ID: 945588115

View in Genome Browser
Species Human (GRCh38)
Location 2:211692676-211692698
Sequence CTTTATAAGAGGAAGGTAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 782
Summary {0: 1, 1: 3, 2: 26, 3: 174, 4: 578}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945588115_945588119 19 Left 945588115 2:211692676-211692698 CCCTCTACCTTCCTCTTATAAAG 0: 1
1: 3
2: 26
3: 174
4: 578
Right 945588119 2:211692718-211692740 TAACCCACTCAAATAACTTTAGG 0: 1
1: 0
2: 0
3: 11
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945588115 Original CRISPR CTTTATAAGAGGAAGGTAGA GGG (reversed) Intronic
900607086 1:3528606-3528628 CCTTATAAGAGGGAGGCAGGAGG + Intronic
900779448 1:4608225-4608247 CTTTTTAAGAGAGAGGCAGAGGG - Intergenic
901395867 1:8981151-8981173 CCTTATAAGAGAAAAGCAGACGG - Intergenic
901563305 1:10090511-10090533 CTGTAAAAGAGGAGGGAAGATGG + Intronic
901866740 1:12111491-12111513 CTTTAAAAGAGGGAGGCAGGAGG + Intronic
902067105 1:13697776-13697798 CATTATGAGAGGGAGGCAGAGGG + Intergenic
902408136 1:16197560-16197582 GTTTATCAGAGGGAGGCAGAGGG + Intergenic
902567259 1:17320250-17320272 CTTTATAAGAGGGAGGCAGGAGG - Intronic
902574218 1:17367146-17367168 CCTTATAAGGGGGAGGCAGAGGG - Intergenic
902753238 1:18532017-18532039 CCTTATAAGAGGGAGGCAGAGGG + Intergenic
903001751 1:20271153-20271175 ATGTATAAGAGGAAGATACAAGG - Intergenic
903041176 1:20531890-20531912 CCTTATAAGAAGGAGGCAGAAGG + Intergenic
903608265 1:24591053-24591075 CTTTATCTGAGGAAGGTAAAAGG + Intronic
904070709 1:27794644-27794666 GATCATAATAGGAAGGTAGACGG - Intronic
904879217 1:33682221-33682243 CTTTGTAAGAAGAAGACAGAGGG - Intronic
904968559 1:34400551-34400573 CCTTATAAGAGAGAGGCAGAGGG - Intergenic
904974308 1:34444081-34444103 CCATATTAGAGGAAGGCAGAGGG - Intergenic
904982816 1:34521281-34521303 CCTTATAAGAGGAAGGCAAGAGG - Intergenic
905475963 1:38228240-38228262 CCTTATAAGAGGGAGGCAGAGGG + Intergenic
906896173 1:49774476-49774498 CTTTATATGGGGCAGGTGGAGGG + Intronic
907525385 1:55050932-55050954 CTTTATGAGAGAAAGGCAGAGGG + Intronic
908064239 1:60385352-60385374 CTTTATAAGAGGAAAGCAGGAGG - Intergenic
908423882 1:63986226-63986248 ATTTTTAAAAGGGAGGTAGAGGG - Intronic
908859151 1:68463813-68463835 CCTTATAAGAGGAAAGCAGGAGG - Intergenic
909808484 1:79901703-79901725 CATTATAAGAGGAAAGGAGGAGG + Intergenic
910450628 1:87340229-87340251 CTTTATTAGAGCAAGTTGGAAGG + Intronic
910498164 1:87856728-87856750 CCTTATAAGAGGAAAGCAGAGGG - Intergenic
910577993 1:88788860-88788882 TTTTATAACAGGAAGGCTGAGGG - Intronic
910939321 1:92516231-92516253 CTTTATAACAGCCAGGAAGAAGG - Intronic
912477130 1:109945971-109945993 CCTTATAAGAGGAAGGCAGGGGG - Intergenic
912668713 1:111606378-111606400 TTTTATAAGAAGAAGGTAGCTGG + Intronic
912999114 1:114562157-114562179 CTTTTTAAGAGGGAGGTAGAAGG - Intergenic
914334424 1:146701531-146701553 CCTTATATGAGGGAGGCAGAGGG - Intergenic
916698090 1:167261464-167261486 CTTTTTAAGAGCAAGATATAGGG + Intronic
916757108 1:167782755-167782777 CCTTAGAAGAGGGAGGCAGAAGG + Intronic
916801885 1:168223572-168223594 CCTTATAAGAGGGAAGCAGAGGG - Intergenic
916841041 1:168601015-168601037 ATTTATAGGAGGAAGGCATATGG - Intergenic
917063479 1:171066305-171066327 CTTTATAAGAGGAATATGGGAGG + Intergenic
917083795 1:171285179-171285201 CTTTATAAAAGGAAGATTGGGGG - Intronic
917710735 1:177681371-177681393 TTTTAAAAGATGAAGGCAGAGGG + Intergenic
917902322 1:179554907-179554929 CCTTATAAGAGGGAGGCAAATGG + Intronic
918338333 1:183544840-183544862 TTTTTTAACAGGTAGGTAGAGGG - Intronic
918477119 1:184936728-184936750 CTTTATAAGAGAAAAGCAGAGGG - Intronic
918743909 1:188173770-188173792 CCTTATAAGAGGGAGGCAGATGG + Intergenic
918768967 1:188528570-188528592 CTTTATAAGAGGAAGGCCGAGGG - Intergenic
918861488 1:189831993-189832015 CCTTATAAGATGAAGGCAGAGGG - Intergenic
919294573 1:195679674-195679696 CCTTACAAGAGGAAGGAAGAAGG + Intergenic
919396692 1:197058618-197058640 TTTTATAAAAGGGAGGCAGAGGG - Intronic
919410096 1:197232037-197232059 CCTTATAAGAGAAAGGTAGGAGG + Intergenic
919605071 1:199671843-199671865 CTATACAAGAGAAAGGAAGAAGG + Intergenic
919817716 1:201451940-201451962 CTTTATTAGAGGAAAGCACATGG + Intergenic
920818566 1:209358500-209358522 CCTTATAAGAAGAAGTTAGGAGG - Intergenic
921474202 1:215586352-215586374 ATTTGTAATAGGAAGGTGGATGG + Intronic
921546206 1:216478009-216478031 CTTTATAAGAAGGAGGCAGAGGG + Intergenic
921637286 1:217511651-217511673 CTTTAACAGAAGAAGGTATATGG - Intronic
922108675 1:222535711-222535733 GTTTAGAAGAGGAAGGTAGGGGG - Intronic
922546542 1:226462087-226462109 CTTCATAAGAGGGAGGCAGAGGG + Intergenic
922597148 1:226822914-226822936 CCTTATAAGAGGGAGGCAGGAGG - Intergenic
922858359 1:228794544-228794566 CTTTATAAGAGGGAGGAAGGGGG - Intergenic
923188657 1:231598483-231598505 CTTTATCATAGGTATGTAGAGGG - Intronic
923773906 1:236961358-236961380 CCTTATAAGAGGGAGGCTGAGGG - Intergenic
923941920 1:238837392-238837414 CTTCATAATAGGAAGAAAGAAGG - Intergenic
924552293 1:245089917-245089939 CTTTTGGAGAGGAAGGTAGTAGG + Intronic
1063810369 10:9698030-9698052 CCTTATAAGAGGGAGGTATGTGG + Intergenic
1064515581 10:16144271-16144293 CTAAGTAAGAGGAAGGGAGAAGG - Intergenic
1064884315 10:20092775-20092797 CTTTATAAGAGGAAGGGAAAGGG + Intronic
1065168056 10:23001423-23001445 CTTTATAAGAGGGGGACAGAAGG - Intronic
1065341652 10:24712259-24712281 CCTTACAAGAGAAAGGCAGATGG + Intronic
1065620496 10:27576207-27576229 CCTTATAAGAGGTAGGCAGAGGG - Intergenic
1065694969 10:28371351-28371373 TCTTATAAGAGGGAGGCAGAGGG - Intergenic
1065808237 10:29415483-29415505 CGTGGTAAGAGGAAGGTAGAAGG - Intergenic
1065984066 10:30931950-30931972 ATTTATAAGGAGAAGGTAGAGGG + Intronic
1066078157 10:31901894-31901916 CTTTATAAGAGAGAGGTAGAGGG - Intronic
1067092707 10:43277431-43277453 CTTTATGATGGGAAGGAAGAAGG - Intergenic
1068644632 10:59451721-59451743 CTTTATAAAAGGGAGGCAGAAGG + Intergenic
1069062319 10:63906892-63906914 CCTTATAAGAGGAAGGCAGAAGG + Intergenic
1069565999 10:69463972-69463994 CTTTATAAGAGAAAGGCAGAGGG + Intronic
1069869524 10:71524688-71524710 CCTTATAAGAAGCAGGTAGGAGG + Intronic
1069902083 10:71712175-71712197 CCTTACAAGAGAAAGGCAGAGGG - Exonic
1070342870 10:75513748-75513770 GTTTGTAAGAGGCAGGCAGAAGG - Intronic
1070525962 10:77296193-77296215 CTTTATAAAAGGGAGGTAGAGGG + Intronic
1070566539 10:77607542-77607564 CCTTCAAAGAGGGAGGTAGAGGG + Intronic
1070997384 10:80797539-80797561 CTGAATAAGAGGGAGGCAGAAGG - Intergenic
1071070672 10:81689868-81689890 CCTTACAAGAGAAAGGCAGAGGG + Intergenic
1071459204 10:85876404-85876426 CTTTATAAGAGGAACACAAAGGG - Intronic
1071701556 10:87944161-87944183 CTTTATCAGATTAAGGTATAAGG - Intronic
1071867783 10:89755590-89755612 CTTTAAAAGAGGAAAGAAAAGGG - Intronic
1072093446 10:92152495-92152517 GTTTAAAAGGGGAAGGTGGAAGG - Intronic
1073474219 10:103742376-103742398 TCTTATAAGAGAAAGGCAGAAGG - Intronic
1073857830 10:107697631-107697653 CATTAAAAGAGGAAGGGAGGAGG - Intergenic
1074912827 10:117927247-117927269 CCTTATAAGACGGAGGCAGAGGG - Intergenic
