ID: 945594341

View in Genome Browser
Species Human (GRCh38)
Location 2:211773178-211773200
Sequence CCTTGGTAGCAGAGGCTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 362
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 333}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945594334_945594341 0 Left 945594334 2:211773155-211773177 CCCAGCTGTGACATGACGGGAGT 0: 1
1: 0
2: 0
3: 6
4: 91
Right 945594341 2:211773178-211773200 CCTTGGTAGCAGAGGCTGGGAGG 0: 1
1: 0
2: 2
3: 26
4: 333
945594331_945594341 5 Left 945594331 2:211773150-211773172 CCTAGCCCAGCTGTGACATGACG 0: 1
1: 0
2: 0
3: 15
4: 119
Right 945594341 2:211773178-211773200 CCTTGGTAGCAGAGGCTGGGAGG 0: 1
1: 0
2: 2
3: 26
4: 333
945594335_945594341 -1 Left 945594335 2:211773156-211773178 CCAGCTGTGACATGACGGGAGTC 0: 1
1: 0
2: 0
3: 3
4: 51
Right 945594341 2:211773178-211773200 CCTTGGTAGCAGAGGCTGGGAGG 0: 1
1: 0
2: 2
3: 26
4: 333

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945594341 Original CRISPR CCTTGGTAGCAGAGGCTGGG AGG Intronic
900236656 1:1594815-1594837 ACTTGGTGGCCCAGGCTGGGTGG - Intergenic
901152323 1:7112100-7112122 CCTTTGTAGGGGAGGCTGTGTGG + Intronic
901207259 1:7504209-7504231 CCTGGGCAGCAGAGCCTGGCAGG - Intronic
902975322 1:20084257-20084279 CTTTGCAGGCAGAGGCTGGGCGG - Intronic
903366327 1:22807545-22807567 CCATGGGGGTAGAGGCTGGGAGG - Intronic
903620680 1:24695907-24695929 CCTTGGTAGGACAGGCTATGGGG - Intergenic
904381898 1:30117037-30117059 CCTTGGTGACAGAGCCTTGGGGG + Intergenic
905267490 1:36764872-36764894 CCTTGGCTGAAGAGGGTGGGTGG - Intergenic
905282722 1:36859492-36859514 CCTAGGTAGCAGGGGTGGGGTGG - Intronic
906061745 1:42953488-42953510 CCATGATGGCGGAGGCTGGGAGG - Intronic
906544203 1:46609967-46609989 CCTTGGTAGGGGAGGGTGGTAGG + Intronic
906960198 1:50415549-50415571 GCCTGGTAGCAGGGGCAGGGGGG - Intergenic
907219438 1:52895268-52895290 CCTTGGTACCAGAGGAGGGAGGG + Intergenic
907773860 1:57493300-57493322 GGTTGGTACCAGGGGCTGGGGGG - Intronic
910548617 1:88450105-88450127 CCTTGTCAGCAAAGGCTGAGTGG - Intergenic
913090287 1:115472143-115472165 CAATGGGAGCAGAGGCAGGGAGG - Intergenic
913253902 1:116937172-116937194 CCTTGGGAGCAGAGCATGGCTGG + Intronic
914778707 1:150763266-150763288 GGTGGTTAGCAGAGGCTGGGCGG + Intronic
915367233 1:155323234-155323256 CCCTGGTAGAAGGGGCGGGGAGG - Intronic
916813135 1:168323792-168323814 CATCTGTAGGAGAGGCTGGGAGG - Intergenic
916857239 1:168762646-168762668 CGTTGGTTGCAGAAGCTGGAAGG + Intergenic
919893691 1:201994740-201994762 CCTGGGTGGCAGAGGTTGCGGGG - Intronic
920171516 1:204074851-204074873 CCTCGGTGACAGAGGCTTGGAGG + Intronic
920354014 1:205356890-205356912 CCTTTGCAGCTGAGACTGGGTGG - Intronic
922086958 1:222358681-222358703 GCTGGTTACCAGAGGCTGGGAGG + Intergenic
922236565 1:223726762-223726784 CATTTGTATCAGGGGCTGGGAGG - Intronic
922239249 1:223744783-223744805 CCTGGGAGGCAGAGGTTGGGAGG + Intronic
