ID: 945589656

View in Genome Browser
Species Human (GRCh38)
Location 2:211714632-211714654
Sequence GTGCAATCCTGTGCTACAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 113}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945589656_945589659 11 Left 945589656 2:211714632-211714654 CCACCTGTAGCACAGGATTGCAC 0: 1
1: 0
2: 1
3: 7
4: 113
Right 945589659 2:211714666-211714688 AACAGCTTTTGACATGCTTCTGG 0: 1
1: 0
2: 3
3: 32
4: 258
945589656_945589661 18 Left 945589656 2:211714632-211714654 CCACCTGTAGCACAGGATTGCAC 0: 1
1: 0
2: 1
3: 7
4: 113
Right 945589661 2:211714673-211714695 TTTGACATGCTTCTGGGTCCTGG 0: 1
1: 0
2: 1
3: 12
4: 219
945589656_945589660 12 Left 945589656 2:211714632-211714654 CCACCTGTAGCACAGGATTGCAC 0: 1
1: 0
2: 1
3: 7
4: 113
Right 945589660 2:211714667-211714689 ACAGCTTTTGACATGCTTCTGGG 0: 1
1: 0
2: 3
3: 58
4: 530
945589656_945589662 27 Left 945589656 2:211714632-211714654 CCACCTGTAGCACAGGATTGCAC 0: 1
1: 0
2: 1
3: 7
4: 113
Right 945589662 2:211714682-211714704 CTTCTGGGTCCTGGTAGAGATGG 0: 1
1: 1
2: 7
3: 28
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945589656 Original CRISPR GTGCAATCCTGTGCTACAGG TGG (reversed) Intronic
902476934 1:16693319-16693341 TGGCAATCCTGTGCCTCAGGCGG + Intergenic
903292397 1:22322787-22322809 GTGCTCTCCTGAGCTACAGAAGG + Intergenic
905449876 1:38049077-38049099 CTGCAATCCCACGCTACAGGTGG - Intergenic
907255572 1:53176158-53176180 GTACAACCCTGTGCTAAGGGCGG + Intergenic
911728855 1:101270813-101270835 GTGCTCTCCTGAGCTACAGAAGG + Intergenic
912711107 1:111950559-111950581 TTGCATTCCTGTGCTCCAGCAGG - Intronic
913648877 1:120890356-120890378 GTGCTCTCCTGAGCTACAGAAGG - Intergenic
914077814 1:144373027-144373049 GTGCTCTCCTGAGCTACAGAAGG + Exonic
914101365 1:144593478-144593500 GTGCTCTCCTGAGCTACAGAAGG - Exonic
914172723 1:145241567-145241589 GTGCTCTCCTGAGCTACAGAAGG + Intergenic
914527380 1:148482695-148482717 GTGCTCTCCTGAGCTACAGAAGG + Exonic
914639014 1:149584433-149584455 GTGCTCTCCTGAGCTACAGAAGG - Exonic
916490239 1:165295910-165295932 GTGCCATCCTGGACTACAGGAGG + Intronic
918381545 1:183960683-183960705 GAGCAATCCTGGGCCACATGTGG - Intronic
923135819 1:231117769-231117791 GTGCTCTCCTGAGCTACAGAAGG + Intergenic
1070704414 10:78627324-78627346 GTGAAATACTGAGCTCCAGGAGG - Intergenic
1071065286 10:81626173-81626195 CTGCAAACCTGTGCTACTGTTGG + Intergenic
1076509139 10:130999742-130999764 GTGCTTTGCTGTGCTGCAGGAGG - Intergenic
1078012094 11:7580266-7580288 CTGCAGACCTGGGCTACAGGAGG - Intronic
1081659881 11:44881613-44881635 TTGCATTGCTGGGCTACAGGTGG - Intronic
1083183957 11:61007000-61007022 GTACAATCCTGGGCTAAAAGGGG + Intronic
1084682152 11:70672746-70672768 GGGCACTCATGTGCTACTGGGGG - Intronic
1088201229 11:107337504-107337526 GCTCCATCCTGTACTACAGGGGG - Intronic
1088622457 11:111699924-111699946 ATGCAATGCTGTGCTCCAGCTGG + Intronic
1089811675 11:121137411-121137433 GGGCACTCCAGTGCTGCAGGTGG - Exonic
1090349940 11:126101461-126101483 CTGCATTCCTGGGCTAGAGGAGG + Intergenic
1093281165 12:17197967-17197989 CTGCTGTCCTGTGCTAGAGGAGG - Intergenic
1100838651 12:98590661-98590683 GTGCTCTCCTGAGCTACAGAAGG + Intergenic
1105412095 13:20178920-20178942 GTGCTCTCCTGAGCTACAGAAGG + Intergenic
