ID: 945586637

View in Genome Browser
Species Human (GRCh38)
Location 2:211673186-211673208
Sequence CAGTGTGAGAAGATGGAAGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 570
Summary {0: 1, 1: 0, 2: 2, 3: 49, 4: 518}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945586637_945586643 0 Left 945586637 2:211673186-211673208 CCATCTTCCATCTTCTCACACTG 0: 1
1: 0
2: 2
3: 49
4: 518
Right 945586643 2:211673209-211673231 GGGGTCACACTCCACACAGATGG 0: 1
1: 0
2: 0
3: 5
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945586637 Original CRISPR CAGTGTGAGAAGATGGAAGA TGG (reversed) Exonic
900354476 1:2253676-2253698 CGGTGCGAGCAGATGGAGGATGG + Intronic
900821490 1:4892825-4892847 CAGGGTGAGAAGAGTGCAGAAGG - Intergenic
901001198 1:6149568-6149590 AAGGGTGAGGAGATAGAAGATGG + Intronic
902155230 1:14479688-14479710 CAGTGTGAGATGGTGGGGGAGGG - Intergenic
902986529 1:20157763-20157785 CAGAGTGAAAAGATGGAAGTTGG + Intergenic
904096024 1:27978069-27978091 CTGTCTTTGAAGATGGAAGATGG + Intronic
904199566 1:28811263-28811285 CAGTGCGAGCAGATAGAAGGGGG - Intergenic
904252236 1:29233339-29233361 CCTTGAGAGAAGAAGGAAGAAGG - Intergenic
904601087 1:31672945-31672967 GAGTGTGGGAGGAGGGAAGACGG - Intronic
906096600 1:43228402-43228424 CAATTAGAGAAGATGGAGGAGGG - Intronic
906283662 1:44571198-44571220 TAGAGAGAGCAGATGGAAGAGGG - Intronic
907006117 1:50915664-50915686 CACTGTGTGAAGATGGAATTTGG - Intronic
907162879 1:52384275-52384297 CAGTGTGGCAACATGGAAAAGGG - Intronic
907393440 1:54173813-54173835 CAGTGGGACAAGCTGGGAGAGGG + Intronic
907494637 1:54835786-54835808 CAGCCTGAGAAGAGGGATGAAGG + Intronic
907909365 1:58813640-58813662 GAGTGTAGAAAGATGGAAGAAGG + Intergenic
908615400 1:65915476-65915498 CATAGTGAGAAAATGGAATAAGG - Intronic
909461222 1:75916684-75916706 CAGAGGGTGGAGATGGAAGAGGG + Intergenic
909647568 1:77934621-77934643 CAGAGTCCGAAGAGGGAAGAAGG - Intronic
910894435 1:92053276-92053298 CCCTGTGGGAAGATGGAGGAGGG + Intronic
911792304 1:102032926-102032948 CTGTGTGAGGAGATGGATGCAGG + Intergenic
911857719 1:102902075-102902097 CAGTGTGAGTTGATGAGAGAGGG + Intronic
912851730 1:113131836-113131858 GTGTGTGTGAAGATGGAATAGGG + Exonic
913571498 1:120124827-120124849 AAGTAAGAGAAGATGGCAGAAGG + Intergenic
914292419 1:146286448-146286470 AAGTAAGAGAAGATGGCAGAAGG + Intergenic
914553463 1:148737231-148737253 AAGTAAGAGAAGATGGCAGAAGG + Intergenic
915535155 1:156530925-156530947 CAGTGTGTGAAGTGGGGAGAGGG + Intronic
915816942 1:158977499-158977521 GAATGTGAGAAGAGGGAATATGG - Intergenic
916028399 1:160855375-160855397 CAGTGTGGGAAGGAGGAAGATGG + Intronic
916188769 1:162158885-162158907 AAGTGAGAGAAGAGGGAATATGG + Intronic
916902199 1:169239380-169239402 CAGAGTATGAAGATGAAAGAAGG + Intronic
917032987 1:170715611-170715633 TTGTGGGAGAAGATAGAAGATGG + Intronic
917440831 1:175067371-175067393 AAGTGTGAGACGATGGATGAAGG + Intergenic
917846314 1:179023369-179023391 CAGTTTGGGAACAAGGAAGAAGG + Intergenic
918106190 1:181417217-181417239 CAGTTTGATAAGATGGGAAATGG - Intronic
918122124 1:181549355-181549377 CAGAGTGAGAATGAGGAAGAAGG + Intronic
921340584 1:214129851-214129873 CAGTGGGTTAAGATGTAAGAAGG + Intergenic
921666675 1:217881025-217881047 CAGAGGCAGAAGATGGAACAGGG + Intergenic
922240919 1:223755194-223755216 CAGTGGGAGATGGTGGGAGATGG - Intronic
922419665 1:225451061-225451083 CTGAGTGAGCAGAAGGAAGAGGG - Intergenic
923456939 1:234172941-234172963 CATTGGGGGAAGCTGGAAGAGGG - Intronic
924057106 1:240134679-240134701 AAGAGGGAGAAGATGGGAGAAGG + Intronic
924072647 1:240297878-240297900 CAGTCTGTGAACCTGGAAGAGGG - Intronic
924166624 1:241289844-241289866 CTGAGTGAGAAGAGGAAAGATGG + Intronic
924859011 1:247901974-247901996 TAGTGTTGGAAGATGGAAGCTGG + Intergenic
1062789662 10:294201-294223 CCTTGGAAGAAGATGGAAGAGGG - Intronic
1063269749 10:4494654-4494676 TTGTGTGAGAAGCTGGATGAGGG - Intergenic
1063312145 10:4963460-4963482 CAGTGTGTGAAGCTGAATGATGG + Exonic
1063315741 10:5003798-5003820 CAGTGTGTGAAGCTGAATGATGG - Exonic
1063432862 10:6006195-6006217 CAGTGAGAGGAGATGAAGGAGGG + Intergenic
1064045910 10:12015269-12015291 AACTTTTAGAAGATGGAAGATGG - Intronic
1064469605 10:15622276-15622298 GAGAGTGAGAAGTGGGAAGAAGG - Intronic
1065169005 10:23009554-23009576 CAGTGAGCCAAGATGGGAGATGG - Intronic
1065178423 10:23100826-23100848 CACTGTGACAAGATGGAAAAAGG + Intronic
1065198759 10:23293475-23293497 CAGTGTGGGCAGATGGCAGAAGG - Intronic
1065211371 10:23406653-23406675 CAGCTTGAGAAGGAGGAAGAGGG + Intergenic
1065223000 10:23515011-23515033 GAGAGAGAGAGGATGGAAGAAGG - Intergenic
1065417239 10:25501896-25501918 CAGTGTGAGGAGATGAGAAAGGG - Intronic
1065768078 10:29050629-29050651 AAGTGTGGGAGGATGGGAGAGGG - Intergenic
1067081209 10:43213436-43213458 CAGGGTGAGAAGAGGGGAGGGGG + Intronic
1067856601 10:49799057-49799079 CAGTGACAGAAGAGGGAGGAGGG - Intergenic
1068199102 10:53760094-53760116 CAGTGTTATAATATGGCAGAAGG + Intergenic
1068307495 10:55232097-55232119 CAGTGTTACAATATGGAATAGGG - Intronic
1068711661 10:60141518-60141540 CAGTGTACCCAGATGGAAGATGG - Intronic