924324314 1:242880268-242880290 GCTTGGTAGCCTAGGCTGGAGGG + Intergenic
1063629909 10:7723578-7723600 CCTTGTTTGCAGTGGTTGGGGGG + Intronic
1063878403 10:10505671-10505693 TCATAGTAGCAGAGGCTGAGTGG - Intergenic
1065470949 10:26081139-26081161 CCCTGGTAGCGGGGGCGGGGGGG - Intronic
1065854015 10:29815146-29815168 TCTTGGTTGCACAGGCTGGTCGG - Intergenic
1067335172 10:45355809-45355831 CCTTAATAGTAGAGGCTGAGTGG - Intergenic
1067582201 10:47452854-47452876 CCTTGGGTGCAGGGGCTGGCGGG - Intergenic
1068427921 10:56891740-56891762 CCTGGGAGGCAGAGGTTGGGAGG - Intergenic
1069089308 10:64180102-64180124 CCCTGGTTGCAGACGGTGGGTGG + Intergenic
1069616387 10:69809019-69809041 CCTTGGGAGTAGAGGATGGGAGG - Intronic
1070190079 10:74104231-74104253 GTTTGGTTTCAGAGGCTGGGAGG + Intronic
1070842210 10:79495049-79495071 CTCTGGTAGCTGAGGATGGGAGG - Intergenic
1072783408 10:98265150-98265172 GCTTGAGAGCACAGGCTGGGCGG + Intronic
1073297776 10:102451275-102451297 CCTTGGGACAAGAGGCTAGGCGG - Intronic
1073564727 10:104525405-104525427 CCTTGAGAGCAGAGGATGAGGGG - Intergenic
1074258579 10:111828931-111828953 ATTTGGTAGCCGCGGCTGGGAGG - Intergenic
1074766113 10:116701119-116701141 CCTTGGTGGCAGGCGATGGGAGG - Exonic
1074956623 10:118397100-118397122 ACCAGGTAGCAGAGGCTGAGGGG + Intergenic
1075071137 10:119320691-119320713 CCCTGAGAGCAGAGGCAGGGAGG + Intronic
1075076406 10:119353620-119353642 CTCTGGCAGCAAAGGCTGGGTGG + Intronic
1075583941 10:123643722-123643744 ACTTGATACCTGAGGCTGGGAGG - Intergenic
1075985353 10:126780281-126780303 CATCGGTAGCATGGGCTGGGTGG - Intergenic
1076492703 10:130873844-130873866 CCTGGGCAGCAGAGGCCGAGTGG + Intergenic
1077034881 11:489788-489810 GCTGGGGAGCAGAGCCTGGGAGG + Intronic
1077130233 11:968370-968392 CCGCGGGAGCAGAGGCTGGTCGG + Intronic
1077402327 11:2365352-2365374 CCCTGGTCCTAGAGGCTGGGAGG + Intergenic
1077435139 11:2535332-2535354 CCTTGGCAGCTGAAGCTGGGTGG - Intronic
1077745195 11:4895678-4895700 CTTTGGTAGCACAAGGTGGGAGG + Intronic
1077883233 11:6367311-6367333 CATTGGGAACAGAGACTGGGGGG - Intergenic
1078066489 11:8082295-8082317 GCCTGGCAGCAGAGGGTGGGGGG - Intronic
1078152263 11:8769311-8769333 CCTGGGAAGCAGAGGTTGCGGGG - Intronic
1079127875 11:17731707-17731729 CTTTGGTAGCTGGGGCTGGTGGG - Intergenic
1080938318 11:36885522-36885544 CCATGGTAGCAGAGGAGGAGAGG - Intergenic
1081739694 11:45430077-45430099 CCTTGGAATAAGAGTCTGGGAGG - Intergenic
1083304873 11:61756928-61756950 CCCTGGCAGCAGAGGCTGCTGGG + Intronic
1083324353 11:61865930-61865952 CCTTGGAAGAAGGGGCTAGGAGG - Exonic
1083404998 11:62450652-62450674 CGGTGGGAGCAGAGGCTTGGAGG - Intronic
1083551263 11:63591819-63591841 GCCTGGGAGCTGAGGCTGGGTGG - Intronic
1083764523 11:64835594-64835616 CGTTGGTCTCAGAGGCTGTGTGG + Exonic
1084256224 11:67944714-67944736 CCCTGTTAGCAGGGGCTGGGGGG + Intergenic
1084287860 11:68143270-68143292 CCTTGGCAGCAGGAGCTGGATGG + Intergenic