1106161767 13:27207572-27207594 CTGTTATCCTTTGCTACAGGTGG - Intergenic
1108686253 13:52821359-52821381 GTGCTCTCCTGAGCTACAGAAGG - Intergenic
1119760951 14:77151510-77151532 TTGCAATCGTGGGCTCCAGGGGG - Intronic
1121511659 14:94517187-94517209 GTGCAAGGCTGTGCTACACATGG - Intronic
1122885071 14:104707243-104707265 GTGCATTCCTGGGCTGCAGTAGG - Exonic
1127107124 15:55628264-55628286 GTCCAGTCCTGTGCTACAGGGGG + Intronic
1127717132 15:61659960-61659982 GTGTAATCCTGTGGTAAAGCTGG - Intergenic
1127845514 15:62866980-62867002 GTGCAATACAGAGCTACTGGAGG - Intergenic
1129260199 15:74362084-74362106 GTGCTGTCCTGAGCTACAGAAGG - Intronic
1129469940 15:75747300-75747322 GTGCTGTCCTGAGCTACAGAAGG - Intergenic
1129663686 15:77567410-77567432 ATGCAAGCATGTGCTAGAGGCGG + Intergenic
1129972041 15:79787307-79787329 GAGCATTCCTGTTCTCCAGGGGG + Intergenic
1133973262 16:10581716-10581738 GTGCAATCCTGTGCTCTGGTTGG + Intergenic
1139823840 16:69741453-69741475 GAGCAGTCCTGAGCTACAAGAGG - Intergenic
1141137461 16:81475650-81475672 GTGCTCTCCTGAGCTACAGAAGG + Intronic
1147430638 17:40368481-40368503 GTGCTCTCCTGAGCTACAGAAGG - Intergenic
1150683671 17:67303147-67303169 GTGCAAGCCTGTGCTACTGCAGG - Intergenic
1151217110 17:72584531-72584553 GTGTCATCCTGTTTTACAGGAGG - Intergenic
1156903401 18:42327178-42327200 GACCAATCCTGTGCTACATGGGG + Intergenic
1165151998 19:33766436-33766458 GTGCAGTGCTGAGCTACAGATGG - Intronic
1165345602 19:35247548-35247570 CTGCAATGGTGTCCTACAGGAGG + Intergenic
1167760105 19:51441121-51441143 GTGCAGTCCTGGGCTCCAGCAGG + Intergenic
1202710950 1_KI270714v1_random:19145-19167 TGGCAATCCTGTGCCTCAGGCGG + Intergenic
928182519 2:29079526-29079548 GGACAATCCTCTGTTACAGGTGG - Intergenic
930154778 2:48094758-48094780 TTGTATTCTTGTGCTACAGGTGG - Intergenic
930747339 2:54898235-54898257 GTCCGATCCTGTGTTACACGGGG + Intronic
932025261 2:68125787-68125809 GTGCTCTCCTGAGCTACAGAAGG - Intronic
933302793 2:80561568-80561590 GTGGAGGTCTGTGCTACAGGTGG + Intronic
944933340 2:204543412-204543434 GTGCAATCCTGTACACCATGGGG - Intergenic
945066302 2:205950187-205950209 GTGCTCTCCTGAGCTACAGAAGG - Intergenic
945589656 2:211714632-211714654 GTGCAATCCTGTGCTACAGGTGG - Intronic
1171470619 20:25368213-25368235 GTGCTCTCCTGAGCTACAGAAGG + Intronic
1171879501 20:30607609-30607631 GTGGAATCATGTGTAACAGGAGG - Intergenic
1172794980 20:37530580-37530602 GTGCTCTCCTGAGCTACAGAAGG - Intergenic
1174341418 20:49899056-49899078 GGGGACTCCTGTGCTGCAGGTGG + Intergenic
1177052497 21:16254447-16254469 GGAAAATCCTGTGATACAGGTGG - Intergenic
1177271824 21:18858313-18858335 GTGCTCTCCTGAGCTACAGAAGG - Intergenic
1179604151 21:42501874-42501896 GGGAGATCCTGTGCTACATGGGG + Intronic
1180008695 21:45035288-45035310 GGGCGAGCCTGGGCTACAGGAGG + Intergenic
950457702 3:13102515-13102537 GTGAAAACCTGTGCTTCACGGGG + Intergenic
950702243 3:14758518-14758540 GTGCCATCCTTTGCTCCAGTTGG - Intronic
955001155 3:54929059-54929081 GTGCAATCCTTGGCTCCAGGAGG + Intronic
955015654 3:55066455-55066477 GTGCAATCCTGTGGTCCTCGGGG + Intronic
956320749 3:67993571-67993593 GTGCAATACCATACTACAGGGGG + Intergenic
957508270 3:81154714-81154736 GTGCCATCCTGTTCCACAGTTGG + Intergenic
958634627 3:96727503-96727525 GCACAATCCTGTGATACAGTGGG - Intergenic
