1059379367 9:113911132-113911154 CTTAGAAAGCAGAAAGTTTCAGG - Intronic
1061086253 9:128400557-128400579 CTGGTAAATATGACACTTTCAGG - Intergenic
1187155072 X:16714247-16714269 CCAGGAAATGAGACAGTTTGGGG + Intergenic
1187187966 X:17005562-17005584 CTGGGAAAACATACTGTATCGGG + Intronic
1189052799 X:37664119-37664141 CTGGGAAATGAGGCACTTGCTGG + Intronic
1191884111 X:65872174-65872196 AGGGGAAATCAGACAGTCACAGG + Intergenic
1192795938 X:74423730-74423752 CTGGGAAAGCAGGCAGTGTAGGG + Intronic
1194438593 X:93900801-93900823 CTAGGACTTCACACAGTTTCTGG + Intergenic
1194721478 X:97345411-97345433 TGGGGAAATCAGACCATTTCTGG - Intronic
1195029422 X:100911886-100911908 CTGGGAATGCAGAGAGTTTAGGG - Intergenic
1195598997 X:106725107-106725129 CAGCAAAATCAGACAATTTCTGG + Intronic
1196767444 X:119260385-119260407 GGGGAAATTCAGACAGTTTCAGG + Intergenic
1199142857 X:144333007-144333029 CTGGAAAAGGAGACACTTTCAGG - Intergenic
1201305550 Y:12546943-12546965 CTTGGAAAACAGACAGCATCTGG - Intergenic