1084434293 11:69129812-69129834 CGATGGAAGCAGAGGTTGGGGGG + Intergenic
1084816533 11:71650585-71650607 CCCTGTTAGCAGGGGCTGGGGGG - Intergenic
1084949708 11:72657912-72657934 CCCTGCTCACAGAGGCTGGGTGG - Intronic
1084967694 11:72752906-72752928 CCTTGGGAGGTGTGGCTGGGTGG - Intronic
1087789376 11:102391082-102391104 CCTTGGCAGCAGAGCCGGGATGG - Intergenic
1088603627 11:111507843-111507865 CCTTGATAGCAGGGACTGGTAGG + Intronic
1089064758 11:115654085-115654107 CCTGGGCGGCCGAGGCTGGGTGG - Intergenic
1089327695 11:117668637-117668659 CATTGGTAGGAGAGTCAGGGAGG - Intronic
1089589432 11:119531151-119531173 CCCTGGGTGCTGAGGCTGGGAGG - Intergenic
1089621082 11:119722602-119722624 CCTAGGCAGCAGGTGCTGGGTGG - Intronic
1089630315 11:119780124-119780146 CCCTGGAGGCAGGGGCTGGGGGG + Intergenic
1091776527 12:3188463-3188485 CCTGGGTGGCAGAGGAAGGGAGG + Intronic
1091960689 12:4691718-4691740 CCCTGGAAGCAGAGGGTGGTGGG + Exonic
1092123709 12:6061585-6061607 CCTGGGTGGCAGGGGCAGGGTGG - Intronic
1092150100 12:6242090-6242112 CCTTGGGAGGAGAGTCCGGGGGG - Intergenic
1092426456 12:8379445-8379467 CCCTGTTAGCAGGGGTTGGGGGG + Intergenic
1092578988 12:9819360-9819382 CCTTGCTACCAGTGGCTGGCTGG - Intergenic
1095983150 12:47984035-47984057 CCCTGGGGGCAGGGGCTGGGAGG - Intronic
1096120900 12:49089012-49089034 CCTTGGTGGCAGGGCCTGGATGG - Intergenic
1097168195 12:57096817-57096839 GCTTGGGAGTGGAGGCTGGGTGG - Intronic
1098403098 12:70094551-70094573 CCTTAGTGGCAGAGACTGGTAGG - Intergenic
1100692024 12:97048247-97048269 CCTGAGTAGCAGACGCTTGGTGG + Intergenic
1100836467 12:98571474-98571496 CCTGGGAGGCAGAGGCTGTGTGG - Intergenic
1101003590 12:100380121-100380143 CCTGGGAAGCAGAGGTTGCGGGG + Intronic
1103395061 12:120600933-120600955 ACATGGTGGCAGAGGCGGGGAGG - Intergenic
1104540056 12:129655675-129655697 ACTTTGTTGCAGTGGCTGGGAGG - Intronic
1104663966 12:130634224-130634246 CCTTGGGAGCGGAGACGGGGAGG + Intronic
1107159004 13:37203878-37203900 CCTGGGTAGCAGAGGTTGCAGGG - Intergenic
1107549965 13:41464945-41464967 CCTGGGCAGGAGAGGGTGGGGGG + Intronic
1107686878 13:42909753-42909775 CATGGTTACCAGAGGCTGGGGGG + Intronic
1109094169 13:58090006-58090028 CGTGGTTACCAGAGGCTGGGAGG + Intergenic
1110471723 13:75867041-75867063 CATAGGTAGCAGAGACTAGGAGG + Intergenic
1111584724 13:90269579-90269601 CTTTGGTAGACGAGGATGGGTGG + Intergenic
1112558197 13:100488528-100488550 CCTTGGAGGCTGAGGCTGGAGGG + Intronic
1113627836 13:111859450-111859472 CCTGAGCAGGAGAGGCTGGGGGG - Intergenic
1116665590 14:47770266-47770288 AATAGGTACCAGAGGCTGGGTGG + Intergenic
1117438204 14:55737600-55737622 CCTTTGGAGAAGAGCCTGGGTGG - Intergenic
1117763539 14:59058217-59058239 ACTTGGTGGGAGAGGTTGGGTGG - Intergenic
1119552478 14:75525062-75525084 CCTGGGAAGCAGAGACGGGGAGG - Exonic
1119952184 14:78756475-78756497 CCTGGGTGACAGAGCCTGGGTGG + Intronic