1074957290 10:118404624-118404646 CTTGATAAATGGAAGGTGGAGGG + Intergenic
1075284205 10:121169018-121169040 CTTTAGGAAAGGCAGGTAGAGGG + Intergenic
1075412303 10:122237563-122237585 ATTTATAAGTGGCAGGAAGAGGG - Intronic
1075512600 10:123084428-123084450 CCTTATAGGAGGGAGGGAGAGGG + Intergenic
1075596709 10:123736453-123736475 CTTTAGGAGAGGTAGGTATATGG + Intronic
1075851951 10:125596284-125596306 CCTTATAAGAGGAGAGAAGAAGG + Intronic
1075955112 10:126516938-126516960 CCTTACAAGAGGGAGGAAGAAGG - Intronic
1076074646 10:127523455-127523477 CCTTATAAGAGGGAGGCAGGAGG + Intergenic
1076413406 10:130267625-130267647 CTTTATAAGAGGGAGACAGAGGG - Intergenic
1076484193 10:130805250-130805272 GTTTATCAGAGGAAGCTAGGTGG - Intergenic
1076565267 10:131394249-131394271 CCTCATAAGAGGGAGGCAGAAGG - Intergenic
1077933545 11:6758721-6758743 CCTTATAAGAGGGAGGTAGCAGG - Intergenic
1078479999 11:11667433-11667455 TCTTACAAGAGGAAGGCAGAGGG - Intergenic
1079590893 11:22181295-22181317 CTTCTTAAGGGGAAGATAGAGGG - Intergenic
1079943630 11:26713977-26713999 CCTTATATGAGGGAGGTAGTGGG - Intronic
1080687834 11:34530132-34530154 CCTTATAAGAGTGAGGCAGAGGG + Intergenic
1081208978 11:40308559-40308581 CCTTATAAGAGAAAGGCAGGAGG + Intronic
1081276341 11:41153886-41153908 CTTTATAAAAGGAGGGTAAAGGG + Intronic
1081632698 11:44700628-44700650 CTCTGTAAGAGGATGGTAGGAGG + Intergenic
1081706642 11:45185906-45185928 CTTAATAAGAGGGAGGTGGGAGG + Intronic
1082036834 11:47651864-47651886 CTTTATAAAAGGGAGGCAGGAGG - Intergenic
1082727384 11:56752418-56752440 CCTTACAAGAGGGAGGCAGAGGG + Intergenic
1082952632 11:58833497-58833519 CCTTCTAAGAGGGAGGCAGAGGG + Intergenic
1083708123 11:64530557-64530579 CCTTCTAAGAGGGAGGTGGAGGG + Intergenic
1084052648 11:66610460-66610482 CCTTGTAAGAGGGAGGCAGAAGG - Intergenic
1084487456 11:69457309-69457331 CTTCATAAGAGGAAGGCAGCGGG + Intergenic
1084676841 11:70640271-70640293 CTTTATAAGAGAGAGGCAGGGGG + Intronic
1084712725 11:70853900-70853922 CTTTATAAGAAGAAGGAGGGGGG - Intronic
1084724167 11:70929636-70929658 CCTTATAAGAGGAAGGCAGAGGG - Intronic
1086037299 11:82432068-82432090 CCTTATAAGAGAAAGGCAGAGGG + Intergenic
1086374985 11:86190975-86190997 ATGTATAAGAAGCAGGTAGAAGG - Intergenic
1086926029 11:92641603-92641625 CCTTATAAGAGAAAGGCAGAGGG - Intronic
1088141805 11:106625826-106625848 TCTTATAAGAGGAAGGCAGGAGG - Intergenic
1088156822 11:106815736-106815758 CCTCACAAGAGGAAGGCAGAGGG + Intronic
1088620081 11:111672592-111672614 CACTAGAAGAGGAAGGAAGATGG + Intronic
1088770759 11:113033678-113033700 TTTTATAAGAGTAAGGAAGCTGG - Intronic
1088879364 11:113961518-113961540 CCTTATTAGAGGAAGGCAGAAGG - Intergenic
1088903823 11:114138989-114139011 CCTTGTAAGAGGAAGGGAGTAGG - Intronic
1091639408 12:2223683-2223705 CTCTATAAGAGGAAGGATAATGG - Intronic
1091690247 12:2591337-2591359 CTGTATAAGATGAAGGTGAAGGG - Intronic
1092096478 12:5846756-5846778 CCCTATAAGAGAAAGGCAGAAGG - Intronic
1092144132 12:6202924-6202946 CTTCATCAGAGGCAGGAAGATGG + Intronic
1092850685 12:12623858-12623880 CCTTATAAGACTAAGGTAGAGGG + Intronic
1092907189 12:13112053-13112075 CCTTATGAGAGGGAGGCAGAGGG + Intronic
1093378596 12:18461996-18462018 CCTTATAAGAGGGAGGCAGATGG - Intronic
1093404888 12:18792273-18792295 CCTTCTAAGAGGAAGGCAGGAGG - Intergenic
1093505363 12:19858956-19858978 CTTTATAAGAGAGAGGCAGAGGG + Intergenic
1093929033 12:24936811-24936833 CTTTATAAGAGAGAGGCAGAGGG - Intronic
1094080250 12:26526910-26526932 ATTAATAAGAGGAATGCAGATGG + Intronic
1094148797 12:27258961-27258983 CTTTCTGAGAGGAAGAGAGATGG - Intronic
1095158023 12:38882205-38882227 ATATATAAGAGGAAGGCAGAGGG + Intronic
1095464902 12:42480183-42480205 CTTAATAAGAGACAGGTAGCAGG - Intronic
1096298797 12:50407495-50407517 TTTTAAAAGAGGAATGAAGATGG + Intronic
1096635986 12:52959947-52959969 CCTTATAAGAAGGAGGCAGAAGG - Intergenic
1096998598 12:55856594-55856616 CTTTATAAGACAGAGGCAGAGGG - Intergenic
1097350052 12:58538754-58538776 CCTTCTAAGAAGAAGGTAGTGGG + Intergenic
1097638441 12:62149903-62149925 CTTTATAAAAGGGAGATGGATGG - Intronic
1097712603 12:62933245-62933267 CTTTATAGGATGATGGGAGAAGG + Intronic
1098569677 12:71974509-71974531 CCTTATCAGAGGGAGGCAGAAGG - Intronic
1098591450 12:72218765-72218787 CCTTATAAGAAGAAGGGAGAGGG - Intronic
1098788739 12:74793207-74793229 TTTTTTAAGAGGAAAGGAGATGG - Intergenic
1098909890 12:76198251-76198273 CCTTACAAGAGGGAGGCAGAGGG - Intergenic
1098936089 12:76480976-76480998 CCTTATAAGAGGAAGCAAGAGGG + Intronic
1098965522 12:76783815-76783837 CCATATAAGAGGGAGGTGGAGGG + Intronic
1099021423 12:77409333-77409355 TTTTATAAGAGGAAGGAAACAGG + Intergenic
1099092696 12:78333511-78333533 CTATATAAGAGAAAGATAGAGGG + Intergenic
1099724246 12:86404480-86404502 TCTTATAAGAGGGAGGGAGAGGG + Intronic
1099920729 12:88953963-88953985 CTTTAGAAAAGGAAGGAATAAGG - Intergenic
1100143837 12:91653085-91653107 TTTTGTAAGAGCAAGGTGGAAGG - Intergenic
1100660075 12:96687174-96687196 CCTTATAAGAGAAAGGCAGGAGG - Intronic
1100673712 12:96844269-96844291 CCTTATGAGAGGGAGCTAGAGGG + Intronic
1100934216 12:99644943-99644965 CTTTGTAAGAGAAAGGCAGCAGG - Intronic
1100939356 12:99708683-99708705 CCTTATAAGAGGGAGGTAGAGGG - Intronic
1101054296 12:100896285-100896307 CCTTATAAGAGAGAGGCAGAGGG + Intronic
1102448180 12:113019816-113019838 CCTTATAAGAGGGAGGAAGTGGG - Intergenic
1102772107 12:115486938-115486960 CTTTATAAGAGAGAGGCAGGAGG + Intergenic
1102784738 12:115595227-115595249 CTTAATAAGAGGAAGAGAAATGG + Intergenic
1102919558 12:116781645-116781667 CCTTATAAGAGGAAGGCAGGAGG - Intronic
1103061753 12:117863896-117863918 CTGTATAAGAGGGAAGTAGGAGG - Intronic
1103951359 12:124553205-124553227 CTTTATAAGAAGGAGGCAGGAGG - Intronic
1103970809 12:124670303-124670325 CTTTATAAGAGGGAGGCAGGAGG - Intergenic
1104042555 12:125139960-125139982 CCTCATAAGAGGAAGTAAGATGG - Intronic
1104063961 12:125291135-125291157 CTTTATGAGAAGAGGTTAGAAGG + Intronic
1104122382 12:125811756-125811778 CCTTAGAGGAGGAAGGTAGGAGG + Intergenic
1104289074 12:127451984-127452006 CATTATAAGAAGGAGGCAGAAGG - Intergenic
1104368303 12:128198131-128198153 CTTTACAAGAGGGAGGCAGGTGG + Intergenic
1104404546 12:128506641-128506663 CATTTTCAGAGGAAGGGAGACGG - Intronic
1105964681 13:25373194-25373216 TTTGACATGAGGAAGGTAGAGGG + Intronic
1106074336 13:26444586-26444608 CCTTATAAGAGAGAGGTGGAAGG + Intergenic
1106528847 13:30568606-30568628 CCTTACAAAAGAAAGGTAGAGGG + Intronic
1106578136 13:30994814-30994836 CTCTTCAGGAGGAAGGTAGAGGG + Intergenic
1106730053 13:32532024-32532046 CTTAATAAGAGGGAGGCAGGAGG - Intronic
1107177930 13:37421764-37421786 CTTTATAAAAGGGAGTCAGAAGG - Intergenic
1107631829 13:42350621-42350643 CCTTATAAGAGGGAAGCAGAGGG + Intergenic
1107640532 13:42438724-42438746 AATCATAAGAGGAAGGTACAGGG + Intergenic
1107679497 13:42833664-42833686 TCTTATAAGAGGAAAGTAGAGGG + Intergenic
1107712040 13:43159866-43159888 CTTTATAAGATGTAGGTTCAGGG - Intergenic
