ID: 945594129

View in Genome Browser
Species Human (GRCh38)
Location 2:211770701-211770723
Sequence CTAGTATGGAGCAGACTTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 67}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945594129_945594131 -3 Left 945594129 2:211770701-211770723 CCAACAAGTCTGCTCCATACTAG 0: 1
1: 0
2: 0
3: 5
4: 67
Right 945594131 2:211770721-211770743 TAGAAATTGCAAGCTGCTTGAGG 0: 1
1: 0
2: 1
3: 13
4: 195
945594129_945594132 7 Left 945594129 2:211770701-211770723 CCAACAAGTCTGCTCCATACTAG 0: 1
1: 0
2: 0
3: 5
4: 67
Right 945594132 2:211770731-211770753 AAGCTGCTTGAGGCTCTCAGAGG 0: 1
1: 0
2: 1
3: 23
4: 212
945594129_945594133 20 Left 945594129 2:211770701-211770723 CCAACAAGTCTGCTCCATACTAG 0: 1
1: 0
2: 0
3: 5
4: 67
Right 945594133 2:211770744-211770766 CTCTCAGAGGCCCCCAAATCAGG 0: 1
1: 0
2: 0
3: 12
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945594129 Original CRISPR CTAGTATGGAGCAGACTTGT TGG (reversed) Intronic
902191266 1:14764870-14764892 CCAGTATGCAGCACTCTTGTGGG - Intronic
916982548 1:170154280-170154302 CTAGTGTGGAGGAGAAATGTGGG + Intronic
1069494873 10:68894618-68894640 CTGGTATAGAAAAGACTTGTAGG + Intronic
1070111067 10:73487204-73487226 TTAGAATGGATAAGACTTGTGGG - Intronic
1072598145 10:96895253-96895275 CTAGGATGGAGAAGACTGGAGGG - Intronic
1084224856 11:67709799-67709821 CTGGTGTTGAGCAGACTTGAAGG - Intergenic
1084679401 11:70657595-70657617 CTGGTGTGGAGCAGCCTCGTAGG + Intronic
1087762853 11:102120890-102120912 CTAATAAGGAGCAGGCTTTTGGG + Intronic
1090624794 11:128597311-128597333 CTCATATGGAGCAGACATGGAGG - Intergenic
1093426538 12:19034651-19034673 GTAGTGTGGGGCAGTCTTGTGGG - Intergenic
1097210985 12:57369688-57369710 TTACCATGGGGCAGACTTGTTGG - Intronic
1102848272 12:116211544-116211566 CTAGTATTTAGGAGCCTTGTAGG - Intronic
1105930787 13:25049621-25049643 GTAGTATGGAGCAGAACTGGTGG - Intergenic
1109925930 13:69139053-69139075 CTAGTATGGAGCAGAGCTGGTGG - Intergenic
1113984561 13:114303483-114303505 CTGGTAAGAAGCAGAATTGTCGG + Intronic
1116118450 14:40690308-40690330 CTAGTATGGCTCTGATTTGTTGG - Intergenic
1117180225 14:53183723-53183745 GAAGTAGGGAGCAGTCTTGTGGG + Intergenic
1118518007 14:66548015-66548037 CTTTTATCCAGCAGACTTGTTGG + Intronic
1123493834 15:20803264-20803286 CTAATTTGGGGGAGACTTGTGGG + Intergenic
1123550332 15:21372346-21372368 CTAATTTGGGGGAGACTTGTGGG + Intergenic
1126515915 15:49537956-49537978 CTATGAAGGAGCAGACATGTAGG + Intronic
1126931449 15:53656815-53656837 CTGTTATTGAGCAAACTTGTTGG - Intronic
1128305116 15:66593272-66593294 CTAGTATGATGCAGCCTGGTTGG + Intronic
1130026494 15:80275365-80275387 CCAGTAAGGAGCTGACTTATGGG + Intergenic
1202958675 15_KI270727v1_random:99600-99622 CTAATTTGGGGGAGACTTGTGGG + Intergenic
1139017329 16:62706298-62706320 CAAGTGGGGAGCAGCCTTGTGGG - Intergenic
1144263708 17:13547799-13547821 CTGATATGGGGCAGCCTTGTGGG + Intronic
1154399965 18:14027123-14027145 CAAGTATGGAGCAGCTTTATGGG - Intergenic
1157211199 18:45743499-45743521 CTAGTAAGTAGCAGACCTGCTGG - Intronic