1120393977 14:83944435-83944457 CCATGGCTGGAGAGGCTGGGAGG + Intergenic
1122141837 14:99667383-99667405 CCCTGGCAGCAGGGGTTGGGAGG + Intronic
1122425808 14:101604724-101604746 CCACGGTAGCAGAGTCTTGGGGG - Intergenic
1122718951 14:103711692-103711714 CCTTCCTGGGAGAGGCTGGGTGG - Exonic
1123047635 14:105526593-105526615 CAGTGGCGGCAGAGGCTGGGCGG + Exonic
1124237671 15:28004010-28004032 CCTGGGTGGCAGCGGCTGGACGG - Intronic
1126042159 15:44601881-44601903 CATTGGTGAAAGAGGCTGGGTGG - Intronic
1128085512 15:64883795-64883817 CCTTGGGAGCAGATGCTGATGGG + Intronic
1130208686 15:81902446-81902468 GCTAGGAAGCAGAGGCTGGGAGG + Intergenic
1130653501 15:85775786-85775808 CCTGGGTTGCAGAGGCTGTGGGG + Intronic
1131040922 15:89266102-89266124 CTTGGGAAGCAGAGGCTGGAGGG - Intronic
1131314154 15:91318038-91318060 CTGTGGAAGCAGAGGCTGGAGGG - Intergenic
1131383532 15:91983761-91983783 CCCTGGTAGCAGAAACAGGGTGG + Intronic
1131447623 15:92513034-92513056 CATTGGGAACAGAGACTGGGGGG - Intergenic
1132581466 16:686592-686614 CCTTGGTAGCTGAGGGTGTCAGG - Intronic
1133061901 16:3180318-3180340 CCTTGATAGCAGAGGCCCTGGGG - Intergenic
1133155504 16:3872456-3872478 CCTTGGGAGCAGTGCCTGTGGGG - Intronic
1133338248 16:5020586-5020608 GCTGGGGAGCAGAAGCTGGGTGG - Intergenic
1133371839 16:5251128-5251150 CCCTGTTAGCAGGGGCTGGGGGG - Intergenic
1135101163 16:19607248-19607270 CCTTGGTACCAGGGGCTAGCTGG - Intronic
1136269779 16:29141716-29141738 CCTGGGACGCCGAGGCTGGGTGG + Intergenic
1136376391 16:29867980-29868002 CCTTGCTGGCTGAGGCTGGAGGG - Intergenic
1137713488 16:50583410-50583432 CCTTGGTAGGGGTGGCTGGAAGG - Intronic
1138556962 16:57776361-57776383 ACTTGGCAACAGAGGCAGGGTGG - Intronic
1139099164 16:63744510-63744532 CCCTGGTAGCTGTGGCTGTGTGG - Intergenic
1139853367 16:69963435-69963457 CCTTCCTAGCAGAGGCTGCTGGG - Intronic
1139882336 16:70186344-70186366 CCTTCCTAGCAGAGGCTGCTGGG - Intronic
1140370173 16:74409160-74409182 CCTTCCTAGCAGAGGCTGCTGGG + Intronic
1140378918 16:74468917-74468939 TTCTGGGAGCAGAGGCTGGGAGG + Intronic
1141675632 16:85515841-85515863 CCTTGGCAGAAGAGGCAGGAGGG - Intergenic
1141700327 16:85639331-85639353 TCCTGGTAGGAGAGGCAGGGAGG - Intronic
1141788888 16:86219581-86219603 CCTGGGCAGCACAGGGTGGGAGG - Intergenic
1142073403 16:88103647-88103669 CCTGGGATGCCGAGGCTGGGTGG + Intronic
1142537898 17:632671-632693 GCTGGGTCCCAGAGGCTGGGAGG - Intronic
1143775357 17:9195518-9195540 CCTTGCTGGCAGAGGCTGGCAGG + Intronic
1143860858 17:9889718-9889740 CCCTGGGAGCAGAGCCAGGGTGG - Exonic
1146498922 17:33347780-33347802 CATGGGTAGCGGAGGCAGGGTGG + Intronic
1147265452 17:39231788-39231810 CCTTGGTAACAGATGCTTTGTGG - Intergenic
1147384724 17:40074384-40074406 CCTGGGTGGCAGGGGGTGGGTGG + Exonic
1147924090 17:43936041-43936063 TGTGGGTAGCAGAGGCAGGGAGG - Intergenic
1148486814 17:47996123-47996145 CCTTGGGAGCAGATGGTGGGAGG - Intergenic
1150207117 17:63417430-63417452 CCCTGGAAACAGAGACTGGGGGG - Intronic