1069577158 10:69538930-69538952 GAGTGTGAGGACATGAAAGAAGG + Intergenic
1069937122 10:71925238-71925260 CACTGGCAGAAGATGGAAGCAGG - Intergenic
1070032038 10:72686461-72686483 AATTATGAGAAGATGCAAGAGGG + Intergenic
1070350501 10:75587724-75587746 TACTGTGAGAAGCTGGAAGATGG + Intronic
1070712299 10:78691568-78691590 TAGAGTGGGTAGATGGAAGATGG + Intergenic
1070949634 10:80420440-80420462 GAGATTGAGAAGAAGGAAGAAGG - Intronic
1071264497 10:83952873-83952895 AAGAGTGAGAAGAGGGAAGAGGG + Intergenic
1072048102 10:91677278-91677300 CACTGCGAGGAAATGGAAGATGG + Intergenic
1072749309 10:97965866-97965888 CAGTGAGAGAAGCTGAAAGCAGG + Intronic
1073025361 10:100483397-100483419 CAGAGGTTGAAGATGGAAGAGGG + Exonic
1073258820 10:102173335-102173357 CAGTGTGGTATGTTGGAAGATGG - Intergenic
1073771300 10:106738543-106738565 CAGTGTGAGAGGAAGGAGGCTGG + Intronic
1073824786 10:107308139-107308161 CAAGGTGAGAACATGGAGGATGG + Intergenic
1074763898 10:116686718-116686740 CAGTGTGGGAAGAGGGGACAAGG - Intronic
1074763943 10:116686880-116686902 CAGTGTGGGAAGAGGGATGAGGG - Intronic
1076289067 10:129330126-129330148 GAGAGTGAGAACATGGAGGAGGG + Intergenic
1076773270 10:132678875-132678897 CCATGTGAGAAGCTGGAAAAGGG + Intronic
1078252262 11:9625947-9625969 CACTGTAACAAGAGGGAAGAAGG - Intergenic
1079375263 11:19886729-19886751 CAGTCCCAGATGATGGAAGAAGG + Intronic
1079760318 11:24320974-24320996 AAGTTTGATAAGATGGAACAAGG + Intergenic
1080180960 11:29425727-29425749 TAGTGTGAGAAAAAGTAAGAAGG - Intergenic
1080564227 11:33493306-33493328 CTATGGCAGAAGATGGAAGAAGG - Intergenic
1081023968 11:37985034-37985056 CTGTGTCAGAAGATGCAACATGG - Intergenic
1081232678 11:40605546-40605568 CACTGTGATAAGGTGGGAGAAGG - Intronic
1081509039 11:43749508-43749530 CAGTGTGAGAGGAAGCAGGAGGG + Intronic
1082609745 11:55282454-55282476 CAGGGAGAGAAGAAGGCAGAGGG - Intergenic
1082656938 11:55868071-55868093 CAGGGAGAGAAGAAGGCAGAGGG + Intergenic
1082921316 11:58497712-58497734 AAGGGTGAGAAGGAGGAAGAGGG + Intergenic
1083514705 11:63245939-63245961 CAGAGTGCGAAGGTTGAAGATGG + Intronic
1083765787 11:64840829-64840851 CAGTGTGACCATATGGAAAATGG + Intronic
1083884912 11:65568310-65568332 CAGTGGGAGAAGAGGGATGCAGG + Intergenic
1083988831 11:66234121-66234143 CAGGGTGAGAACCTGGTAGATGG - Exonic
1085568623 11:77539464-77539486 CAGTTTTAAGAGATGGAAGAAGG + Intronic
1085838999 11:79988672-79988694 CAGTGAGAGATGTTTGAAGAAGG + Intergenic
1086593841 11:88547619-88547641 CAGTCTGAAAAGATGGAATCAGG - Intronic
1088003801 11:104916024-104916046 CAGTGTGAGAAGAAGCAAAAAGG + Intergenic
1088680452 11:112237096-112237118 CAGTGGAAATAGATGGAAGAAGG + Intronic
1089235674 11:117022886-117022908 CTGTGTGGTAAGATGGAAGTGGG - Intronic
1089715859 11:120358442-120358464 CTGACTGATAAGATGGAAGATGG + Intronic
1091723931 12:2832972-2832994 CATCGTGGGAAGGTGGAAGATGG - Intronic
1092045576 12:5430229-5430251 CAGGGCGAGAAGCTGGAGGAGGG + Intergenic
1092815871 12:12311918-12311940 CAATGTTAGAAGATGGAGCAGGG + Intergenic
1093827199 12:23708046-23708068 CAATGAGAGAAGATAGAAAATGG + Intronic
1093887284 12:24476649-24476671 CAGTGTGGTAACTTGGAAGAGGG - Intergenic
1093958826 12:25251052-25251074 CGGTGTGGGAAGAGGGAAGAGGG + Intergenic
1094207917 12:27860086-27860108 CATTGAGAGAAGACGGCAGAAGG - Intergenic
1094225484 12:28040554-28040576 CAGGTTGAGAGGATGGTAGAGGG - Intergenic
1094270360 12:28607955-28607977 CAGTCTAACAAGATGGAAAAAGG - Intergenic
1095503912 12:42871730-42871752 CAATGTGAGAAACTGGATGAGGG - Intergenic
1096123525 12:49103855-49103877 CAGTGTGGGAACATTGGAGATGG + Intronic
1096910812 12:54981973-54981995 CAGTGTGGGAGGAGAGAAGAAGG + Intronic
1097622408 12:61956368-61956390 GATTTTGAGAAGATGGAGGAAGG - Intronic
1098428158 12:70389742-70389764 CAGTATGAGAAGTAGGCAGATGG - Intronic
1098722172 12:73914031-73914053 CAGGGTGACTAGATGGAAGCAGG + Intergenic
1099072538 12:78064021-78064043 CAATGTAAGAACATTGAAGAGGG + Intronic
1100172136 12:91986990-91987012 GGGTGGGAGAAGGTGGAAGAGGG - Intronic
1101195112 12:102373647-102373669 AAGACTGAGAAGATAGAAGAGGG - Intergenic
1101338612 12:103820416-103820438 CAGAGAGAGAATATGAAAGAAGG + Intronic
1102586243 12:113924964-113924986 CAGTTTTAGAAGAAGGAAGTAGG + Intronic
1103010312 12:117453417-117453439 CAGAGTGAGTTGATGTAAGAAGG - Exonic
1103311300 12:120011119-120011141 CCGAGTCACAAGATGGAAGATGG - Intronic
1103941423 12:124503339-124503361 TGGAGGGAGAAGATGGAAGAGGG + Intronic
1104128919 12:125873938-125873960 CATTGTGACAAGGTAGAAGAGGG + Intergenic
1104595939 12:130120035-130120057 CAGTGTGTGAAGATGCATGTGGG - Intergenic
1106554346 13:30797284-30797306 CAGTGTGAAACGCTGGAGGAGGG + Intergenic
1106572523 13:30940186-30940208 TAGTCTTGGAAGATGGAAGAAGG + Intronic
1106992700 13:35441162-35441184 AAGTGTGAGATGATGGAAAATGG - Intronic
1107454150 13:40538520-40538542 CAGTAGGAGAAGCTGGATGAAGG - Intergenic
1110149310 13:72230259-72230281 CACTGTGAAGAGATGAAAGAGGG + Intergenic
1110326805 13:74225838-74225860 CAGTCTAAGAAGAGGAAAGAGGG + Intergenic
1110341700 13:74399840-74399862 CATTGTGAGAGGCTGCAAGAAGG - Intergenic
1110696880 13:78501468-78501490 CAGTCTGGGTAGATGGAAGAAGG - Intergenic