1158603698 18:58876482-58876504 CTAGCAGGGAGCAGACATGGGGG + Intronic
926785048 2:16510218-16510240 CTATTATGCATCAGACTGGTAGG + Intergenic
926785834 2:16517732-16517754 CTAGTATAGAGCAGCATTCTTGG + Intergenic
932323145 2:70836572-70836594 CTGGTGAGGAGCAGACTGGTGGG + Intergenic
944612503 2:201425924-201425946 CTAGTATGTAACAGAGTGGTGGG - Intronic
945594129 2:211770701-211770723 CTAGTATGGAGCAGACTTGTTGG - Intronic
945850400 2:214999314-214999336 CTAGTATAAAGCAGAAATGTTGG + Intronic
946222392 2:218239482-218239504 CAGGTATGGAGCAGACATCTTGG + Exonic
1169815358 20:9650733-9650755 CTGGCATGTAGCATACTTGTGGG + Intronic
1178002184 21:28174682-28174704 CTAGTAGGGTGCAGGCTAGTTGG - Intergenic
1181023455 22:20115064-20115086 CGAGTATGGAGTGGACCTGTGGG + Exonic
1183677860 22:39309832-39309854 CTAGCATGGAGAAGGTTTGTTGG - Intergenic
950334166 3:12180543-12180565 CTAGTAGACAGCAGGCTTGTAGG + Intronic
952399899 3:32953710-32953732 CTACTATGCAGCAGACCAGTGGG + Exonic
953842033 3:46396821-46396843 GTTGTATGCAGCAGACTTGTGGG - Intergenic
954324930 3:49858396-49858418 CTAGGGTGGAGAGGACTTGTGGG + Exonic
955537356 3:59938434-59938456 ATAGTAAGCAGCAGATTTGTAGG + Intronic
956393585 3:68800643-68800665 CAAGTGTGGAGCAGACCAGTTGG - Intronic
957078110 3:75617584-75617606 CTGGTGTTGAGCAGACTTGAAGG - Intergenic
959673197 3:109002684-109002706 TTAGTAGAGAGCAGAGTTGTTGG - Intronic
962182290 3:133220768-133220790 AAAGTAGGGAGCAGTCTTGTGGG - Intronic
965800540 3:172488981-172489003 CAACTATGGAGCAAACTTGGAGG - Intergenic
981978775 4:150766441-150766463 TTAGTATGGAGAAAACTTGTTGG - Intronic
986658464 5:10038208-10038230 ATAGGATGGTGGAGACTTGTGGG - Intergenic
989306449 5:39962462-39962484 CTGGTATGGAGCACACTTTGAGG - Intergenic
997351887 5:133236770-133236792 CAAGGTTGGAGCAGACTTGCAGG - Intronic
998317609 5:141198114-141198136 CTAGTAGGTACCAGACTTGGAGG - Intergenic
999601344 5:153269592-153269614 CTAGTTAGGAGCAGAGTTGAAGG + Intergenic
1001162562 5:169333862-169333884 CTAGTCTGCAGGAGGCTTGTAGG - Intergenic
1003828057 6:9974585-9974607 GAAGTAGGGGGCAGACTTGTGGG - Intronic
1006039438 6:31241873-31241895 CTAGAATGGAGCAAACTTTCAGG - Intergenic
1030474056 7:110005644-110005666 CAAGAATAGACCAGACTTGTGGG + Intergenic
1034089270 7:148349073-148349095 CTTTTATGGAGCTGACTTGCTGG + Intronic
1042860608 8:73309478-73309500 CTAGAATATATCAGACTTGTTGG + Intronic
1048319838 8:133389814-133389836 CTAATATGGAGCAGACTTCATGG + Intergenic
1048949496 8:139483612-139483634 CTATCATGGAGAAGACTTGCAGG - Intergenic
1050228991 9:3497030-3497052 TCAGTATGAAGCAGATTTGTGGG - Intronic
1050248644 9:3719554-3719576 CCAGTATGGAGGAGAGTTGTAGG + Intergenic
1055778145 9:79788882-79788904 CTAATATAAATCAGACTTGTAGG - Intergenic
1188077514 X:25796897-25796919 AAAGAATGGAGCAAACTTGTGGG + Intergenic
1188693479 X:33158665-33158687 CTGTTATGGAGCAGGCCTGTTGG + Intronic
1196170925 X:112587728-112587750 GTAGTATGGAGAAGAATTGCTGG - Intergenic
1197629168 X:128838021-128838043 CTAGTATGAAGTAGAATAGTAGG - Intergenic
1198264581 X:134997580-134997602 CTAGTAGAGATCAGAGTTGTAGG + Intergenic