1150656863 17:67045002-67045024 CCTGGGCAGAAAAGGCTGGGCGG - Intronic
1151328680 17:73394145-73394167 CCTTGGATGGAGAGGCTGGAGGG + Intronic
1151827072 17:76529616-76529638 CTTTGGCAGCAGAGCCTGCGTGG + Intronic
1152378010 17:79928654-79928676 CCTTGGGAGGTGAGGGTGGGAGG - Intergenic
1152395716 17:80031605-80031627 CCTTGGAGGCAGAGGCTTTGGGG - Intronic
1152646978 17:81473782-81473804 CCTTGGTTGCAGGGGCAGGGTGG - Intergenic
1160810470 19:1010939-1010961 CTCTGGGAGCAGCGGCTGGGTGG - Intronic
1160859247 19:1230754-1230776 CCTTGGGAGCATGGGCGGGGCGG + Exonic
1162363839 19:10236068-10236090 ACTTGGTAGAAGAGGCAGTGAGG - Intergenic
1163267911 19:16232750-16232772 CCTGGGGAGCAGAGACTGTGGGG + Intronic
1164208964 19:23081176-23081198 ACTTTGTTGCAGAGGCTGGAGGG + Intronic
1164477193 19:28584952-28584974 CATTGGGACCTGAGGCTGGGGGG + Intergenic
1165109532 19:33493721-33493743 CCTAGGAACCAGAGGCTGGTAGG - Intronic
1165197509 19:34116474-34116496 CCGTGCCAGCAGATGCTGGGTGG - Intergenic
1165232407 19:34395284-34395306 CTTGGGAGGCAGAGGCTGGGGGG + Intronic
1165777741 19:38414809-38414831 CCTTGGAAGCCCAGCCTGGGCGG + Intronic
1166228762 19:41413457-41413479 GCTTGGTAGCAGAGGGAGGCGGG - Intronic
1167295062 19:48645105-48645127 GCTAGGAACCAGAGGCTGGGTGG - Intronic
1167303269 19:48692148-48692170 CCTGGGAGGCAGAGGCGGGGTGG - Intergenic
1167574856 19:50313036-50313058 CCGTGGGAGCAGAGGGAGGGAGG + Intronic
926531306 2:14049665-14049687 CCTTGAGGGCAGAGGGTGGGAGG - Intergenic
929078441 2:38097720-38097742 GCTGGGAAGGAGAGGCTGGGTGG - Intronic
929559652 2:42948057-42948079 TGTTGGGAGCTGAGGCTGGGCGG - Intergenic
929906896 2:46054450-46054472 CCTAGTGAGCAGAGGCTGAGGGG - Intronic
930090103 2:47525698-47525720 CCTAGGAAGAAGAGGCTGAGGGG + Intronic
930284294 2:49408924-49408946 CCTTGGAAGCAGAGCCTGGGAGG - Intergenic
931027629 2:58131108-58131130 CAATGGTATCAGAGGCTGGGGGG - Intronic
932751291 2:74373335-74373357 CCTTGGGAGTGGTGGCTGGGCGG - Intronic
933936890 2:87213336-87213358 ACTTGTTAGCAAAGGCTGAGTGG - Intergenic
936007018 2:108898167-108898189 CCAGGGTAGCAAAGGCTGAGTGG + Intronic
936356253 2:111752489-111752511 ACTTGTTAGCAAAGGCTGAGTGG + Intergenic
937141969 2:119609774-119609796 ACTTGGCAGCAGTGGATGGGTGG + Intronic
938069854 2:128302677-128302699 CCGTGGTGGCAGGGGCTTGGTGG - Intronic
938364824 2:130726678-130726700 CCTTGGGTGCAGACGCGGGGTGG - Intergenic
938471279 2:131564721-131564743 AGTGGGTACCAGAGGCTGGGGGG - Intergenic
939407296 2:141774730-141774752 GCCTGGTAGCAGAGGTTGGATGG - Intronic
940885317 2:158984796-158984818 CGTAAGAAGCAGAGGCTGGGAGG + Intronic
942461383 2:176171113-176171135 CCCTGGCAGCAGAGGCTGGGAGG + Intronic
944406729 2:199393118-199393140 CATTTGTAGCAGAGGGTGGGTGG - Intronic
945594341 2:211773178-211773200 CCTTGGTAGCAGAGGCTGGGAGG + Intronic
946965357 2:225031417-225031439 CCTTGGTATCAGTTGCTAGGAGG + Intronic