1110696893 13:78501546-78501568 CAGTCTGGGTAGATGGAAGAAGG - Intergenic
1110988396 13:82004570-82004592 TAGTGTAAGAAAATGAAAGATGG - Intergenic
1112121319 13:96415153-96415175 CACTGTGAGAAGATTCAAAATGG - Intronic
1112218194 13:97458195-97458217 CTGTGTGAAAAGATGAATGAGGG + Intronic
1112769172 13:102776775-102776797 CTGGCTGAGAAGATGGAAGAGGG + Intergenic
1113734593 13:112669208-112669230 CTGAGTGAGAAGATGTGAGAAGG + Intronic
1114275071 14:21135662-21135684 GAGTGGGAGAAGATGGGAGTGGG - Intergenic
1115162565 14:30412330-30412352 CTGGCTGTGAAGATGGAAGAAGG - Intergenic
1116225100 14:42140326-42140348 CACTGTTAGAAGAGGGAACAGGG - Intergenic
1117841267 14:59862848-59862870 AAGTTTGAGAAGAGGGGAGAAGG - Intronic
1118821829 14:69350792-69350814 GAATGAGAGAAGATGGAAGAGGG + Intronic
1118975128 14:70670248-70670270 CACTGTGACAAAATGGAATAGGG - Intronic
1119529576 14:75350337-75350359 CAGAGTTAGAAGATGGCAGGAGG + Intergenic
1120540323 14:85742791-85742813 GAGTGTGAGAAGAGAGAAAATGG - Intergenic
1121019816 14:90573069-90573091 CTTTGTGAGAAGATGGCAGAGGG - Intronic
1121086811 14:91152969-91152991 CAGTGGGATAAACTGGAAGAAGG + Intronic
1121489128 14:94345535-94345557 CATGGTGGGAAGAGGGAAGAAGG - Intergenic
1121745725 14:96289488-96289510 CTGTGTGAGGTGATGGAAAAGGG - Intronic
1121827825 14:97025296-97025318 CAGGGTTTGAAGAGGGAAGATGG - Intergenic
1121885436 14:97538633-97538655 CAGTGAGAGAAGATAGCAGGAGG - Intergenic
1121970229 14:98349199-98349221 GAGGGTGAGAAGAAGGGAGAGGG + Intergenic
1122723873 14:103737723-103737745 AAGTGTGAGGAGATGGAGGAAGG - Exonic
1123685506 15:22794391-22794413 CAGTGTGTGAAGATGGAGTGTGG + Intronic
1124010023 15:25830643-25830665 CAGTGAGGGAAGACGGAAGGGGG - Intronic
1124602938 15:31149834-31149856 CAGAATGTCAAGATGGAAGAGGG - Intronic
1124794749 15:32766729-32766751 GGGTGTGAGAGGATGGAGGAGGG + Exonic
1124801451 15:32837039-32837061 CAGAGTGAGAAGGATGAAGATGG - Intronic
1125931630 15:43604342-43604364 CAGGGTGAGATGAAGGAAGAAGG - Exonic
1125944734 15:43703822-43703844 CAGGGTGAGATGAAGGAAGAAGG - Intergenic
1126132848 15:45359853-45359875 CAGTGTGATACGCTGGAAGCGGG - Intergenic
1126330158 15:47523089-47523111 CACTGTTAGCAGATGGAAGATGG - Intronic
1126416973 15:48427883-48427905 CTGGGTGAGAAGAAGCAAGAGGG + Intronic
1127229393 15:56971898-56971920 TAGCGGGAGTAGATGGAAGAAGG + Intronic
1129281731 15:74490300-74490322 CAGGGTGAGCAGCCGGAAGAGGG - Intergenic
1129354299 15:74979049-74979071 CATTGCAAGAAGCTGGAAGAAGG - Intronic
1129535794 15:76312705-76312727 CAGTGAGAGAAGAGGGCAGTGGG - Intergenic
1129940925 15:79495968-79495990 CAGTGTGAGTATATGTAAGGGGG + Intergenic
1130766651 15:86877850-86877872 GAATGTGAGAAGAGAGAAGAAGG - Intronic
1131023756 15:89122199-89122221 CATGGTAGGAAGATGGAAGAAGG - Intronic
1132093122 15:98961594-98961616 CAGTGTGAGCTGCTGGCAGAAGG - Exonic
1132751584 16:1460142-1460164 CAGAGTGAGGAGATGGAAGGAGG + Intronic
1133042415 16:3067684-3067706 CAGGGTGAGAAGGATGAAGAGGG + Intronic
1133110616 16:3545953-3545975 CAGTGTGAGAGGATGGACTGAGG + Intronic
1133889008 16:9860666-9860688 CAGAGTGACAAGCTGGGAGATGG + Intronic
1134233879 16:12450585-12450607 CGGTGTGAGAGAAGGGAAGACGG + Intronic
1134566108 16:15253216-15253238 CAGTGGGACAGGATGGAAGCTGG + Intergenic
1134736386 16:16503482-16503504 CAGTGGGACAGGATGGAAGCTGG - Intergenic
1134931129 16:18208686-18208708 CAGTGGGACAGGATGGAAGCTGG + Intergenic
1135294821 16:21270057-21270079 AAGTGGGAAAAGAAGGAAGAAGG + Intronic
1135524180 16:23201268-23201290 CAGTTTGAAAAGGGGGAAGAGGG - Intronic
1137406888 16:48196279-48196301 CAGGAGGAGGAGATGGAAGAAGG - Exonic
1137572820 16:49577971-49577993 CACTGTGGGCAGGTGGAAGAAGG + Intronic
1137936531 16:52640229-52640251 GTCTGTGAGAAGAAGGAAGAGGG + Intergenic
1138150973 16:54656725-54656747 CACAGTGAGTAGATGGAAGAAGG + Intergenic
1138514150 16:57526715-57526737 CTGTGGGAGAAGCTGGAACAGGG - Intronic
1138576145 16:57908479-57908501 GAGGATGAGAAGGTGGAAGAAGG - Intronic
1138598378 16:58041418-58041440 CAGTGTGGGGAGATCGAGGAGGG + Intronic
1139104143 16:63805682-63805704 GAGTGAGAGAAGATAGAACAGGG - Intergenic
1139181301 16:64751680-64751702 CAGTCTGAGAGGATGGAATGGGG + Intergenic
1139729261 16:68928704-68928726 AAGTTTGAGCAGATGAAAGAGGG + Intronic
1140057680 16:71539635-71539657 CAGTGTGAACAGAGTGAAGAGGG + Intronic
1140232288 16:73127284-73127306 CAGGCAGAGAAGAGGGAAGAAGG + Exonic
1141270401 16:82534939-82534961 CAGTGTGACATTATGGAACACGG + Intergenic
1141619594 16:85229873-85229895 CAGGGTGAGAAGGGGGTAGAGGG + Intergenic
1141894172 16:86947842-86947864 CAGGGTGAGAAGGTGGGTGAAGG - Intergenic
1142023939 16:87802218-87802240 CAGTGTGTGCAGATGGCAGATGG - Intergenic
1142411644 16:89920025-89920047 GAGTGTGAGATGCAGGAAGAAGG - Exonic
1143387232 17:6538302-6538324 CAGTGTTAGGACATGGAAAATGG - Intronic
1144391211 17:14795234-14795256 GTGTGTGAGAACATGGAAGGAGG + Intergenic
1144442166 17:15293279-15293301 ACCTCTGAGAAGATGGAAGAAGG - Intergenic
1145415327 17:22709926-22709948 CAGGATGAGGGGATGGAAGATGG + Intergenic
1147763657 17:42818187-42818209 GAGTGTGAGAAGATAGAACAGGG + Intronic