1107778687 13:43875955-43875977 CCTTATAAGAGAAAGGTAGAGGG + Intronic
1107990807 13:45817561-45817583 CCTTATACGAGGGAGGCAGAGGG + Intronic
1108121280 13:47189909-47189931 CCTTACAAGAGGTAGGCAGAGGG + Intergenic
1108133427 13:47328832-47328854 CCTTATTATAGGAAGGCAGAAGG - Intergenic
1108167129 13:47705140-47705162 CTTTATGAGAGAACGGCAGAGGG - Intergenic
1108404630 13:50087766-50087788 TTTTATAAAGGGAATGTAGATGG - Intronic
1108557386 13:51607926-51607948 CTTTGTAAGAGGGAGGCAGAAGG + Intronic
1108592310 13:51922874-51922896 GTTTCTAAGAGGGAGGTAGGAGG - Intergenic
1108870351 13:54976855-54976877 CTTTTTAGGAGGAAGAGAGATGG + Intergenic
1109018656 13:57055353-57055375 CTTTATAAGAGAAAAGCAGAGGG + Intergenic
1110441985 13:75536539-75536561 CCTTATAAGAGGGAGGAAAAAGG + Intronic
1110464247 13:75782814-75782836 CCTTATGAGAGGGAGGAAGAGGG - Intronic
1110802929 13:79721304-79721326 TCTTATAAGGGGAAGGCAGAAGG + Intergenic
1110830611 13:80026211-80026233 CCTTATAGGAGGAAAGCAGAGGG + Intergenic
1110968852 13:81735603-81735625 CCTTGTAAGAGAAAGGTAGAGGG + Intergenic
1111643218 13:90996902-90996924 CCTTATAAAAGAAAGGCAGAGGG + Intergenic
1111767594 13:92552468-92552490 CTTTGTAAGGGGAAGATAAATGG + Intronic
1112175848 13:97023216-97023238 CCTTATAAGAGGGAGGCAGCAGG + Intergenic
1112598794 13:100834267-100834289 CTTCATAAGAGAGAGGGAGAGGG - Intergenic
1112834493 13:103497633-103497655 CTTTATAAGAGGGAGGTGGAAGG - Intergenic
1113816680 13:113176463-113176485 CCTTATAAGAGGAAGAGAGCCGG + Intergenic
1114151428 14:20044225-20044247 CTTTTTAAGTGGAAGTGAGATGG + Intergenic
1114287667 14:21260394-21260416 CTTTATGTGATTAAGGTAGAAGG + Intronic
1115936156 14:38555059-38555081 CCTTATAAGAGGGAGGCAGGAGG + Intergenic
1116233936 14:42253769-42253791 CCTTATAAGAGAAATGCAGAGGG - Intergenic
1116290608 14:43033202-43033224 TTCTATAAGAGCAAAGTAGAGGG + Intergenic
1116394775 14:44434382-44434404 CTTTATAAGAGCACTGTGGAAGG + Intergenic
1116539529 14:46082169-46082191 CCTTATAAGAGGGAGGTAGGAGG + Intergenic
1117105952 14:52397200-52397222 TTTTATAAGAGGGAGGTAGGTGG + Intergenic
1117626861 14:57649456-57649478 CTTTATAAGAAGCAGGCAGGAGG - Intronic
1117873545 14:60225612-60225634 CCTTATAAGAGGAAGGCAGGAGG - Intergenic
1119133048 14:72192337-72192359 CTTTAGAAGAGGGAGAAAGATGG + Intronic
1119416051 14:74470160-74470182 TTTTAAAAAGGGAAGGTAGAAGG - Intergenic
1119677673 14:76568001-76568023 CCTTATAAGAGAAAGGCAGGAGG + Intergenic
1119689604 14:76661263-76661285 CCTTATAAGAGGGAAGCAGAGGG - Intergenic
1120039659 14:79738279-79738301 CCTTATAAGAGTGAGGCAGAGGG + Intronic
1120219822 14:81719547-81719569 CCTTATAAGAGGAAGGCGGGTGG - Intergenic
1120363023 14:83530185-83530207 CTGTATCATAGGAAGATAGAGGG - Intergenic
1120453797 14:84705260-84705282 GATTATATGAGGAAGGTGGAAGG + Intergenic
1121544674 14:94754696-94754718 CCTCATAAGAGAAAGATAGAGGG - Intergenic
1121612389 14:95290429-95290451 CTTTATAAGAGGAAGACAGAGGG + Intronic
1121846338 14:97175465-97175487 CTGTATTTGAGGAACGTAGAAGG + Intergenic
1121880853 14:97499256-97499278 ATTTAGAAGAAGAAGGAAGAAGG + Intergenic
1121902223 14:97704081-97704103 CCTTATAAGAGGAAAGCAGGAGG - Intergenic
1121917041 14:97844709-97844731 CTTTGTAAAAGGAAGGAAGGAGG + Intergenic
1121944070 14:98102544-98102566 CCTTATAAGACAAAGGCAGAGGG - Intergenic
1122483064 14:102060242-102060264 CCTTATAAGAGAAAGGCAGAAGG + Intergenic
1123539695 15:21275764-21275786 CTTTATAAGAGGGATTGAGAAGG - Intergenic
1125214824 15:37259550-37259572 CCTTACAAGAGGGAGGCAGAAGG - Intergenic
1125269997 15:37928532-37928554 TTTTATAAGAGGGAGGCAGGAGG + Intronic
1125425279 15:39542599-39542621 CTTATAAAGAGGAAGGCAGAAGG - Intergenic
1126074971 15:44900384-44900406 CCTTGTAAGAGGGAGATAGAGGG + Intergenic
1126083393 15:44987432-44987454 CCTTATAAGAGGGAGATAGAGGG - Intergenic
1126152956 15:45539640-45539662 CTCAATAATAGGAAGGGAGAAGG - Intergenic
1126174147 15:45719963-45719985 CTTGGTAAGAGAAAGGTAAAGGG + Intergenic
1126382496 15:48063687-48063709 CCTTATAAGAAAAAGGCAGAGGG + Intergenic
1127067839 15:55258771-55258793 TTTAATAAGAGGAAACTAGATGG - Intronic
1127715559 15:61645775-61645797 CCTTATAAAAGAAAGGCAGAGGG + Intergenic
1128612526 15:69085315-69085337 CCTTATAAGAGGGAGCTAGGAGG + Intergenic
1128878859 15:71224806-71224828 CCTTATAAGTGGGAGGTAGGAGG - Intronic
1129118934 15:73383183-73383205 CCTTATAAGAGGGAGACAGAGGG + Intergenic
1129542127 15:76359000-76359022 CTTTATAAAATGAGGGTAGATGG + Intronic
1129702934 15:77778239-77778261 CCATATAAGAGGGAGGCAGAGGG - Intronic
1130201698 15:81835556-81835578 CTTTAGGAGACGGAGGTAGAAGG + Intergenic
1130799421 15:87246511-87246533 CTTTAAAAGAAGAATCTAGAAGG - Intergenic
1130977311 15:88787372-88787394 CCTTATAAGAGAGAGGTAGAGGG - Intergenic
1131510324 15:93046212-93046234 CTTTATAAGAAGGAGGCAGAGGG + Intronic
1131723462 15:95196817-95196839 CATTATGAAAGGCAGGTAGAAGG + Intergenic
1132248022 15:100312225-100312247 CTTTAGATGAGGGAGGCAGAGGG + Intronic
1202948006 15_KI270727v1_random:2930-2952 CTTTATAAGAGGGATTGAGAAGG - Intergenic
1132906162 16:2283846-2283868 CCTTATAAGAGAAATGCAGAAGG + Intronic
1133652883 16:7829601-7829623 CTTTAAAAGAGGAAGGTGGGTGG - Intergenic
1133703266 16:8329241-8329263 CTTTATAGGAGGAGGGGAGATGG + Intergenic
1134636604 16:15796729-15796751 CCTTATAAGAGAGAGGTAGGGGG + Intronic
1135085061 16:19468627-19468649 CTTTATAAGAGGCAGGCAGGAGG + Intronic
1135408249 16:22213833-22213855 CCTTATAAAAAGGAGGTAGAAGG - Intronic
1135550595 16:23395117-23395139 CTTTATAAGAGGTACACAGATGG + Intronic
1135913651 16:26583557-26583579 TATTATAAGAGGAAGACAGAGGG - Intergenic
1136276285 16:29181070-29181092 CCTTGGAAGAGGAAGGCAGAAGG + Intergenic
1137801422 16:51265652-51265674 CCTTATAAGAGAAAGGTGGAGGG - Intergenic
1138624753 16:58241909-58241931 CCTTACAAGAGGGAGGCAGAAGG - Intronic
1139509656 16:67419876-67419898 CCTTATAAGAGGGAGGCAGGAGG + Intergenic
1139999194 16:71009701-71009723 CCTTATATGAGGGAGGCAGAGGG + Intronic
1140020260 16:71231540-71231562 CTATAGAAGAGCAAGGGAGAGGG + Intergenic
1140839591 16:78826581-78826603 CTTCATAGCAGAAAGGTAGAGGG - Intronic
1140997253 16:80272910-80272932 CTTCATAAGAGAGAGGTAAAGGG + Intergenic
1140999426 16:80294760-80294782 CTTTGTAAGAGGAAGGCAGGAGG - Intergenic
1141005832 16:80350703-80350725 CTTTATAAGAGGGAGGCAGGAGG - Intergenic
1141018710 16:80474815-80474837 CTTTATAAGTGGAAGAAGGAAGG - Intergenic
1141191065 16:81824925-81824947 CTTTAAAAGAGGAAGGTAGGAGG + Intronic
1141361417 16:83398422-83398444 CTTTGTAACAGAAAGGCAGAGGG - Intronic
1141955512 16:87368644-87368666 CTTTATAAGAGGAAGTGTGCTGG + Intronic
1142080666 16:88147129-88147151 CCTTGGAAGAGGAAGGCAGAAGG + Intergenic
1142104956 16:88297698-88297720 CCTCATAAGAGGGAGGCAGAGGG - Intergenic
1143366362 17:6411172-6411194 CCTTATAAGACGGAGGCAGAAGG + Intronic
1144335699 17:14267302-14267324 CCTTATATGAGAAAGGTAGAGGG - Intergenic
1144837668 17:18165524-18165546 CCTCATAAGAGGAAAGCAGAAGG - Intronic
1145238796 17:21227446-21227468 CTTTATACGAGGGAGGCGGAGGG - Intergenic