947406120 2:229779378-229779400 TGTTGGGAGCAGATGCTGGGGGG - Intronic
948089735 2:235282815-235282837 GCTTGGTTGCAGTTGCTGGGTGG - Intergenic
948399547 2:237673694-237673716 CATTGGCAGCAGTGGCGGGGAGG + Intronic
949026404 2:241768306-241768328 CCTGGGGAGCAGGCGCTGGGTGG + Exonic
1169579762 20:7006995-7007017 GGTTGTTAGCAGAGGCTGGCAGG + Intergenic
1169843242 20:9962510-9962532 CCTTGGCAACACAGGCTGGTGGG + Intergenic
1170269990 20:14515683-14515705 ACTGGTTAGCAGAGGCTGGATGG + Intronic
1170527995 20:17260367-17260389 CCATGGCAGCAGAGATTGGGAGG - Intronic
1171292644 20:23990996-23991018 CCTGTGCAGCAGATGCTGGGGGG - Intergenic
1171294231 20:24003690-24003712 CCTGGCAAGCAGAGGCAGGGCGG - Intergenic
1172011985 20:31850903-31850925 CATTGGGAGAAGAGGCTGTGAGG + Intronic
1172174527 20:32964164-32964186 CCTGGGAAGCTGAGGCGGGGAGG - Intergenic
1173697564 20:45032418-45032440 CCTTGAGGGCAGAGGGTGGGAGG - Intronic
1173923809 20:46765640-46765662 CCTTGGCAGCAGGCGGTGGGAGG + Intergenic
1174120244 20:48259636-48259658 CCTTTGGGGCAGAGACTGGGAGG - Intergenic
1174281964 20:49445870-49445892 GCATGGTTGCTGAGGCTGGGTGG + Intronic
1175385018 20:58589308-58589330 CCCTGGCAGCACAGACTGGGCGG + Intergenic
1175390139 20:58621925-58621947 CTTTAGTAGCAGGGCCTGGGAGG - Intergenic
1175762390 20:61570485-61570507 CCTTGAGAGCAGGGGCTGCGAGG - Intronic
1175885541 20:62288384-62288406 CTGTGGGTGCAGAGGCTGGGAGG + Intronic
1175885547 20:62288407-62288429 CTGTGGGTGCAGAGGCTGGGAGG + Intronic
1175885553 20:62288430-62288452 CTATGGGTGCAGAGGCTGGGAGG + Intronic
1175885565 20:62288475-62288497 CTGTGGGTGCAGAGGCTGGGAGG + Intronic
1175885577 20:62288520-62288542 CTGTGGGTGCAGAGGCTGGGAGG + Intronic
1175885589 20:62288565-62288587 CTGTGGGTGCAGAGGCTGGGAGG + Intronic
1175943816 20:62549772-62549794 CCTTGGTGGCAGGGCCTGGCTGG + Intergenic
1177739530 21:25136794-25136816 CCTGGTTAGAAGTGGCTGGGGGG - Intergenic
1179046810 21:37852101-37852123 CCTGGAAAGCAAAGGCTGGGTGG + Intronic
1179725520 21:43339503-43339525 CCTTGTAGGCAGAGGCTGAGGGG - Intergenic
1180139810 21:45886517-45886539 CCTTGGTACCAGAGGCAATGAGG - Intronic
1180154252 21:45970566-45970588 CCTTGGCTGCAGGGACTGGGTGG - Intergenic
1180823708 22:18848760-18848782 CCTGTGCAGCAGATGCTGGGGGG - Intronic
1181123937 22:20690930-20690952 CCTCTGTAGCAGATGCTAGGGGG - Intergenic
1181189028 22:21125786-21125808 CCTGTGCAGCAGATGCTGGGGGG + Exonic
1181210172 22:21284709-21284731 CCTGTGCAGCAGATGCTGGGGGG - Intergenic
1181463822 22:23100233-23100255 CCCTGGTAGCAGAGGCTTTGTGG - Intronic
1182361556 22:29749459-29749481 CCTTGGGTGCAAAGGCCGGGAGG - Intronic
1182889827 22:33808449-33808471 CCTTGGTGGTAGGGGCAGGGAGG - Intronic
1183358495 22:37371697-37371719 CCATGGTGACAGAGGCTGGCTGG + Exonic
1183571492 22:38656607-38656629 CCTCGGTGGTAGAGGCCGGGCGG + Intronic
1183572877 22:38667414-38667436 CTTGGGAAGCTGAGGCTGGGGGG - Intronic