1147788770 17:42999548-42999570 CAGTCTCAGGAGATGGGAGAGGG - Intronic
1148020198 17:44548274-44548296 CAGAGTGAGAAGATGGGAGGGGG + Intergenic
1148729699 17:49825915-49825937 CTGTGTGCCAACATGGAAGAAGG - Intronic
1149289801 17:55207029-55207051 CACTGTGAGAAGTTGCAGGAGGG - Intergenic
1149358059 17:55864607-55864629 CAGTATGAGGAGGTGGAATAAGG - Intergenic
1149547630 17:57515978-57516000 CATTGTGGGAAGCTGGATGAAGG - Intronic
1149804730 17:59605615-59605637 AAGTGAGAGAAGATGCAAGAAGG + Exonic
1151887552 17:76932130-76932152 CTGTGTAAGAAGAAGAAAGAAGG - Intronic
1152365976 17:79856580-79856602 CAGTTTTAGAAGATAGAAGCTGG + Intergenic
1155118466 18:22793939-22793961 CAGTGGGTGAATGTGGAAGAGGG - Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1156495749 18:37524302-37524324 GAGGGTGACAAGGTGGAAGAAGG + Intronic
1156903028 18:42323334-42323356 CAGTGTGAGAGGCAGGAATAAGG + Intergenic
1157131494 18:45011810-45011832 CAGTCTCAGAAGATGAAAGATGG + Intronic
1157172283 18:45418885-45418907 CAGTGTCAGAGGAGGGGAGAGGG + Intronic
1158131078 18:54153287-54153309 CAGAGTGAGGGAATGGAAGAGGG + Exonic
1158651411 18:59290656-59290678 CATTGGGAGAAGCTGGGAGAAGG + Intronic
1159166182 18:64703549-64703571 GAATATGAGAAGATGAAAGATGG - Intergenic
1159418288 18:68182407-68182429 CATACTGAGAAGATAGAAGATGG - Intergenic
1160265290 18:77336503-77336525 CAGTGGGAGGAGGTGGAAGGGGG + Intergenic
1160512964 18:79462850-79462872 CAGTGTGTGCAGTTGGAAGCTGG + Intronic
1160821128 19:1058693-1058715 TAGTGTGAAGAGAAGGAAGAGGG - Exonic
1160937955 19:1606186-1606208 CGGTGTGGGCAGAAGGAAGAGGG + Intergenic
1162196140 19:8986204-8986226 CAATCTGTGAAGATGGTAGAAGG - Intergenic
1162719942 19:12656428-12656450 CAGAGGGAGAAGATACAAGAGGG + Intronic
1163580343 19:18135059-18135081 CAGGGAGAGAAGCAGGAAGAGGG + Intronic
1163933823 19:20423906-20423928 CAGGGAAAGAAGAGGGAAGAAGG + Intergenic
1165004244 19:32791575-32791597 CAGTCTTAGAAGATGAAAGCAGG + Intronic
1166048678 19:40244958-40244980 CAGTGTCAAAATGTGGAAGAGGG - Intronic
1166307952 19:41945764-41945786 CACTTTGAGAAGATGGATGCTGG - Intergenic
1166357693 19:42236745-42236767 CACTGTGAGAAGAGTGAGGAGGG + Intronic
1166909487 19:46141725-46141747 CAGTGAGGGAAGTTGGAAGCAGG - Intergenic
1166923792 19:46251500-46251522 CAGTGAGGGAAGTTGGAAGCAGG + Intergenic
1167429674 19:49447262-49447284 CAGTGTGGGAGGATGGAGGGAGG + Intronic
1167477988 19:49711992-49712014 AAGTGGGAGACCATGGAAGAAGG + Intronic
1167712188 19:51119172-51119194 TAGTGGGGGATGATGGAAGAGGG + Intergenic
925741111 2:7006787-7006809 CAATGTCAGAGGGTGGAAGAAGG - Intronic
925774698 2:7323340-7323362 CAGTGTTTGAAAAAGGAAGAAGG - Intergenic
926303416 2:11619563-11619585 TAGTGTGAGGGTATGGAAGAAGG - Intronic
927231040 2:20824494-20824516 CAGTGTCACAACATGGTAGAAGG + Intergenic
927703122 2:25280468-25280490 GAGAGTGAGAACAGGGAAGAAGG - Intronic
927829406 2:26336126-26336148 CAGTGTGGGGAGCTGGAAGTAGG + Intronic
928732680 2:34250650-34250672 CTGTGGGAGAAGATGCAGGAAGG + Intergenic
929092471 2:38233056-38233078 CAGGGTCAGAAGCTGGCAGAAGG - Intergenic
929287269 2:40149605-40149627 AAGTGTGACAAGATGGAAAGAGG + Intronic
929564887 2:42978137-42978159 GAGAGTGGGAAGAAGGAAGAGGG + Intergenic
930463026 2:51708078-51708100 AAGTATAAGAAGAGGGAAGAAGG - Intergenic
930535268 2:52637988-52638010 AAGTGGAAGAAGAAGGAAGAAGG - Intergenic
931457614 2:62424571-62424593 CTGTGTGACAAGATGGAGAAGGG + Intergenic
931987576 2:67756451-67756473 GGGTGTGAGAGGATGGAAAAAGG - Intergenic
932029457 2:68168457-68168479 GAGTGTGGGAAGAGGGAAGCTGG + Intronic
932313856 2:70767211-70767233 CAGGGAGAGGAGAGGGAAGATGG + Intronic
933022255 2:77208488-77208510 CTGAGTGAGAAAAGGGAAGAAGG + Intronic
933060487 2:77730988-77731010 CAGTGTGAGGATGTGGAAGTGGG - Intergenic
933692959 2:85194011-85194033 TAGTGTGAAAAGATGGGAGAGGG + Intronic
933878342 2:86643035-86643057 CACTGTCAGAAGAGGGAAAAAGG - Intronic
934962314 2:98687503-98687525 GAAAGTGAGAAGAGGGAAGAAGG - Intronic
935845187 2:107158421-107158443 CAGTATGAAAAGATGGAATTGGG - Intergenic
935861298 2:107332961-107332983 CACTGTGGGAGGATGGAACACGG + Intergenic
935918533 2:107985431-107985453 CAGTGTAAGAAAAGGGGAGATGG + Intergenic
936997870 2:118434137-118434159 CAGCATGAGAAAATGAAAGAAGG + Intergenic
937479209 2:122241579-122241601 AAGGGTGAGAAGAAGGAAGGAGG + Intergenic
937493885 2:122398093-122398115 AAGGATGAGAAGGTGGAAGATGG + Intergenic
938663011 2:133506519-133506541 CAGTGTGAGGAGAATGAAGTGGG + Intronic
939290561 2:140188917-140188939 CTGTGTGAGAAGATAAAATATGG - Intergenic
939657617 2:144847682-144847704 CAGAGAGAGAAAATGGGAGAGGG + Intergenic
939737371 2:145865353-145865375 CAGAGAGAAAAGATGGTAGAGGG - Intergenic
940183224 2:150956991-150957013 CAGGGTGAGAACAGGAAAGAAGG - Intergenic
940663146 2:156572758-156572780 AGGTGTAAGAAGATGCAAGAGGG + Intronic
941204704 2:162557499-162557521 CAGTGGCAAAAGATGGGAGATGG + Intronic
941465733 2:165824339-165824361 CAGAATAAGAAGATGGAAGGAGG - Intergenic
941952212 2:171167273-171167295 CACTCTGATAAGAAGGAAGAAGG - Intronic
942483910 2:176419397-176419419 CAGTGTGGGAAGAGAGAAGGGGG - Intergenic