1145275954 17:21430606-21430628 CTTTATCAGAGGGAGGCAGAGGG + Intergenic
1145313800 17:21716519-21716541 CTTTATCAGAGGGAGGCAGAGGG + Intergenic
1145712242 17:26988493-26988515 CTTTATCAGAGGGAGGCAGAGGG + Intergenic
1145889172 17:28402946-28402968 CTTTATAAGAGGAAAGCAGACGG + Exonic
1146290189 17:31601170-31601192 CTTTATAAGAGGGAGGCAGGAGG + Intergenic
1146406116 17:32539643-32539665 CCTTATAAAAGAAAGGTAGAGGG - Intronic
1146482002 17:33212294-33212316 CCTTGTAAGAGGGAGGCAGAAGG + Intronic
1146510988 17:33448477-33448499 CCTTATAAGAGAGAGGCAGAGGG + Intronic
1146959914 17:36965386-36965408 CCTTATAAGAGGAAGGCAATAGG - Intronic
1147020345 17:37526759-37526781 CCTTAGAAGGGGAAGGTAGGAGG - Intronic
1147020498 17:37528321-37528343 CCTTATAAGGGGAAGGTAGGAGG - Intronic
1147035694 17:37678650-37678672 CCTTATAAGAGGGAGGAAGAGGG + Intergenic
1148481427 17:47961942-47961964 CCTTATAAGAGAGAGGTGGAGGG - Intergenic
1149018215 17:51933305-51933327 CTTTATAAGAGAAATGTAGGAGG + Intronic
1149179960 17:53923976-53923998 TCTTATAAGAGGCAGGTAAAGGG + Intergenic
1149381444 17:56098052-56098074 CTTTATAAGAGAGAAGCAGAAGG + Intergenic
1149911971 17:60574997-60575019 CTTTGTAAGAGGAAAGCAGAAGG + Intronic
1150838178 17:68583498-68583520 CCTTATATGAGGAATGCAGAAGG - Intronic
1151192478 17:72408505-72408527 CTTTATAAGAGAGAGGCAGAGGG + Intergenic
1151271844 17:73002918-73002940 CCTTATAAGAGGGAGGCAGAGGG - Intronic
1151410153 17:73919851-73919873 CGTCATAAGAGAGAGGTAGAGGG + Intergenic
1151959351 17:77397353-77397375 CCTTATAGGAGAAAGGCAGAAGG - Intronic
1152154933 17:78626796-78626818 CCTTATCAGAGAAAGGCAGAGGG + Intergenic
1152174622 17:78779632-78779654 CTTAATAAGAGGGAGGTAGGAGG + Intronic
1152260452 17:79263930-79263952 CTTTATAAGAGAAAGGAGGGAGG + Intronic
1153304577 18:3620169-3620191 CCTTATAAGAGGGAGGCAGGAGG + Intronic
1153685956 18:7545542-7545564 CTTTATAAGAGAGAGGCAGAGGG - Intergenic
1153724827 18:7943773-7943795 CTATTTATGAGGAAGGCAGAAGG - Intronic
1153780518 18:8491430-8491452 CCTTATGAGAGGAAGGCAGGAGG + Intergenic
1154227193 18:12516169-12516191 CTTTATCAGAGGAAGGAGCAGGG - Intronic
1155581626 18:27314623-27314645 TATTGTAAGAGGAAGGAAGAAGG + Intergenic
1155712768 18:28903454-28903476 CTTTAAAAGATGAAGCTAGAAGG + Intergenic
1156093088 18:33494819-33494841 CCTTATAAGAAGCAGGCAGAGGG - Intergenic
1156271534 18:35538266-35538288 CTTTATGAGAGGGAGGCAGTGGG - Intergenic
1156299243 18:35821188-35821210 TTTTATAAGAGGGAGGCAGACGG + Intergenic
1156390484 18:36645574-36645596 CTTATAAAGAGGTAGGTAGAGGG - Intronic
1156949791 18:42881104-42881126 GTTTAAAAGAGGTAGGAAGATGG - Intronic
1157989682 18:52479589-52479611 CTTAGTGAGAGGAAGGGAGACGG - Intronic
1158489194 18:57894790-57894812 CTTTTTAAGAGAAAAGCAGAGGG + Intergenic
1158492012 18:57918601-57918623 CCTTACAAGAGGAGGGCAGAGGG - Intergenic
1159180083 18:64891973-64891995 CCTTACAAGAGGAAGGCAGGGGG + Intergenic
1159299693 18:66547294-66547316 CTTTATGCAAGGAAGGAAGAGGG + Intronic
1159789913 18:72765322-72765344 CTTTTTAAGAGGAAGCAACAAGG - Intronic
1160417522 18:78721439-78721461 CTTCAGAAGGGGAAGGGAGAGGG + Intergenic
1160592968 18:79954150-79954172 CTTTGTAAGAGGGAGGCAGAAGG + Intergenic
1161848757 19:6727780-6727802 CTTTATAAGAGGGAGGTGGGAGG - Intronic
1162911239 19:13848926-13848948 TTTTCCAAGTGGAAGGTAGAGGG - Intergenic
1164500342 19:28814455-28814477 CTTTATAAGAAGAGGAGAGAGGG - Intergenic
1165590990 19:36969709-36969731 CCTTAAAAGAGGAAGGCAGGAGG - Intronic
1167582756 19:50356126-50356148 CCTTATAAGAGGGAGGCAGAGGG - Intronic
1167663005 19:50807422-50807444 CTGTATGAGAGGGAGATAGATGG + Intergenic
1167800327 19:51736460-51736482 CCTTATAAGAGTGAGGCAGAGGG + Intergenic
1168050444 19:53825760-53825782 CTTTATAAGAAGAAGACAGGAGG + Intergenic
1168676384 19:58280919-58280941 CTTTATAAGAGGTAGACAAAGGG - Intronic
924993407 2:336032-336054 CTTTATGAAAGGGAGGCAGAGGG + Intergenic
926304439 2:11627922-11627944 ATTAATAAGATGAAGGGAGAGGG + Intronic
926552797 2:14320265-14320287 CTTTATGAGAGGGAGGCATATGG - Intergenic
926820996 2:16851735-16851757 CCTTATAAGAGGCAGGCAGAAGG - Intergenic
927987195 2:27420333-27420355 CCATGTAAGAGGAAGGCAGAGGG - Intergenic
928091848 2:28379414-28379436 CCTTATAAGAGTGGGGTAGAGGG - Intergenic
928600241 2:32897354-32897376 CCTTATAAGAGAGAGGCAGAGGG + Intergenic
928681070 2:33702653-33702675 ACTTATAATAGGAAGGTGGAGGG - Intergenic
928846381 2:35678366-35678388 ACTTATAAGAGAAAGGTGGAAGG - Intergenic
928945123 2:36765197-36765219 CTTTGTAAAAGGAAGGCAGAGGG + Intronic
929195650 2:39181679-39181701 CCTTATAAGAAGAGGGAAGATGG + Intronic
931386126 2:61799083-61799105 CTTTGTAAGAGATAGGCAGAGGG + Intergenic
932145562 2:69313054-69313076 CATTGTAAGAGGGAGGCAGAAGG - Intergenic
932281277 2:70494188-70494210 CTTTATAAGAGGATGGGAAGAGG - Intronic
932484074 2:72070632-72070654 CCTTATAAGAGGCAGGCAGAGGG + Intergenic
932911886 2:75814996-75815018 CTTTATAAGAGGAAGACAGAGGG - Intergenic
933150536 2:78909669-78909691 CCTTATAAGAGGGAGGTACAAGG + Intergenic
933203791 2:79481799-79481821 CTTTAAAAGAAGAAGACAGACGG + Intronic
933328586 2:80869244-80869266 CATTTTAAGAGGAAGTTAGAAGG + Intergenic
933429473 2:82157237-82157259 CCTTATAAAAGGAATGCAGAAGG + Intergenic
933771749 2:85749034-85749056 CTTGAATAGAGGAAGGTAGAAGG + Intergenic
933869868 2:86555775-86555797 CCTTATAAGAGGGATTTAGAGGG - Intronic
934032870 2:88064259-88064281 CCTTATAGGAGGAAGGCAGGAGG - Intergenic
934688441 2:96338602-96338624 CCTTGTAAGAGGAAGGTCGTCGG + Intronic
935689974 2:105722276-105722298 CATTTTAAGAGGGAGGTAGAAGG - Intergenic
935727709 2:106038087-106038109 CCTTATAACAGGGAGGCAGAGGG + Intergenic
936004056 2:108866236-108866258 CCTTATAAAAGGGAGGCAGAAGG - Intronic
936068394 2:109349315-109349337 CTTGATAAAAGGAAGGGAGAAGG - Intronic
936155806 2:110046862-110046884 CTTTTTCAGAGGAAGTTGGAGGG - Intergenic
936188882 2:110324566-110324588 CTTTTTCAGAGGAAGTTGGAGGG + Intergenic
936428526 2:112438406-112438428 CCTTATAAGAGGGATGTAGGAGG - Intergenic
937342018 2:121097132-121097154 CCTTATAAGAGGGAGGCAGGAGG + Intergenic
937426787 2:121806606-121806628 CTTTATGAGAGGGAGGGAGGAGG + Intergenic
940541817 2:155029946-155029968 CCTTATAAGTGGGAGGCAGAGGG + Intergenic
940781634 2:157939652-157939674 CTTTATAGGAGGGAGGGAGAGGG + Intronic
941031071 2:160512336-160512358 CCTTATAAGAGAAAGGCAAAGGG - Intergenic
941063831 2:160878466-160878488 CTTTATAAGAGGGAAGCAGGAGG - Intergenic
941811781 2:169762572-169762594 CCTTATAAGAGTTAGGCAGAGGG - Intronic
942161802 2:173196711-173196733 ATTTCTAATAGGAACGTAGATGG - Intronic
942377412 2:175352029-175352051 CTCTATAAGAGAAAGGCAGAGGG - Intergenic
943712934 2:191117940-191117962 CTGTTCAAGAGGAAGATAGATGG + Intronic
944248398 2:197556721-197556743 CCTTGTAAGAGGAAGTCAGAAGG - Intergenic
944312061 2:198244440-198244462 CCTTATAAGAGGGTGGTAGGAGG + Intronic
944345547 2:198660998-198661020 CTTTATAAGAGAGAGGCAGAGGG - Intergenic
944662876 2:201935757-201935779 CCTTATAAGAGGAAAACAGAGGG + Intergenic