1184238315 22:43198329-43198351 CCATCGCAGCAGATGCTGGGAGG + Exonic
1185046644 22:48531783-48531805 TCCTGGGAGGAGAGGCTGGGAGG + Intronic
1185067772 22:48640601-48640623 CATTTCTTGCAGAGGCTGGGCGG + Intronic
1203216777 22_KI270731v1_random:10724-10746 CCTGTGCAGCAGATGCTGGGGGG + Intergenic
950265252 3:11568683-11568705 CCTGGGAAGCAGTGGCCGGGAGG - Intronic
950896862 3:16460568-16460590 CATTTCAAGCAGAGGCTGGGTGG + Intronic
952555795 3:34529122-34529144 GCTTCGTACCAGTGGCTGGGGGG - Intergenic
952820132 3:37479472-37479494 CCTTGGTGGCAGTGGCTTGAAGG + Intronic
953040732 3:39252902-39252924 CCTGGGGAGGAGTGGCTGGGAGG + Intergenic
954443464 3:50534224-50534246 CCCTGGCAGCAGAGGTGGGGAGG + Intergenic
955596916 3:60601031-60601053 CCCTGCCAGCAGAGGCTGGAAGG + Intronic
955950485 3:64238192-64238214 ACTTGGTAGTATTGGCTGGGTGG + Intronic
956096099 3:65717958-65717980 CCATGGTAGTAGAAGCTTGGGGG - Intronic
956699287 3:71944614-71944636 CCCAGGGAGCAGTGGCTGGGAGG - Intergenic
957274758 3:78076535-78076557 CCTGGTTTGCAGAGGTTGGGAGG + Intergenic
961282976 3:125777973-125777995 CCCTGTTAGCAGGGGCTGGGGGG - Intergenic
962458020 3:135583108-135583130 CAGTGACAGCAGAGGCTGGGTGG - Intergenic
962866711 3:139453233-139453255 CCTTGGTATCTGGGGGTGGGAGG + Intronic
963281409 3:143387992-143388014 CCCTGGTGACAGGGGCTGGGTGG + Intronic
964714761 3:159710360-159710382 CTCTGGTACCAGAGGCTGGTTGG + Intronic
964893953 3:161571692-161571714 ACTTGGGAGCAGAGGCTAGGAGG - Intergenic
966061356 3:175760352-175760374 CCTTGAAAACAGAGGCTGTGAGG - Intronic
966289146 3:178334475-178334497 CGGTGGTAGCAGGGGTTGGGGGG + Intergenic
966330606 3:178808086-178808108 CCTTGGAAGAATAGCCTGGGAGG + Intronic
966516159 3:180822903-180822925 CCTTGAAGGCAGAGGGTGGGAGG + Intronic
967768633 3:193310016-193310038 ACTTGAGAGCAGAGGGTGGGAGG - Intronic
969739200 4:9011992-9012014 CCCTATTAGCAGGGGCTGGGGGG - Intergenic
969798388 4:9543505-9543527 CCCTGTTAGCAGGGGCTGTGGGG - Intergenic
970309676 4:14768855-14768877 CATTTGTAGCAGATGCTGCGGGG - Intergenic
971234607 4:24829782-24829804 GCTTGGGTGCAGCGGCTGGGGGG - Intronic
971260480 4:25052418-25052440 CTTCTCTAGCAGAGGCTGGGAGG + Intergenic
971260485 4:25052468-25052490 CTTCTCTAGCAGAGGCTGGGAGG + Intergenic
981151654 4:141385601-141385623 CCTTGGAAGCAGAGACAGAGTGG - Intergenic
984729851 4:183057804-183057826 CTTTGGGTGCAGAGGATGGGAGG - Intergenic
984833763 4:184000159-184000181 CAGTAGAAGCAGAGGCTGGGAGG - Intronic
985585656 5:732462-732484 CTTTGGTGGCTGAGTCTGGGCGG + Intronic
985766007 5:1779926-1779948 CCCTGGAAGGACAGGCTGGGTGG - Intergenic
985776688 5:1848033-1848055 TGCTGGTAGGAGAGGCTGGGTGG + Intergenic
987115209 5:14721025-14721047 CCTTTGGAGCAGTGGGTGGGGGG + Intronic
987320930 5:16768782-16768804 GCTTGGGAGGAGAGGGTGGGAGG - Intronic
988342152 5:29986427-29986449 CCTGGGAAGCAGAGGCTGAAGGG + Intergenic
988654847 5:33198660-33198682 GCTGGTTACCAGAGGCTGGGAGG - Intergenic