944659065 2:201905317-201905339 CAGGCAGAGAGGATGGAAGAGGG - Intergenic
945228383 2:207557282-207557304 AACTGTGAGAAAATGGAAGTAGG - Intronic
945586637 2:211673186-211673208 CAGTGTGAGAAGATGGAAGATGG - Exonic
945718833 2:213392479-213392501 CAGTTTGAAAATATGGAAGTTGG + Intronic
946775538 2:223136342-223136364 CTTTGTGAGAAGATGGAGGCTGG + Intronic
947231533 2:227892623-227892645 CTGTGGGAGAAGATGGTAGAAGG + Intronic
947457741 2:230270996-230271018 CAGGCTTTGAAGATGGAAGAAGG + Intronic
947468080 2:230372010-230372032 CAGGCTTTGAAGATGGAAGAGGG + Intronic
947524399 2:230869557-230869579 CAGGCTGAGAACAGGGAAGATGG - Intronic
948246660 2:236492054-236492076 CAGTGTCATAACATGGCAGAAGG - Intronic
948249832 2:236517985-236518007 CAGTGTGAGAAAAAAGAAAAAGG + Intergenic
1168803522 20:659553-659575 AAGAGTCAAAAGATGGAAGATGG - Intronic
1169858777 20:10130672-10130694 CAGTGGTAGAAGTTAGAAGAGGG - Intergenic
1171564391 20:26166371-26166393 GAGTTTGAGACGGTGGAAGATGG + Intergenic
1173155803 20:40607624-40607646 CAGTCTGGGAACATGGTAGAAGG - Intergenic
1173416054 20:42856887-42856909 AAGGGAGAGAAAATGGAAGATGG + Intronic
1173497469 20:43529944-43529966 CAGTGAGAGAAGGTAGCAGAGGG + Intronic
1173759886 20:45550135-45550157 GAGTGTGATAAGTGGGAAGATGG + Intergenic
1174975530 20:55328857-55328879 CATTCTGAGAAGATGGAGGGAGG - Intergenic
1175385537 20:58592630-58592652 CGGGGTGAGATGAGGGAAGATGG + Intergenic
1175523564 20:59618442-59618464 CAGAGTGAGACCAGGGAAGAGGG + Intronic
1175677882 20:60962385-60962407 CAGGGTTAGAATATGAAAGATGG - Intergenic
1176033099 20:63023319-63023341 AAGGGTGTGAAGAGGGAAGAGGG - Intergenic
1176126958 20:63479890-63479912 CTGTGTGAGACCAGGGAAGAGGG - Intergenic
1177004044 21:15648725-15648747 CAGTGAGAAAAGGAGGAAGAGGG - Intergenic
1177479688 21:21670111-21670133 TAATTTGAGAAGATGTAAGAAGG + Intergenic
1178246902 21:30961617-30961639 CATTGGGAGATGAGGGAAGAAGG - Intergenic
1178789270 21:35683784-35683806 GAGTGGGTGAAGGTGGAAGAGGG - Intronic
1178995999 21:37400389-37400411 GAGTGTGATAAGCTGGAAAATGG - Intronic
1179371787 21:40812574-40812596 CAGAGGGAGAAGATGGAACTTGG + Intronic
1179588022 21:42386164-42386186 GAGAGTCACAAGATGGAAGATGG + Intronic
1179964844 21:44796869-44796891 CTGGCTGTGAAGATGGAAGAAGG - Intronic
1181743944 22:24942763-24942785 CAGGGTGATATGATGGAAAAAGG + Intronic
1182018860 22:27064032-27064054 CAGGGTGAGAAGAAGAAAGAAGG + Intergenic
1182541420 22:31044744-31044766 AAGTGTGTGAAAATGGCAGATGG + Intergenic
1182963033 22:34494295-34494317 CAGAGGGAGAAGATGCAAGTGGG + Intergenic
1183023696 22:35047963-35047985 CAGGGTGAGGAAAAGGAAGAGGG + Intergenic
1183487391 22:38096928-38096950 CAGGGAGGGAAGAGGGAAGAAGG + Intronic
1184203329 22:42984475-42984497 CAGTCTGGGGAGATGCAAGATGG - Intronic
1184421449 22:44384901-44384923 GAGTGGGGGGAGATGGAAGAGGG + Intergenic
1184634726 22:45817976-45817998 CAGGGTGAGAAGCTGGAAGTTGG + Intronic
1184782183 22:46654982-46655004 CCGTGAGAGAAGATGACAGAAGG + Intronic
1184854448 22:47138811-47138833 CCGTGTGAGGACATGGCAGAGGG - Intronic
949302894 3:2605343-2605365 CAGTGTTAGGAGGTGGGAGAAGG + Intronic
949469927 3:4383578-4383600 CAGTCTCAGAAGATGACAGAAGG + Intronic
949930191 3:9072318-9072340 GTGTGTGGGAACATGGAAGAGGG - Intronic
950335570 3:12190250-12190272 CAGTGTGGGAACAAGGGAGAAGG - Intronic
950375587 3:12569620-12569642 CAGTGGGAGATGATGGAAGTAGG + Intronic
951240056 3:20276472-20276494 ATGTGTGAGATGATGGAAGGGGG + Intergenic
951854118 3:27175802-27175824 GAGTGTGAGAAGAAAGAAAAAGG + Intronic
953461202 3:43082497-43082519 CAGTGTGTGTATATGGGAGAGGG - Intronic
954683927 3:52360435-52360457 CAGTGTGGGAAGGAGCAAGAGGG - Intronic
955303322 3:57805532-57805554 CAGTGTTAGAAGTAGTAAGAGGG - Intronic
956506859 3:69949911-69949933 CAGACTGAGAATATGGAATATGG + Intronic
957025051 3:75172254-75172276 CAGTGTGAGAGTATGACAGAAGG - Intergenic
957144045 3:76398576-76398598 CAGTGTGTGAAAATGGAAGAGGG - Intronic
957144054 3:76398869-76398891 CTGAGTATGAAGATGGAAGAAGG + Intronic
957569164 3:81924266-81924288 CAGTGAGGGATGAGGGAAGAGGG + Intergenic
957773941 3:84730781-84730803 CTGTGTGAGAAGAAAGAGGAAGG - Intergenic
957955312 3:87178680-87178702 CAGAGGGAGAAGAAGGTAGAAGG - Intergenic
958774137 3:98461056-98461078 CAGGGTTTGAAGATGGAAGGGGG + Intergenic
960493640 3:118349691-118349713 CAGTGGGGGAAAATGGAACAAGG - Intergenic
960972669 3:123150706-123150728 CAGTGTCTGGAGAAGGAAGAGGG - Intronic
961101128 3:124200106-124200128 CAGTGTGAGAAGATGGTCAGTGG + Intronic
961173942 3:124818733-124818755 CAATGTTAGAAGATGAAACAAGG - Intronic
961476853 3:127152429-127152451 CAGCATGTGAAGATGCAAGAAGG - Intergenic
962069352 3:132017283-132017305 GAGTGAGAGAAGATGGGAGAAGG + Intronic
962202817 3:133414844-133414866 AGGTGTGAGTAGATGGAAGAGGG - Intronic
962415795 3:135180581-135180603 CAGTGCAGGAAGATGGATGAGGG - Intronic
962426632 3:135274504-135274526 CAGTGTGTGAAGATGGGTGTGGG + Intergenic
962957619 3:140280663-140280685 CAGTGTGCCATGATGCAAGATGG + Intronic
963313776 3:143736615-143736637 AATAGTGAGAAGATTGAAGATGG + Intronic