944832646 2:203548433-203548455 CTTTATAAGAGGGAGGCAGGGGG - Intergenic
944840613 2:203620458-203620480 CCTTGTAAGAGAAAGGCAGAGGG + Intergenic
944922349 2:204428710-204428732 CCTTATAAGAGGAAGGCAAGAGG + Intergenic
944931908 2:204528512-204528534 CCTTATAAGAGGGAGGCAGGGGG + Intergenic
945387520 2:209220564-209220586 CTTTATAAGAGGAAGTCAGAGGG + Intergenic
945578185 2:211558372-211558394 CTTTGTAAGTGGGAGGCAGAAGG - Intronic
945588115 2:211692676-211692698 CTTTATAAGAGGAAGGTAGAGGG - Intronic
945695591 2:213099207-213099229 CTTTATAAAAGAAAGGAGGATGG - Intronic
946693772 2:222332139-222332161 CTTTATAAAAGGAAGGTGAAGGG - Intergenic
946893992 2:224304242-224304264 CCTTTTAAGAGGGAGGCAGAGGG + Intergenic
947105411 2:226663356-226663378 GTTTATAAGATGAAGAAAGAAGG - Intergenic
947979052 2:234393306-234393328 CCTTGTAAGAGGGAGGAAGAGGG - Intergenic
948103012 2:235390362-235390384 CTTTATAAGAGGCAGGAGGTCGG - Intergenic
948115183 2:235490207-235490229 CCTTATACGAGGAAGGCAGGAGG - Intergenic
948154557 2:235770976-235770998 CCTTATAATAGGGAGGGAGAAGG + Intronic
948644447 2:239395061-239395083 CTGGAGAAGAGGAAGGTAAAGGG + Intronic
949061104 2:241957905-241957927 CCTTATAAGAGAAAGGAAGAGGG - Intergenic
1168751059 20:281733-281755 CTTTGGAAGAGCAAGGTGGAAGG + Intronic
1168881809 20:1212602-1212624 CCTTATAAGAGGTAGACAGAGGG - Intergenic
1168925169 20:1573453-1573475 CTTTCTAAGAGGACGGCAGAAGG - Intronic
1168929046 20:1606481-1606503 CTTTCTAAGAGGACGGCAGAAGG - Intronic
1169453015 20:5728382-5728404 CCTTATAAGAGGGAGATAGGAGG + Intergenic
1169489965 20:6063058-6063080 TCTTATAAGAGGGAGGAAGAGGG + Intergenic
1169985414 20:11437933-11437955 CTTTGTAAAATGAAGGAAGAAGG + Intergenic
1170059250 20:12242309-12242331 GTTTTAAATAGGAAGGTAGATGG - Intergenic
1170354533 20:15477833-15477855 CCTTATATGAGGAAGGCAGGAGG + Intronic
1172465038 20:35149885-35149907 CCTTATAAGAGAAAAGCAGAAGG - Intergenic
1172475899 20:35237413-35237435 CCTTATAAGAGGAAGGCAGGGGG - Intronic
1173041311 20:39465950-39465972 CTTTATAAGAGACAGGCACAGGG - Intergenic
1173155730 20:40606978-40607000 CTTTATAAGAGGGAGACAGAAGG - Intergenic
1173540133 20:43844772-43844794 CCTTATAAGAGAGAGGCAGAGGG + Intergenic
1174062633 20:47843476-47843498 CTTTATAAGAGGAGGGCAGGAGG + Intergenic
1174075652 20:47934146-47934168 CCTTATAAGAGGACGGAAGGAGG - Intergenic
1174590647 20:51641969-51641991 CTTTATGAGAGGAAAGTGGGAGG + Intronic
1174705377 20:52650001-52650023 CTTAATAATAGGAAGGATGATGG - Intergenic
1174856472 20:54050194-54050216 CTTCATGAGAGGGAGGCAGAAGG - Intronic
1175172490 20:57090345-57090367 CCTTATAAGACGGAGGTAGGAGG + Intergenic
1175347901 20:58295459-58295481 CTTTAGAAGGCCAAGGTAGAAGG + Intergenic
1175821165 20:61909682-61909704 CTTCAGAAGAGGGAGGCAGAGGG - Intronic
1175931112 20:62494170-62494192 CCTTATAAGAGACAGGCAGAGGG - Intergenic
1176513564 21:7766809-7766831 CCTTGTAAGAGGGAGGCAGAGGG + Intronic
1176701132 21:10051651-10051673 CCTTATAAGAGTGAGGGAGAGGG - Intergenic
1177442115 21:21139132-21139154 CTTTATAAGAAAAAGGCAGAGGG + Intronic
1177606265 21:23381468-23381490 CCTTATAAGAGAGAGGCAGAGGG - Intergenic
1178174169 21:30077197-30077219 CTTATTAAGAGGAAGGAAGGAGG + Intergenic
1178484977 21:33013398-33013420 CTTTATAAGAGAAAGGCAGAGGG - Intergenic
1178597949 21:33972017-33972039 TCTTATAAGAAGAAGGCAGAGGG - Intergenic
1178647677 21:34397333-34397355 CCTTGTAAGAGGGAGGCAGAGGG + Intronic
1178839633 21:36128488-36128510 CTTTATGAGAGGGAGGCAGAAGG - Intergenic
1179065852 21:38024329-38024351 CTTTGTAACAGGGAGGCAGAGGG + Intronic
1179285610 21:39975130-39975152 CCCTATAAGAGGAGGGTGGAGGG - Intergenic
1181878366 22:25957800-25957822 CCTTATAAGAAAAAGGCAGAGGG - Intronic
1181988471 22:26818565-26818587 CTTTATAAGAAGCAGGCAGAGGG + Intergenic
1182096442 22:27629214-27629236 CCTTATAAGAGGAAGGCAGGAGG - Intergenic
1182106316 22:27692304-27692326 CCTTGTAAGAGGAAGGCAGGAGG + Intergenic
1182191890 22:28469543-28469565 CCTTATAAGAGGGAGGCAGAGGG + Intronic
1184304530 22:43587603-43587625 CCTTATAAGAGGGAGGCAGAGGG - Intronic
1184413121 22:44337268-44337290 CCTTATAAGAGGGAGGCAGAGGG - Intergenic
1184494072 22:44827107-44827129 CTTTACAAGAGGGAGGTAGGAGG + Intronic
1184529254 22:45044040-45044062 CCTTATGAGAGGGAGGCAGAGGG + Intergenic
949233050 3:1774058-1774080 CTTTATAAAAGAAAGGCAAAAGG - Intergenic
949787446 3:7757539-7757561 CTTTATAAGAGGATGGCTGAGGG + Intergenic
949849223 3:8405155-8405177 TCTTATAAAAGGGAGGTAGAAGG + Intergenic
950817140 3:15716963-15716985 CTTTTTAGGAGGAAGGGAGATGG - Intronic
951356360 3:21671757-21671779 TTTTATGAAAGGAAGGTGGAAGG + Intronic
951942252 3:28092379-28092401 CTTCATAGGAGGATGGTTGATGG + Intergenic
953827205 3:46263977-46263999 CTTTCTAGGAGGAAGGGACAAGG - Intronic
955155394 3:56412096-56412118 CCTTATAGGAGAAAGGTAGAGGG + Intronic
955234105 3:57124420-57124442 CTTTACAAGAGGAAGACAGAAGG + Intronic
956032155 3:65050266-65050288 CATTGTAAGAGGGAGGGAGAGGG - Intergenic
956878334 3:73486064-73486086 CTTCATCAGAGGAAGGTAAGTGG + Intronic
957245498 3:77711359-77711381 CTTTATAAGAAAAAGGCAGAGGG - Intergenic
957449534 3:80360470-80360492 CCTTTTCAGAGGAGGGTAGAGGG + Intergenic
957587804 3:82155233-82155255 CTTTATAAGAGAAAAGAAGAAGG - Intergenic
957682858 3:83460141-83460163 CCTTATAAGAGACAGGCAGAGGG + Intergenic
957884080 3:86260644-86260666 CCTTATAAGAGGGAAGCAGAGGG - Intergenic
957890222 3:86347252-86347274 CTTTATTAGAGAAAGTTACAAGG - Intergenic
958186024 3:90120144-90120166 CTTTATAAGAGGGAGGCAGAGGG - Intergenic
958727591 3:97924709-97924731 CCCTGTAAGAGGAAGGTAGGAGG - Intronic
959231546 3:103660105-103660127 CCTTATAAGAGAAAGGCAGCGGG + Intergenic
960022917 3:112975730-112975752 CTTTATAAAAGGGAGGCATAAGG - Intergenic
960529859 3:118751797-118751819 CTTTAAAAGATGAAAGCAGAAGG + Intergenic
960718063 3:120597164-120597186 CTTTAAAAGATGCAGGTTGAAGG - Intronic
960726910 3:120679623-120679645 CATTATAAGAGGGAGGCAAAGGG + Intronic
960790969 3:121430515-121430537 CTTTATAAGAGGGAAGCAGATGG - Intergenic
962926264 3:139996050-139996072 GTGTACAAGAGGAAGATAGATGG - Intronic
964465380 3:156985924-156985946 CCTTATAAGAGGAAGCAAGAGGG + Intronic
964618104 3:158691875-158691897 CGTTAACAAAGGAAGGTAGATGG - Exonic
964670387 3:159219006-159219028 CCTTCTAAGAGGAAGGCAGAGGG - Intronic
964928713 3:161988991-161989013 CATTATAAGTGGAAGGCAGAAGG - Intergenic
965171321 3:165268285-165268307 CTTTGTAAGAGAAAGGGAGAGGG - Intergenic
965179327 3:165381817-165381839 CCTTATAAAAGGGAAGTAGAGGG - Intergenic
965326274 3:167308725-167308747 ATTTATAAGAGGAAGCTAAATGG + Intronic
965798007 3:172461577-172461599 ATTTTGAAGAGGAAGGTAGGGGG - Intergenic
965895981 3:173576626-173576648 TTTTATTAGAGGAAGGCAGAGGG - Intronic
966033890 3:175386034-175386056 CTTTATAACAGGAGAGGAGATGG - Intronic
966335861 3:178867488-178867510 CCTTACAAGAGCAAGGCAGAGGG + Intergenic
966433956 3:179862189-179862211 CCTAATAAGAGTAAGGCAGACGG - Intronic
966990442 3:185224836-185224858 CCTTATAAGAGGGAAGCAGAAGG - Intronic