962987369 3:140547871-140547893 GGGCTGTCCTGTGCTCCAGGAGG - Intronic
965046143 3:163580412-163580434 GTGCATTCCTGGGTTTCAGGAGG + Intergenic
965306167 3:167066372-167066394 GTGCTCTCCTGAGCTACAGAAGG - Intergenic
968086776 3:195877384-195877406 GTGCAATCCTGTGCCTCTTGGGG - Intronic
969496816 4:7530971-7530993 CTACCATCCTGTGCTGCAGGTGG + Intronic
969568372 4:7993316-7993338 GTGCCATCCTGTGCCAGAGGTGG + Intronic
980661634 4:135867175-135867197 GTGCAATCCTGTATTATAGAAGG + Intergenic
986178950 5:5375906-5375928 GTGCAGTCCTGGCCCACAGGAGG + Intergenic
986593753 5:9398888-9398910 GTGCAAGCCTGTGCTACCAATGG + Intronic
992018094 5:72595792-72595814 GTACCTTGCTGTGCTACAGGTGG - Intergenic
992199170 5:74367358-74367380 CTGCATTCCTGGGATACAGGAGG + Intergenic
992966670 5:82009537-82009559 GTGCTCTCCTGAGCTACAGAAGG + Intronic
993214298 5:84999753-84999775 GTGCTCTCCTGAGCTACAGAAGG + Intergenic
994176347 5:96715771-96715793 GTACAATACAATGCTACAGGCGG - Intronic
1001119647 5:168969430-168969452 GTGCAATCCTTGGCCACAGGCGG + Intronic
1004020230 6:11770416-11770438 CTGCAATCTTGTTCCACAGGAGG - Intronic
1004652180 6:17620603-17620625 GAGCCATCCTGGGCTACATGTGG - Intronic
1005355266 6:24977018-24977040 GTGCTCTCCTGAGCTACAGAAGG - Intronic
1006768834 6:36534027-36534049 TTGCAATCCTGTTCTTCATGAGG - Intronic
1017766244 6:157609598-157609620 GTGCCATCATGTGCCACAAGTGG + Intronic
1019031536 6:169018071-169018093 GTGCAATCCTGTGCTTCCCCAGG - Intergenic
1022217527 7:28279145-28279167 GTGCTCTCCTGAGCTACAGAAGG + Intergenic
1023921217 7:44631552-44631574 GTGAAATACTGTGCTAAAGTTGG - Intronic
1023945720 7:44801459-44801481 GTGCTCTCCTGAGCTACAGAAGG - Exonic
1024582747 7:50813137-50813159 GGGGAACCCTGTGCTCCAGGAGG - Intergenic
1025190224 7:56890756-56890778 TTGCTATCCTTTGCTCCAGGTGG + Intergenic
1025681715 7:63686164-63686186 TTGCTATCCTTTGCTCCAGGTGG - Intergenic
1029147072 7:98454051-98454073 GTGCTCTCCTGAGCTACAGAAGG + Intergenic
1029307141 7:99628741-99628763 GTGCTGCCCTGTGCTACAGCAGG + Intronic
1031236222 7:119181507-119181529 GTGCAATTCTCTGCTGCAGATGG + Intergenic
1031895579 7:127345200-127345222 GTCAAATATTGTGCTACAGGCGG + Intergenic
1035220073 7:157401149-157401171 CAGCAATCCTTTGATACAGGAGG - Intronic
1036180221 8:6577969-6577991 GTGCGATCCTGTGAGACAGCGGG + Intronic
1037004476 8:13760033-13760055 GTGCCACCCTGCCCTACAGGTGG + Intergenic
1038255005 8:25942957-25942979 GGGAAATCCTGAGCTCCAGGAGG - Intronic
1038515783 8:28186672-28186694 GTGCTATCCTGTGCCACCGCAGG - Intronic
1038756854 8:30349795-30349817 GTGCTCTCCTGAGCTACAGAAGG + Intergenic
1041459037 8:58091491-58091513 GTGGAATCCTGAGAGACAGGAGG - Intronic
1042110684 8:65378155-65378177 GTGCTATCCTGAGTTACAGAGGG - Intergenic
1042267903 8:66927158-66927180 TTGCAATCCTTTGTTAAAGGAGG - Intergenic
1050634648 9:7598414-7598436 GTGCTCTCCTGAGCTACAGAAGG - Intergenic
1055464314 9:76549220-76549242 GTGCTCTCCTGAGCTACAGAAGG + Intergenic
1055511593 9:77000530-77000552 GTGCTATCCTGTGCCACTGGGGG - Intergenic
1061825572 9:133256397-133256419 GTGCACCCCTGGGCTGCAGGAGG + Intronic
1185769120 X:2751804-2751826 GTACAATCATGTCCTGCAGGAGG + Intergenic
1195018346 X:100800237-100800259 GTGCTCTCCTGAGCTACAGAAGG + Intergenic
1199234605 X:145476467-145476489 GTGGAATCCCGCCCTACAGGTGG - Intergenic