965082143 3:164047765-164047787 CAGAGTAAGAATATGGAACAAGG - Intergenic
966402543 3:179562687-179562709 CAGTGGGAGAAGAAGGAGGAAGG - Intergenic
966435402 3:179878174-179878196 CCATGATAGAAGATGGAAGAGGG - Intronic
966935779 3:184707973-184707995 CAGTGTCTGAAGAAAGAAGATGG + Intergenic
967972999 3:195012875-195012897 CAGTGGGAGAGGATGGAGGAGGG + Intergenic
968346882 3:198015957-198015979 CAGTTTGGGAAGAGGGAAGATGG + Intronic
969440276 4:7212862-7212884 CAGGGTGAGGAGTTGGAGGAGGG + Intronic
970066673 4:12102809-12102831 GAGTGTGAGAAAAGGGAAAATGG - Intergenic
970467889 4:16345969-16345991 CTGTCTTTGAAGATGGAAGAAGG - Intergenic
970673603 4:18423012-18423034 AAGTGGGGGAAGATGGAAAATGG - Intergenic
971185240 4:24369154-24369176 CAGGGTGAGAACATGGATAACGG + Intergenic
971243796 4:24911596-24911618 CAGTTTGAGAAGATGGAGCCAGG + Intronic
971266584 4:25101226-25101248 AAGGGTGAGGAGGTGGAAGAGGG - Intergenic
972733799 4:41820135-41820157 GAGGGTGGGAAGGTGGAAGAAGG + Intergenic
972840974 4:42929618-42929640 AGGTTTGAGAAGGTGGAAGACGG + Intronic
974320857 4:60347719-60347741 CAGTGTGAGGATATTGAAAAGGG - Intergenic
974429769 4:61780640-61780662 CAGTGGGAATGGATGGAAGAAGG - Intronic
974654194 4:64798511-64798533 GCTTGTGAGAAGATGGAATATGG + Intergenic
976190337 4:82480886-82480908 CAGTGTGAGCAACTGAAAGACGG + Intergenic
976190647 4:82483573-82483595 GAGTGAGAGAGCATGGAAGATGG - Exonic
976651093 4:87435663-87435685 CAGTGTGAAAAAATAGAAAAGGG + Intronic
976681137 4:87757427-87757449 GAGTGTGAGGAGAAGGAAAAGGG + Intergenic
978119653 4:105063071-105063093 AATTCTCAGAAGATGGAAGATGG - Intergenic
979223690 4:118260306-118260328 TAGAATGAGAAGGTGGAAGAAGG - Intergenic
979752960 4:124302327-124302349 CATTTTGGGAAAATGGAAGAAGG - Intergenic
979957097 4:126967864-126967886 CTGTGTGGGATGATGCAAGAAGG + Intergenic
980011117 4:127595809-127595831 CACAGTGAGAAATTGGAAGAGGG - Intergenic
982619756 4:157689650-157689672 CAATGTGAGAAAATGGAAAAAGG - Intergenic
982829335 4:160041790-160041812 CAGGATGAAAAGATGGCAGAAGG + Intergenic
984237555 4:177179060-177179082 CAGGAAGAGCAGATGGAAGATGG - Intergenic
985194842 4:187418768-187418790 CAGTATGAGAAAATGGGTGAAGG - Intergenic
986190392 5:5491570-5491592 GAGAGGGAGAAGATGAAAGACGG + Intergenic
986594188 5:9403575-9403597 CAGTGTGAGATGATGCATGGAGG - Intronic
990312739 5:54555186-54555208 CAGGGTGGGAAGATGGGACAGGG - Intergenic
992232459 5:74676777-74676799 CGGTGCGGGAAGGTGGAAGAAGG + Intronic
992602426 5:78415963-78415985 CAGTGTTAGGAGGTAGAAGATGG + Intronic
993074128 5:83205806-83205828 CAGGGTGAGAATAAGGATGAGGG + Intronic
993593686 5:89826673-89826695 CAGAGAGAAAAGCTGGAAGATGG + Intergenic
994076707 5:95659941-95659963 CAGTGTTCAAAGAAGGAAGAGGG - Intronic
994292272 5:98042004-98042026 AAGTATCAGGAGATGGAAGATGG + Intergenic
995096653 5:108243640-108243662 CAGTTTGACAAAACGGAAGAAGG - Intronic
995248367 5:109961191-109961213 GAGCATAAGAAGATGGAAGAGGG + Intergenic
995315014 5:110759814-110759836 CAGGGTCAGAAGTAGGAAGATGG + Intronic
996613740 5:125414859-125414881 GGATGTGAGAAAATGGAAGATGG + Intergenic
997142480 5:131397524-131397546 CAGATTGAAAAGAGGGAAGAAGG - Intronic
997368033 5:133338356-133338378 CAGGGTGGGAAGATGGAGCATGG - Intronic
997420212 5:133760729-133760751 TAGAGTGAGAAAAAGGAAGAGGG + Intergenic
997430990 5:133841123-133841145 CAGTATCAGACTATGGAAGAAGG + Intergenic
1000695173 5:164371689-164371711 CAGTGGGACAAGATGGAAGGGGG + Intergenic
1000969378 5:167697053-167697075 AAGTGTGAGAAACTGGAGGAGGG - Intronic
1001801502 5:174548234-174548256 GAGGGTGAGGAGAAGGAAGAAGG - Intergenic
1002427552 5:179185184-179185206 CAGTGGGAGGACATGGAGGAAGG + Intronic
1002438743 5:179252376-179252398 CAGTGTGAGAAGTTAGAAAAAGG - Intronic
1002483905 5:179522243-179522265 CAGGGTGAGAGGACGGAAAACGG + Intergenic
1003335499 6:5168129-5168151 CAGTGGGAGAAGAGAGAGGAAGG + Intronic
1003618624 6:7677701-7677723 AAATAGGAGAAGATGGAAGATGG - Intergenic
1003897319 6:10619943-10619965 CAGAGTGACACGATGTAAGAAGG - Intronic
1004375172 6:15084840-15084862 CATTGGGAGAGGATGGAGGATGG + Intergenic
1004546585 6:16603843-16603865 CAGTGGCAGAAGATTGACGAAGG + Intronic
1004578379 6:16922523-16922545 CAGTGGCAGGAGATGGGAGAGGG + Intergenic
1004691564 6:17996600-17996622 CAAAGTGAGAAGAAAGAAGAAGG + Intergenic
1004743448 6:18486508-18486530 ATGTGTTAGAAGAGGGAAGATGG + Intergenic
1004788744 6:18999396-18999418 CAATGTAAGAAGATGGATGCTGG - Intergenic
1005659857 6:27985917-27985939 CAGTGGGAGAACATGGATTAGGG - Intergenic
1006418655 6:33920043-33920065 CAGAGGGAGAGGATGGAAGAAGG + Intergenic
1006888279 6:37400475-37400497 AAGTCTGAAAATATGGAAGAGGG + Intergenic
1007067079 6:39001621-39001643 GAGTGTGGGAAGAAGAAAGAAGG + Intronic
1009588183 6:65633712-65633734 AAGTGTGAGAAATTGGAAAAGGG - Intronic
1009873222 6:69473904-69473926 CAGAGTGAGAAAAAGGAAGCAGG - Intergenic
1010025752 6:71214359-71214381 TAGTCTGAAAAGATGAAAGAAGG + Intergenic
1010619350 6:78055130-78055152 CAGTAAGAGATGCTGGAAGAAGG - Intergenic
1011075288 6:83431465-83431487 AAGTGCGAGAAGATGCCAGAAGG + Intergenic
1011079012 6:83469079-83469101 AAATGTGAGAAAATGGCAGATGG + Intergenic