967094738 3:186168055-186168077 GTTGAAAAGAGGAAGGAAGAAGG + Intronic
967626765 3:191695255-191695277 CTCTATATGAGGACGTTAGAAGG - Intergenic
967966556 3:194964824-194964846 CTTTACAAGAAAGAGGTAGATGG + Intergenic
968961336 4:3745395-3745417 CTCTATAAGAGCAATGAAGAAGG + Intergenic
969030664 4:4210519-4210541 CTTTATAAGAAGAGGAGAGAAGG - Intronic
969175580 4:5396345-5396367 CTTTATAGGAGGAAAGTAGGGGG - Intronic
969342741 4:6552592-6552614 CCTTATAAGAGGGAGGTAGGAGG - Intronic
970573357 4:17404278-17404300 CTTTAAAAAGGGAAGGAAGAAGG + Intergenic
970580033 4:17466689-17466711 CCTTATAAAAGGGAGGCAGAAGG + Intronic
970926019 4:21453313-21453335 CTTTATATGAAAGAGGTAGAAGG + Intronic
971075226 4:23140351-23140373 TTTGATAAGAAGAAGGTAGATGG - Intergenic
971188912 4:24408138-24408160 GTTTACAAGAGGAAGATAAAAGG + Intergenic
971260998 4:25057107-25057129 CCTTACAAGAGGGAGGTAGGAGG - Intergenic
971261301 4:25059318-25059340 CTTTACAAGAGAAAGGCAGAGGG - Intergenic
971278756 4:25223508-25223530 CCTTATAAAAGAGAGGTAGAGGG - Intronic
971379731 4:26085703-26085725 CTTTATAAGAGAAAGGCAGAGGG + Intergenic
971384591 4:26131680-26131702 CCTTATAAGAGAAAGACAGAGGG + Intergenic
971575315 4:28265375-28265397 CATTAAAAGAGGGAAGTAGAGGG - Intergenic
971893803 4:32563159-32563181 CTTTATAAGAGGAAGGTAGTGGG - Intergenic
972247930 4:37265726-37265748 CCTTATAAGAGGGAGGCATAAGG - Intronic
972411418 4:38799295-38799317 TTTTTTAAGAGAAAGGCAGAGGG + Intronic
973116575 4:46467572-46467594 CCCTATAAGAGGGAGGTAGAAGG + Intronic
973127493 4:46605840-46605862 CTTTATAAGAGAAAGGTAGAGGG + Intergenic
973972536 4:56227901-56227923 CTTCCTAAGAGGCAGGGAGAGGG - Intronic
974030771 4:56774303-56774325 AGTTATAAGTGGAAGGAAGAAGG - Intergenic
974093285 4:57334916-57334938 CCTTATGAGAGGGAGGCAGAAGG + Intergenic
974873933 4:67679164-67679186 CTTTATATGAGAAAGGTGGGAGG + Intronic
975262107 4:72315393-72315415 CCTTATAAGAGAGGGGTAGAAGG + Intronic
975715255 4:77199402-77199424 AGTTATCACAGGAAGGTAGATGG + Intronic
975799044 4:78039572-78039594 CTTTAGAAGAGAGAGGAAGAAGG + Intergenic
975991271 4:80262487-80262509 TTTTATAAGGGGGAGGCAGAGGG + Intergenic
976096423 4:81513087-81513109 CATAATAAGAGGAAGGGAAAGGG - Intronic
976189607 4:82475716-82475738 CTTTAGGACAGGAAGATAGATGG + Intergenic
976362887 4:84201181-84201203 CCTTAGAAGAGGAAGGTAGAGGG - Intergenic
976997552 4:91454427-91454449 CCTTATAAGTAGAAGGTGGAGGG - Intronic
978806212 4:112803371-112803393 CTTTATAGGAGGCAGGCAGAAGG + Intergenic
978842319 4:113229381-113229403 CTTTACAAGAGCAAGACAGAAGG - Intronic
979781122 4:124652051-124652073 CTTCATAAGAGGCATGTACAGGG - Intergenic
980176035 4:129345799-129345821 ATTCATAAGAGGAAAGGAGAAGG + Intergenic
980181825 4:129410638-129410660 CTTTATAAGGCAAAGGAAGAAGG - Intergenic
980424325 4:132607116-132607138 CTCTATAAGAGGAAGACAAAGGG - Intergenic
980832789 4:138152053-138152075 CTTTGTAAAAGGAAGGTAGAAGG + Intergenic
981432388 4:144676698-144676720 TTTCATCAGAGGAAGGTAAATGG + Intronic
981499274 4:145431448-145431470 CTTTATAAGAGAAAGGCAAGAGG + Intergenic
982702012 4:158667588-158667610 CTTTATAGGAGGAGGCGAGATGG + Exonic
983423455 4:167550950-167550972 TTTTATAGGAGGAAGACAGAAGG + Intergenic
983593782 4:169442788-169442810 TTTTAGAAAAGGAAGGCAGAAGG + Intronic
983866450 4:172772877-172772899 CCTTATAAGAGGGAAGAAGAGGG + Intronic
984252375 4:177349490-177349512 CTTTATAAGAGAGAGGGAGGGGG - Intronic
984494196 4:180474011-180474033 CTTTATAAGAGGCAAGCAGGGGG - Intergenic
985243362 4:187954746-187954768 CCTTATAAGAGAAAGTCAGAAGG + Intergenic
985382936 4:189414292-189414314 GTCTAAAAGAGGAAGGAAGAAGG + Intergenic
986231582 5:5869101-5869123 CTTTATAAGAGGAAGGCAGAGGG - Intergenic
986304362 5:6504534-6504556 CCTTATAAGAGGAAGGCAGAGGG - Intergenic
986367145 5:7043731-7043753 CCTTATAAGAGGGAGGCAGAGGG - Intergenic
986447646 5:7836538-7836560 CTTCATACGAGAAAGGAAGATGG + Intronic
986616116 5:9619020-9619042 CTTGGGAAGAGGATGGTAGATGG - Intergenic
986708906 5:10473331-10473353 CCTTAAAAGAGAAAGGCAGAGGG + Intergenic
986791365 5:11164140-11164162 CCTTATGAGAGGGAGGTAGGAGG - Intronic
987150882 5:15038537-15038559 CCTCATAAGAGGAAGGTAGGAGG - Intergenic
987180975 5:15368148-15368170 CCTTATAAGAGGGAGGTAGGAGG + Intergenic
987188063 5:15445235-15445257 CCTTATTAGAGGAAGGCAGGAGG + Intergenic
987826730 5:23039602-23039624 CTTTATATCAGGAAAGTGGAAGG + Intergenic
988709965 5:33763290-33763312 CCTTATAAGAGGAAGGCAAGAGG + Intronic
988787551 5:34578745-34578767 CTTTATAAGAGGGAGGCAGATGG - Intergenic
988884650 5:35542958-35542980 CATTTTAAGAGGAAGGCAGAGGG + Intergenic
989650830 5:43688248-43688270 CATTATAAGAGGGAGGCAGGAGG + Intronic
990232232 5:53725851-53725873 CCTTATAAGAGGGAAGCAGACGG - Intergenic
990374094 5:55152010-55152032 CCCTGTAAGAGGAAGGCAGAGGG + Intronic
990412487 5:55554655-55554677 CCTTATAAGTGGGAGGCAGAGGG + Intergenic
991039883 5:62164114-62164136 CCTTATAAAAGGAAGGCAGAGGG + Intergenic
991141981 5:63255035-63255057 CTTCATAAGAGAAAAGGAGAAGG - Intergenic
991261330 5:64671572-64671594 CTTTATAAGAGAAAGGCAGAGGG + Intergenic
991433218 5:66569466-66569488 CCTTATAAGAGGGAGGCAGAAGG + Intergenic
992591827 5:78303533-78303555 CCTTAAAAGAGGAAGGCAGAAGG - Intergenic
992863361 5:80934302-80934324 CTTTGCTAGAGGAAGGTTGATGG - Intergenic
993081843 5:83310780-83310802 CCTTATTAGAGGGAGGAAGAAGG + Intronic
993396939 5:87401307-87401329 TTTTTTAAGAGAAAGGTAGAAGG - Intronic
993502918 5:88682061-88682083 CTTTTTAAGAGGGAGAGAGAGGG - Intergenic
993558225 5:89368272-89368294 CCTTATAAGATGGAGGCAGAAGG - Intergenic
993858179 5:93101086-93101108 CCTTATAAGAGGAAGACAGGAGG + Intergenic
994275925 5:97837221-97837243 CCTTACAAGAGGGAGGTAGGAGG - Intergenic
994886497 5:105569318-105569340 ATTTATAACAAGAAGATAGATGG + Intergenic
994886746 5:105573609-105573631 CTATATAAGAGCAAGCAAGAAGG - Intergenic
995006272 5:107199769-107199791 ATATATAAAAGGAAGGAAGAGGG + Intergenic
995038667 5:107563922-107563944 GTTTGTACCAGGAAGGTAGAGGG - Intronic
995806402 5:116057244-116057266 CTTTTTGAGGGGAGGGTAGAGGG + Intronic
995820045 5:116219466-116219488 CCTTATAAGAGAGAGGCAGAGGG + Intronic
996624045 5:125548280-125548302 CCTCATAAGAGGGAGGTAGGAGG - Intergenic
996767091 5:127045468-127045490 CTCTATAAGAGGGAGTCAGAAGG - Exonic
996810841 5:127515045-127515067 GCTTATAAGAGAAAGGCAGAAGG + Intergenic
996836027 5:127793347-127793369 CTATATAAAAGGAAGCAAGATGG + Intergenic
997053669 5:130413777-130413799 CCTTATAAAAGGGAGGCAGAGGG - Intergenic
997254453 5:132417711-132417733 CCTTATAAGAGGGAGGCAGGGGG - Intronic
997787522 5:136727249-136727271 CATAATAAAAGGAAAGTAGAGGG - Intergenic
998188702 5:140003415-140003437 CCTTGTAAGAGGGAGGTAGGAGG + Intronic
999194019 5:149769855-149769877 CTTTTTAAGAGGGAGGCAGAAGG - Intronic
999446011 5:151639967-151639989 CCTTATAAGAGGTGGGTAGAGGG - Intergenic
999966556 5:156816461-156816483 TTTTATAAGAGGAAGGCGGTTGG + Intergenic
1000035653 5:157445726-157445748 CCTTATAAGTGGAAGGCAGATGG - Intronic
1000050146 5:157555940-157555962 ATTTATAAGAGGGAGGCAGAAGG - Intronic