1011162462 6:84406815-84406837 CGGTTTTAGAAGGTGGAAGAAGG + Intergenic
1011249150 6:85352678-85352700 CAGTGGGACAAGATGGGAGGTGG - Intergenic
1011488627 6:87868760-87868782 CTGGGTGAGAGGAGGGAAGAAGG - Intergenic
1011587342 6:88940901-88940923 CATTGTGAGAAGCTGGGAGAAGG + Intronic
1011960955 6:93089312-93089334 CAATATGAGAAGGTGGAAGGAGG + Intergenic
1012104096 6:95131482-95131504 CAGAGTGATAAGCTGAAAGAGGG - Intergenic
1012530090 6:100225200-100225222 CAATGTCAGAGGGTGGAAGATGG + Intergenic
1013290941 6:108718164-108718186 CAGTGTGAGAAGCCAGAGGAAGG + Intergenic
1013761599 6:113524831-113524853 TAATGAGAGAAGAAGGAAGAGGG + Intergenic
1013929456 6:115513754-115513776 CAGTGAGAGAAATTGGAGGAAGG - Intergenic
1014045702 6:116883347-116883369 GAGTGGTAGAAGAGGGAAGAGGG - Intronic
1014620890 6:123666013-123666035 CAGTGTGAGAATATTGAAAATGG - Intergenic
1014848727 6:126313507-126313529 CAGTGTCAGAGGAGGGAAGAGGG - Intergenic
1014946935 6:127510094-127510116 CGATTTGAGAAGATGGAAGGTGG - Intronic
1015485628 6:133766797-133766819 GAGTGTAAGAAGAGGGAAAAAGG + Intergenic
1015889786 6:137958876-137958898 CAGTTTTACAAGATGGAAGAAGG - Intergenic
1016488220 6:144566789-144566811 CAGTTTGAGAAGCTGGAATAAGG - Intronic
1016987084 6:149903705-149903727 CAGTTGGAGAAGCTGGAAAAGGG + Intergenic
1017022709 6:150153036-150153058 CACAGCAAGAAGATGGAAGACGG + Intronic
1018181402 6:161226592-161226614 AAGTGAGAGAAGATGGAGGGCGG - Intronic
1018674360 6:166206185-166206207 CAATGCCAGAAGAGGGAAGAGGG - Intergenic
1019861806 7:3665932-3665954 AATTGTGGGAAGATGGTAGAAGG - Intronic
1021113524 7:16723232-16723254 CATTGTGAGAACATGTCAGAAGG - Intergenic
1021183302 7:17533606-17533628 CAGAGTGGGAGGATGGGAGAAGG - Intergenic
1021668771 7:23014063-23014085 CAGTGAGAGGAGGGGGAAGATGG - Exonic
1021956358 7:25828828-25828850 TAGTGTGGGGAGATGGAAAATGG + Intergenic
1022037132 7:26545140-26545162 CAGGGTGACAAAATGGAACACGG + Intergenic
1022549104 7:31220169-31220191 CAGGGTGACCAGTTGGAAGAAGG - Intergenic
1022959119 7:35409448-35409470 CAGTGTGATGACATGGGAGAGGG - Intergenic
1022964595 7:35460784-35460806 CAGAGTTAGAATATGAAAGACGG - Intergenic
1023284853 7:38608435-38608457 CAGTGAAAAAAGGTGGAAGAAGG - Intronic
1023506711 7:40907041-40907063 CAGGGTAGGAAGATGGAAGTAGG + Intergenic
1023878732 7:44306902-44306924 CGGTGTGAGCAGGGGGAAGAGGG + Intronic
1023878820 7:44307236-44307258 GGGTGTGAGCAGAGGGAAGAGGG + Intronic
1023878830 7:44307276-44307298 GGGTGTGAGCAGAGGGAAGAGGG + Intronic
1023943131 7:44782821-44782843 CAGTGAGGGCAGATGGCAGAGGG + Intergenic
1026602468 7:71787920-71787942 AGGTGTGGGAAGAAGGAAGAGGG + Intronic
1027535147 7:79390532-79390554 CAGTATGAGATGCTGGAGGAGGG + Intronic
1027542966 7:79491731-79491753 CAGTGTGAAGACAAGGAAGATGG - Intergenic
1029330173 7:99846828-99846850 CAGTTTTGAAAGATGGAAGAAGG + Intronic
1029493429 7:100884523-100884545 AAGGATGAGAAGAAGGAAGACGG + Exonic
1030359765 7:108582579-108582601 CAGTGTCATAACATGGCAGAAGG + Intergenic
1030579665 7:111338057-111338079 CAGAGTGAGACAAAGGAAGAAGG + Intronic
1031013728 7:116550247-116550269 CAGGGTTTCAAGATGGAAGAGGG - Intronic
1031424091 7:121584820-121584842 AAGTGTCAGAAAATGGATGAAGG + Intergenic
1031813587 7:126404171-126404193 CAGCCAGAGAAGAAGGAAGAAGG - Intergenic
1031968831 7:128048915-128048937 CCGTGTGAACAGCTGGAAGAAGG - Intronic
1032558359 7:132861347-132861369 CAGTGAGAGAAAATAGGAGAGGG - Intronic
1032961682 7:137042489-137042511 GAGAGAGAGAAGAGGGAAGAGGG - Intergenic
1033447906 7:141438116-141438138 TAGTGTGGGAAGCTGGAAGCAGG + Intronic
1035477614 7:159154477-159154499 CAGTGTCAGAACATGGGCGATGG + Intergenic
1035595312 8:853233-853255 CAGAGGGAGAAGGTGGAGGAGGG + Intergenic
1035913606 8:3595850-3595872 CACTGTGTGAACGTGGAAGAGGG + Intronic
1036918410 8:12828056-12828078 CAGTGTGGGATGATGGGAGAGGG + Intergenic
1036945718 8:13092635-13092657 CAGGGTGTTGAGATGGAAGAGGG + Exonic
1037987556 8:23299324-23299346 CGGTGTGGGAACCTGGAAGAGGG + Intronic
1038303259 8:26375627-26375649 AAGGATGAGAAGAGGGAAGAAGG - Intergenic
1038567124 8:28628995-28629017 CAGAATGAGAAGCTGGAAGGTGG + Intronic
1038686392 8:29722585-29722607 CACTGTGGAAAGCTGGAAGAAGG + Intergenic
1039407852 8:37328236-37328258 GAGAGAGAGAAGAAGGAAGAAGG - Intergenic
1040005979 8:42621299-42621321 CAGTGTGAGAAGCTGCAGGTCGG + Intergenic
1040748797 8:50680307-50680329 CAGTGTGAGAATGTGGACAAAGG - Intronic
1040809550 8:51436491-51436513 CAGTGGGATCACATGGAAGAAGG - Intronic
1041765788 8:61416905-61416927 GAGTTTGAGAGGGTGGAAGAGGG + Intronic
1041994231 8:64033887-64033909 CAGTGGGACAAGATGTAATACGG + Intergenic
1042014903 8:64298159-64298181 GAGTGTGCGAATATGGATGAAGG + Intergenic
1042701179 8:71616747-71616769 CAGTGTCAGCAAATGGAACAAGG + Intergenic
1043244568 8:77981412-77981434 AAGTGTGAGAAGATGAATGGAGG + Intergenic
1043528863 8:81127949-81127971 CAGTATGAGCAAATGTAAGAAGG + Intergenic
1043730125 8:83667588-83667610 GAGTGAGAAAAAATGGAAGAGGG + Intergenic
1043733648 8:83717510-83717532 CAGTGTGGGAAAATGGGGGAAGG + Intergenic
1044106759 8:88217975-88217997 CACTGAGAGAAGATTAAAGATGG + Intronic