1000397926 5:160795687-160795709 CCTTATAAGAGAAAGGCAGAGGG + Intronic
1000658202 5:163907478-163907500 ACTTATAAGTGGAAGGTAAATGG - Intergenic
1001427972 5:171636811-171636833 CCTTATAAGAAAAAGGCAGAGGG + Intergenic
1001813140 5:174645963-174645985 CCTTGTAAGAGAGAGGTAGAGGG - Intergenic
1001933336 5:175688125-175688147 CTTTCTAACAAGGAGGTAGAGGG - Intergenic
1002411363 5:179079999-179080021 CTCTATAAGTGGAAGGAATATGG + Exonic
1002469391 5:179426458-179426480 CTTTATGGGAGCAAGGTGGAGGG + Intergenic
1002565293 5:180109646-180109668 CCTTATAAGAGGACGGCAAAGGG + Intronic
1002939018 6:1699651-1699673 CCTTATAGGAGGAAGGCAGGAGG - Intronic
1003331116 6:5129540-5129562 TCTTCTAAGAGGAAGGCAGAGGG - Intronic
1003416216 6:5910728-5910750 CTTTATAAGAGGGAGGCAGCAGG - Intergenic
1003671990 6:8168005-8168027 CCTTATAAGAGAAAGACAGAGGG - Intergenic
1003682478 6:8269566-8269588 TCTTACAAGAGGAAGGGAGAGGG + Intergenic
1003747106 6:9014857-9014879 CCTTACAAGAGGGAGGTAGAGGG + Intergenic
1003854763 6:10262111-10262133 CATTATAAGAGGAAGGCAGTGGG - Intergenic
1003878347 6:10458065-10458087 CTTTATAAGACAGAGGCAGAGGG - Intergenic
1004218371 6:13723303-13723325 CCTTATAAGAGAGAGGCAGAGGG + Intergenic
1004454296 6:15777428-15777450 CTTTATAAGAGCGAGGCAAAGGG - Intergenic
1004567664 6:16814324-16814346 CTTTAAAAGAGGAAATTACAGGG + Intergenic
1005004013 6:21270182-21270204 CCTTATAAAAGAAAGGCAGAAGG - Intergenic
1008191220 6:48460941-48460963 CTTTATAAAAGCAAAGCAGAGGG + Intergenic
1009406053 6:63314053-63314075 CTCTATCAGAGGAAGGAAAAGGG + Intronic
1009474281 6:64068961-64068983 CTTTGTAAAAGGGAGGAAGAGGG + Intronic
1010009828 6:71037070-71037092 CCTTATAAGAGGGAGGCAGAGGG + Intergenic
1010621878 6:78086224-78086246 TTTTGTCAGAGGAAGGTAAAGGG + Intergenic
1010928358 6:81770663-81770685 CTTTATAAGAAGAAGAGTGAGGG - Intergenic
1011163429 6:84418889-84418911 CCTTAAAAGTGGAAGATAGAGGG - Intergenic
1011476673 6:87755444-87755466 CCTTATAAGAGGGAGGCAGAGGG - Intergenic
1011735613 6:90308115-90308137 CTTTTTAAGAGGGAGGAGGAGGG - Intergenic
1012137044 6:95571528-95571550 CTTTATAACAGGGAGGCAAAGGG - Intergenic
1012187181 6:96233395-96233417 CTGGATTAGAAGAAGGTAGATGG - Intergenic
1012205745 6:96458354-96458376 CCTTATAAGAGAGAGGCAGAGGG + Intergenic
1013055384 6:106577745-106577767 CCTTATAAGGGGAAGGCAGGAGG + Intronic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013635327 6:112023846-112023868 CCTTACAAGAGGGAGGTACAGGG + Intergenic
1014742146 6:125158071-125158093 CCTTATAAGAGAGAGGCAGAGGG - Intronic
1015036325 6:128659386-128659408 ATATAGAAGAGGAAGGCAGAAGG + Intergenic
1015104156 6:129516910-129516932 CTTTTTATGCTGAAGGTAGAGGG + Intergenic
1015498003 6:133900940-133900962 CCTTATAAGAGAAAGGGAGAGGG + Intergenic
1015884520 6:137903132-137903154 CTTTATGAGAGGAATATATATGG + Intergenic
1016285659 6:142469844-142469866 CCTTAGAAGAGGGAGGGAGAGGG - Intergenic
1018754692 6:166838884-166838906 CCTCATAAGAGGAAGGCAGCAGG + Intronic
1018830478 6:167438725-167438747 CCTTAGAAGAGGGAGGCAGAGGG - Intergenic
1019064864 6:169288291-169288313 CTTTATGAGAGGCAGGTGGAAGG - Intergenic
1019287315 7:230173-230195 CCTCATAAGAGGGAGGTGGAGGG + Intronic
1020367645 7:7397309-7397331 CTTTATAAGAGGGAGGCAAAAGG - Intronic
1021066382 7:16179471-16179493 CCTTATAAAAGGGAGGTAGATGG + Intronic
1021897734 7:25253002-25253024 TCTTATAAGAGGAAGGCAGAAGG + Intergenic
1022081732 7:27029225-27029247 CTTTAAAAAAGAAAAGTAGAAGG - Intergenic
1022749157 7:33205096-33205118 ATTTCTAAGAGGAAACTAGATGG - Intronic
1022788165 7:33659905-33659927 CTGTATAAGATGAAGGTGCAAGG - Intergenic
1022819712 7:33947339-33947361 CTCTATATGAGGAAAGAAGATGG - Intronic
1023055578 7:36287299-36287321 CTATATAAGAAGGAGGTGGAAGG - Intronic
1023303032 7:38793841-38793863 CTTTATGAGAGGGAGGCAGAGGG - Intronic
1025209585 7:57013167-57013189 CATTAAAAGATGAAGGCAGACGG - Intergenic
1025662366 7:63563683-63563705 CATTAAAAGATGAAGGCAGACGG + Intergenic
1025909828 7:65819411-65819433 CTTTATAAGAGAAAGGAGGTAGG + Intergenic
1026613585 7:71882298-71882320 CTTCATAAGAGGAAGGCAGGAGG - Intronic
1026657189 7:72267128-72267150 CTTTCTAAGAGGAGGTTTGAAGG - Intronic
1028155258 7:87422271-87422293 ATTTATGAGAGGAATGAAGAAGG - Intronic
1028655734 7:93204720-93204742 CTTTCTAAAAGGTAGGTATAGGG - Intronic
1029867855 7:103655053-103655075 CTTTAGAAGACAAAGGTAGGAGG - Intronic
1029910293 7:104138414-104138436 CTTTTTAAGAGTTAGGTAGCTGG + Intronic
1030286388 7:107831275-107831297 CCTTATAAGAAGGAGGTGGAAGG + Intergenic
1030545697 7:110892396-110892418 CTTTTTAGGGGGAAGGGAGATGG - Intronic
1030843741 7:114384549-114384571 CTTCATGACAGGATGGTAGATGG - Intronic
1031041898 7:116847240-116847262 CTTTTTAAAAGGAAAGCAGAAGG + Intronic
1031587241 7:123546977-123546999 CCTTATAAGAGAGAGGCAGAGGG + Intronic
1031910406 7:127511110-127511132 CCTTCTAAGAGGAAGGCAGGAGG + Intergenic
1032181290 7:129681092-129681114 CTTTATAAGAGGGAAGCAAAGGG + Intronic
1032644346 7:133805816-133805838 TTTTATAAGTTGAAGGAAGAAGG + Intronic
1032860063 7:135868242-135868264 CTCTAAAAAAGGAAGGGAGAGGG + Intergenic
1033331147 7:140417853-140417875 CCTTACAAGGGGGAGGTAGAGGG - Intronic
1033929079 7:146501796-146501818 CATTATAAGAGAAAGGCAGAGGG + Intronic
1034955316 7:155330136-155330158 CTTTCTAAGAGGGAGGCAGAGGG + Intergenic
1037209604 8:16370664-16370686 CCTTATGAGAGAAAGGTAGGAGG + Intronic
1037241821 8:16786076-16786098 CCTTATAAGAGAAAGGTAGGGGG + Intergenic
1037449612 8:19003622-19003644 TTTTAAAAGAGGAGGGAAGAAGG + Intronic
1038060513 8:23907257-23907279 CTCTTCAAGGGGAAGGTAGAAGG - Intergenic
1038701828 8:29856109-29856131 CCTTATAAGAGTGAGGCAGAGGG + Intergenic
1039436786 8:37564939-37564961 CTTTAGAGGAGGAAGATGGAAGG - Intergenic
1039493700 8:37965813-37965835 CACGAGAAGAGGAAGGTAGAAGG + Exonic
1041386683 8:57312019-57312041 CTCTATAAGAGCAATGCAGAGGG + Intergenic
1041936226 8:63334959-63334981 TTTTATAAGAGGGAGGCAGAGGG - Intergenic
1042127691 8:65555256-65555278 CTTTATAAGAGGGAGGCAGGAGG - Intergenic
1042216723 8:66435518-66435540 CCTTATAAAAGGGAGGCAGAGGG - Intronic
1042576499 8:70226240-70226262 GTTTATAATAAGAAGGAAGAGGG + Intronic
1043400367 8:79878677-79878699 CTTTGTGAGACTAAGGTAGATGG + Intergenic
1043534835 8:81191178-81191200 CTTGATAAGAGAAAGGCAGAAGG + Intergenic
1043564271 8:81530769-81530791 CCTTTTAAGAGGGAGGAAGAGGG + Intronic
1043582068 8:81725619-81725641 CCTTAAGAGAGGAAGGCAGAAGG - Intronic
1043687889 8:83110948-83110970 CTTCATAACAGGAAAGTATAAGG - Intergenic
1044131602 8:88530720-88530742 CTTTATAAGAGAGAGTAAGAGGG + Intergenic
1044388197 8:91615731-91615753 AGTTATATGAGGAAAGTAGATGG + Intergenic
1044828362 8:96220354-96220376 TTTTATAAGAGGGAGGCAGGAGG + Intergenic
1045478508 8:102574293-102574315 CCTTAGAAGAGGGAGGCAGAAGG + Intergenic
1045529907 8:102974624-102974646 CTTTGTAAGAGGCAGGCAGGAGG - Intronic
1046222823 8:111237730-111237752 CCCTATAAGAGGGAGGGAGAGGG - Intergenic
1046281994 8:112045384-112045406 CTTTACAAGAGGGATGCAGAAGG + Intergenic
1046850670 8:118969077-118969099 CTCTATAAGAGGAAGGCAAGAGG + Intergenic
1047002440 8:120586540-120586562 CCTTATAAGAGGGAGGCAGGAGG - Intronic
1047003813 8:120598906-120598928 CTTTATAAGAGGGAGGCCAAGGG - Intronic
1047063475 8:121253581-121253603 CCTTAGAAGAGGGAGGAAGAAGG - Intergenic
1047124526 8:121945950-121945972 CTTTATAAGAGGAGGGCAGGAGG - Intergenic
1047201521 8:122771601-122771623 CTTTATAAGAGGGAGGCAAAAGG - Intergenic
1047771786 8:128035744-128035766 CCTTATTAGAGGGAGGCAGAGGG + Intergenic
1047983244 8:130205174-130205196 CTATGTGAGAGGAAGGAAGAAGG - Intronic
1048035197 8:130671343-130671365 CATTACAAGAGGGAGGTAGAGGG + Intergenic
1048216351 8:132499123-132499145 ATTTATATGAGCAAGGTACAGGG - Intergenic
1048237842 8:132709552-132709574 CCTTTAAAGAGGGAGGTAGAGGG + Intronic
1048426654 8:134329524-134329546 CCTAATAAGGGGGAGGTAGATGG + Intergenic
1048455585 8:134575326-134575348 CCTTATAAAAGGAAGGCAGGAGG + Intronic
1048722808 8:137346055-137346077 TCTTATAAGTGGAAGATAGAAGG - Intergenic
1048917817 8:139201420-139201442 CCTTATAAGAGAGAGGCAGAAGG - Intergenic
1048937936 8:139372451-139372473 CTTTATAAAAGGCAGGCAAAGGG - Intergenic
1048974830 8:139665373-139665395 CTTTATAAGAGGGAGGCAGGAGG - Intronic
1049358525 8:142200647-142200669 CCTTTTAAGAGGAAGGCAGGTGG + Intergenic
1050112012 9:2226952-2226974 CTTTGTAGAATGAAGGTAGAAGG - Intergenic
1050322252 9:4465104-4465126 TTTTGTAAGAGGAAGAGAGAGGG - Intergenic
1050642515 9:7683483-7683505 CTTTATAAGAGAGAGGGAGGCGG + Intergenic
1051682774 9:19624752-19624774 CTACATAAAAGGAAAGTAGAGGG - Intronic
1051734966 9:20188631-20188653 CCTTACAAGAGGGAGGCAGAAGG + Intergenic
1051972123 9:22901608-22901630 CCTTATAAGAAGAAGAAAGAGGG + Intergenic
1052183108 9:25555430-25555452 CCTTATAAGAGGGAGGTAGGGGG - Intergenic
1052472923 9:28922933-28922955 CTTTATAAAAGGGAGGTGGAAGG + Intergenic
1052643965 9:31208158-31208180 CCTTACAAGAGGCAGGTAGAAGG - Intergenic
1053446598 9:38157959-38157981 CCTTATAAGAGGGAGGCAGAGGG - Intergenic
1055086928 9:72323896-72323918 GCTTCTAAGAGGAAGGTAGAAGG - Intergenic
1055827926 9:80349041-80349063 CCTTATAAAAGGGAGGCAGAAGG + Intergenic
1056233164 9:84567393-84567415 CTTTAAATTAGGAAGGCAGAGGG - Intergenic
1056512089 9:87315931-87315953 TCTTATAAGAGGGAGGGAGAGGG + Intergenic
1057838938 9:98469544-98469566 CTGTATGAGAGAAAGGCAGAGGG - Intronic
1057864325 9:98667230-98667252 GCTTACAAGAGGAAGTTAGAGGG - Intronic
1058513145 9:105741065-105741087 CCTTATAAGAGGAAAACAGAGGG + Intronic
1058651726 9:107181241-107181263 CTTTATAAGAGTCAGGCAGAGGG - Intergenic
1058681034 9:107440422-107440444 CTTTAAAAGAGGAAAGGAGAGGG + Intergenic
1059014114 9:110495394-110495416 CCTTATAAGGGGAAGGCAGGAGG + Intronic
1059058978 9:111015014-111015036 CCTTATAAGAGGAAGAAAGTTGG + Intronic
1059472463 9:114516401-114516423 CTCCAATAGAGGAAGGTAGATGG + Intergenic
1059983584 9:119799530-119799552 CTTTATAAGAGGGAGGCTGGAGG - Intergenic
1060465524 9:123901381-123901403 ATTTTTAATAGGAGGGTAGAGGG - Intronic
1060541399 9:124432963-124432985 CCTTATAAGAGGGAGGCAGAGGG + Intergenic
1060903089 9:127278924-127278946 CTTTATAAGAGAAAAAGAGAGGG - Intronic
1060915086 9:127384134-127384156 CATTTTGAGAGGAAGGCAGAGGG + Intronic
1061576782 9:131512384-131512406 GTTTTTATGAGGAAGGGAGAGGG - Intronic
1062703707 9:137922496-137922518 TTTGATAAGAGGAAGGTTGTTGG + Intronic
1202786148 9_KI270719v1_random:21706-21728 CCTTATAAGAGTGAGGGAGAGGG - Intergenic
1185687392 X:1940574-1940596 CTTTCTAAGAAGGAGGCAGAGGG - Intergenic
1185691136 X:2156094-2156116 CTTCATAAGAGGAAAGGAGAAGG - Intergenic
1185882107 X:3750694-3750716 CCTTATAAGAGGGAAGTAGGAGG + Intergenic
1186024175 X:5290701-5290723 CTTTATAAGAGGGAGGTAAAAGG - Intergenic
1186139366 X:6554815-6554837 CTTTATAAGAGAGAGGTAGGAGG + Intergenic
1186176580 X:6931417-6931439 CTTTAGAAGGGCAAGGCAGAAGG - Intergenic
1186207230 X:7213538-7213560 CTTGCTATGAGGAAGGCAGATGG + Intergenic
1186894880 X:13995736-13995758 CCTTATAAGAGGGAGGGAGGTGG - Intergenic
1186937483 X:14466347-14466369 ATTTACAACAGGGAGGTAGATGG - Intergenic
1187295870 X:17999981-18000003 CCTTATAAGAGGAAGACAGAGGG - Intergenic
1188152485 X:26695197-26695219 TCTTATAAGAGGGAGGCAGAAGG + Intergenic
1188325874 X:28800203-28800225 CCTTATAAGAGAAAAGCAGAAGG - Intronic
1188583506 X:31744538-31744560 CTTGATAAGTGGAAGTTCGAAGG - Intronic
1188625591 X:32280721-32280743 CTTTTAAAGTGGAAGCTAGAGGG - Intronic
1188981684 X:36732604-36732626 CCTTATAAAAGAAAGGCAGAGGG + Intergenic
1189246703 X:39568882-39568904 CTTTATTAGAGGGAGGCAGGAGG - Intergenic
1189365516 X:40384922-40384944 CCTCATAAGAGAAAGGCAGAGGG - Intergenic
1189532674 X:41902464-41902486 CCTTATAAGAGGAAGGCAGGAGG - Intronic
1190033408 X:46996702-46996724 CCTTACAAGAGAAAGGTGGAGGG - Intronic
1191025627 X:55909851-55909873 CTTTAACAGTGGAAGGGAGATGG - Intergenic
1191801936 X:65091165-65091187 CCTTATAAGAGGGAGACAGAAGG + Intergenic
1192055038 X:67765372-67765394 CTTAATAAGAGAAAGGTTCATGG + Intergenic
1193426575 X:81347377-81347399 CCTTATAAGGGTAAGGAAGAGGG - Intergenic
1193587728 X:83346569-83346591 CTGTATAAAATGAAGGTAGTAGG - Intergenic
1193667800 X:84344458-84344480 CTTTATAAGAGAAATATAGGAGG + Intronic
1194355924 X:92883856-92883878 CCTTATAAGTGGAAGCTAAATGG + Intergenic
1194427917 X:93762838-93762860 CTTCATAAGAGATAGGAAGAGGG - Intergenic
1195272462 X:103245400-103245422 CCTTATAAGAGAGAGGCAGAGGG - Intergenic
1195509098 X:105693715-105693737 CCTTATAAGAGAGAGGCAGAAGG + Intronic
1195604331 X:106785444-106785466 CCTTATAAGAGGGAGAGAGAGGG + Intronic
1195664559 X:107416982-107417004 CCTTATAAGAGGGATGCAGAGGG + Intergenic
1195869333 X:109469790-109469812 CTGTGTAAGAGGAAGGTGGGAGG + Intronic
1196003525 X:110811480-110811502 GTTTATAAGAGGAAAGGAGGTGG + Intergenic
1196391061 X:115207881-115207903 CCTTATAAGAGGAAAGCAGAGGG + Intronic
1196391151 X:115208905-115208927 CCTTATAAGAGGAAAGCAGAGGG + Intronic
1196555191 X:117077444-117077466 CTTTATCACAGGAAAGGAGAAGG + Intergenic
1196744408 X:119056558-119056580 CTTTGTTAGAGGCAGGCAGATGG + Intergenic
1197985603 X:132263640-132263662 CCTTATAAAAGGGAGGCAGAAGG + Intergenic
1198105601 X:133458397-133458419 CCTTATAAGAGAAAGGCGGAGGG - Intergenic
1198152185 X:133922204-133922226 CTTTTTAAGAGAAGGCTAGAGGG + Intronic
1198942427 X:141971229-141971251 CCTTATAAGAGGTAATTAGAGGG + Intergenic
1199017284 X:142833253-142833275 CTTTATCAGAGAGAGGTAAAAGG - Intergenic
1199524343 X:148775772-148775794 CCTTATAAGAGAGAGGCAGAGGG - Intronic
1199675739 X:150187803-150187825 CTTTATAAGGGGGAGGCAGAAGG - Intergenic
1199681636 X:150228714-150228736 CCTTATAAGAGGAAGGCAGAAGG - Intergenic
1199737469 X:150696984-150697006 CTTTATCAGAAGAAGGGGGAAGG + Intronic
1200389378 X:155928572-155928594 CTCTATAGGAGGAAAGTAGATGG - Intronic
1200782867 Y:7232512-7232534 CCTTATAAGAGGGAAGTAGGAGG - Intergenic
1200925328 Y:8649218-8649240 CTTTAGAATAGGTAGGTACAAGG - Intergenic
1201625064 Y:16005829-16005851 CCTTATAAGAGGAAGGCAGTAGG + Intergenic