1044339563 8:91031446-91031468 CAGGGGGAGAATTTGGAAGACGG - Intronic
1045499675 8:102735525-102735547 CAGAGTGACAAGAAGGAAAATGG + Intergenic
1045500062 8:102738245-102738267 CACGGTGAGAAGCTGGGAGAAGG + Intergenic
1045767155 8:105686958-105686980 CTGTGTGCGTAGAAGGAAGAGGG - Intronic
1045891306 8:107161040-107161062 CAATGAAAAAAGATGGAAGAAGG - Intergenic
1046373812 8:113349200-113349222 CAGTGTTAGAAACTGGTAGATGG - Intronic
1046617643 8:116495080-116495102 CAGTGGGAGAAGAGGGTACAAGG - Intergenic
1047312420 8:123703879-123703901 CAGTGTGCGAATAAGAAAGACGG + Intronic
1047983244 8:130205174-130205196 CTATGTGAGAGGAAGGAAGAAGG - Intronic
1048621259 8:136135094-136135116 CAGTGGGAGAAGATGGTTTAAGG - Intergenic
1048871994 8:138806829-138806851 CAGTGGAACAGGATGGAAGATGG + Intronic
1049236748 8:141515933-141515955 CAGTGTGAGGAGAGAGACGATGG - Intronic
1049341431 8:142114646-142114668 CTTTGAGAGAAGAAGGAAGAAGG + Intergenic
1049379926 8:142306988-142307010 CAGTGTTAGAAGTTGGAACTGGG - Intronic
1050037897 9:1456724-1456746 CAGATTGAGATGATGGAAGCTGG + Intergenic
1050219697 9:3373204-3373226 CAGTGAGAGAGAATGGATGAGGG + Intronic
1050377725 9:4990376-4990398 CAGTGTTAGTAGCTGGTAGAGGG + Intronic
1050460704 9:5875256-5875278 CAGTGTACGTAGTTGGAAGAGGG + Intergenic
1050742617 9:8839766-8839788 CAGTGGGAGAAATGGGAAGAAGG + Intronic
1051584208 9:18710118-18710140 GAGTGTGGGAAGCTGGAGGAGGG - Intronic
1051799589 9:20917597-20917619 CAGTTAGAGAAGATGGTGGAAGG - Intronic
1052018703 9:23499845-23499867 CAGAGTGATGAGATGTAAGAAGG + Intergenic
1052288565 9:26816724-26816746 AAGTGTGATAACATGGATGAAGG + Intergenic
1053260963 9:36663521-36663543 AAGGGTGAGGAGATGGAAGGGGG - Intronic
1053621888 9:39828037-39828059 CAGAGAGAGAAGGGGGAAGATGG - Intergenic
1053837821 9:42159895-42159917 CAGAGAGAGAAGGGGGAAGATGG - Intergenic
1053883197 9:42616235-42616257 CAGAGAGAGAAGGGGGAAGATGG + Intergenic
1053889472 9:42678064-42678086 CAGAGAGAGAAGGGGGAAGATGG - Intergenic
1054222221 9:62423708-62423730 CAGAGAGAGAAGGGGGAAGATGG + Intergenic
1054228492 9:62485464-62485486 CAGAGAGAGAAGGGGGAAGATGG - Intergenic
1056317625 9:85406500-85406522 CAATGCAGGAAGATGGAAGAGGG - Intergenic
1056543983 9:87597811-87597833 CAGTGTGAGCAGAGGCAGGAAGG - Intronic
1058358986 9:104119765-104119787 CAGTGTCAGACGATGGAAGATGG + Intronic
1059645321 9:116260538-116260560 CTGAGTTAGAAGATGTAAGATGG - Intronic
1059764664 9:117372292-117372314 CAGAGGGTGAAGAAGGAAGAAGG + Intronic
1060062518 9:120473835-120473857 CCCTGTCAGAAAATGGAAGAGGG - Intronic
1060549924 9:124480063-124480085 CAGTGTGAGCAGAAGGATGGAGG - Intergenic
1060799424 9:126534318-126534340 CAGTGACAGAAGTAGGAAGAAGG + Intergenic
1061418168 9:130459287-130459309 CAGCTTGGGAAGATGGAGGACGG - Intronic
1061433215 9:130544333-130544355 AAGAGTGAGCAGATGCAAGAGGG - Intergenic
1061783769 9:133011389-133011411 GAAAGTGAAAAGATGGAAGATGG + Intergenic
1062060025 9:134490260-134490282 CAGTTTGGGAAGGTTGAAGAGGG + Intergenic
1062546639 9:137066537-137066559 CAGTGTGAGGAGCTGGAAAGGGG - Intronic
1185689395 X:2140706-2140728 CAGTGGGAGAGGCTGGAAAAAGG + Intergenic
1185918306 X:4061100-4061122 CAGGGTGAGAGGATGATAGATGG + Intergenic
1186174706 X:6913767-6913789 AAGTGAGAGAATTTGGAAGAAGG - Intergenic
1186955632 X:14678876-14678898 CAGTGCCGTAAGATGGAAGAAGG - Intronic
1187007614 X:15247870-15247892 CAGTGAGAGTAGGAGGAAGAAGG + Intronic
1187030186 X:15478777-15478799 AAGTGTGAGCAGAAGGCAGAGGG - Intronic
1187111257 X:16302966-16302988 CAGGCTTTGAAGATGGAAGAAGG + Intergenic
1187248534 X:17575573-17575595 AATTGTGAGAAGATTGATGAAGG - Intronic
1187356192 X:18574079-18574101 CAGTGTGAGAAGGAGGAAAATGG - Intronic
1189161552 X:38814214-38814236 CTGGCTGTGAAGATGGAAGAAGG + Intergenic
1189204603 X:39226932-39226954 CAGTTTGAGAAGAAGGGAAAAGG + Intergenic
1189510726 X:41658620-41658642 CAGTGTGAAGAGGTGGGAGAGGG + Intronic
1190462757 X:50694885-50694907 GATTGTGGGAAGATGCAAGATGG + Intronic
1193635413 X:83944090-83944112 CACTGTGAGCAGATGCAACAAGG + Intergenic
1193924043 X:87464066-87464088 CATTGTGGGCAGATGGGAGAGGG + Intergenic
1194725668 X:97393216-97393238 CAGTTTGAGAAGATGGTAACAGG + Intronic
1194992930 X:100564111-100564133 CAGTGGAGGAAGAGGGAAGAGGG + Intergenic
1195244479 X:102983215-102983237 AAATGTGAGAAGATGGTAGCAGG + Intergenic
1195431938 X:104798715-104798737 CAGTGAAAGAAGATGGAAATGGG - Intronic
1196413512 X:115445666-115445688 CAGTGTGAGAAAATTTAAAAGGG + Intergenic
1196950069 X:120868232-120868254 CACTGTGAGAAAAGGGAGGAAGG - Intergenic
1198160916 X:134007320-134007342 CAATGGGAGAAGAAAGAAGATGG + Intergenic
1198333347 X:135642711-135642733 CATTAAGAGAAGATGGAAAATGG - Intergenic
1199194478 X:145011251-145011273 CAGTTTGACAAGATGGACGTTGG + Intergenic
1199280034 X:145990969-145990991 CAGGGAGAGAACATGCAAGATGG - Intergenic
1199280343 X:145993391-145993413 CAGGGGGAGAACATGCAAGATGG - Intergenic
1201100711 Y:10669582-10669604 CAGTGTGAGATGATGTTAAAAGG - Intergenic
1201146605 Y:11068095-11068117 GAGAGGGAGAAGAAGGAAGAGGG + Intergenic
1201596738 Y:15678894-15678916 CAGTATGAGATGTTGGAAAAGGG + Intergenic