990751532 5:59021984-59022006 CCCTGGTAGCAGAGGATGGTGGG - Intronic
994912527 5:105930856-105930878 GCTTGGTAGCATATGCTGGTAGG - Intergenic
996250000 5:121317650-121317672 CATTGGTGGCAGAGGCTTTGTGG + Intergenic
998943647 5:147313157-147313179 CCTTGGAAGTGGAGGCTGCGGGG + Intronic
1001503480 5:172257135-172257157 CCTTGAGGGCAGAGGATGGGAGG - Intronic
1001570549 5:172727748-172727770 CCTTTGCTGCAGAGGCTCGGGGG - Intergenic
1001943288 5:175755881-175755903 CCTGGGAAGCAGAGGCTGCAGGG + Intergenic
1002101086 5:176857995-176858017 CCTTGGTTGCAGTGGCTCGTGGG - Intronic
1002924759 6:1599029-1599051 CCTGGGGAGCAGAGGCTGCCTGG - Intergenic
1006423875 6:33951680-33951702 CCTTTGTAGCACAAGCTTGGGGG - Intergenic
1006912407 6:37571962-37571984 CTCTGGCAGCTGAGGCTGGGAGG - Intergenic
1011917156 6:92521393-92521415 TATTGTTAGCAAAGGCTGGGAGG + Intergenic
1012490730 6:99780181-99780203 CACTGGAAGCAGAGGCAGGGTGG + Intergenic
1012939754 6:105403497-105403519 CCTTGGAAGCAGAGGGCTGGAGG + Intergenic
1013368434 6:109451565-109451587 CCTGGCCAGGAGAGGCTGGGTGG - Intronic
1013846500 6:114459241-114459263 CCTTGGTAGGCGTGGTTGGGAGG + Intergenic
1014889174 6:126821421-126821443 AGTTGGCAGCAGAGGGTGGGAGG + Intergenic
1015291809 6:131546162-131546184 CCTTTGTTGCAAGGGCTGGGTGG - Intergenic
1015708882 6:136117844-136117866 CCATGGTAGAAGAGGCAGAGAGG - Intronic
1017221537 6:151971139-151971161 CCTAGCTAGCAGAGACTTGGGGG + Intronic
1018684344 6:166291962-166291984 CCTTGGTTCCAGCTGCTGGGAGG + Intergenic
1019626545 7:2018778-2018800 CACTGGTGGCAGAGGCCGGGCGG - Intronic
1022012957 7:26324996-26325018 CATTGGTCTCAGAGGATGGGTGG + Intronic
1022129399 7:27390556-27390578 CCTGGGTAGCTGAGGCGGGGAGG + Intergenic
1026901424 7:74039518-74039540 CCTTGGTGACAGAGGGTGGGTGG + Intronic
1029073412 7:97918078-97918100 CCCTGTTAGCAGGGGCTGGGGGG + Intergenic
1034045264 7:147920681-147920703 CCTTGGAAACACAGGGTGGGTGG + Intronic
1034776368 7:153830653-153830675 GCTTGGTAACAGTGGCTGTGGGG + Intergenic
1034840113 7:154387699-154387721 CTTTGGCAGCAGGGGCTGTGGGG - Intronic
1034989221 7:155537246-155537268 CCTCGGAAGGAGAGGCTGGAAGG - Intergenic
1035333339 7:158110767-158110789 GCTTGGTCGCAGAGACTGGGTGG - Intronic
1035459625 7:159030935-159030957 CCTTGGGGGCAGAGGCTGGAGGG + Intronic
1035546133 8:483648-483670 CCGTGGTATCTGGGGCTGGGTGG + Intergenic
1035785121 8:2253927-2253949 TCTGGGTAGCAGATGCTGGGTGG - Intergenic
1035807690 8:2467789-2467811 TCTGGGTAGCAGATGCTGGGTGG + Intergenic
1036244277 8:7103212-7103234 ACCTGTTAGCAGGGGCTGGGGGG - Intergenic
1036641291 8:10585663-10585685 CCTTGGCAGCTGAGGATGGGAGG - Intergenic
1036707717 8:11057579-11057601 CCACGGTCACAGAGGCTGGGCGG + Intronic
1036897556 8:12648197-12648219 CCCTGTTAGCAGGGGCTGGGGGG + Intergenic
1037748215 8:21663016-21663038 GCTTGGTAGGGGAGGGTGGGGGG - Intergenic
1038553736 8:28491769-28491791 CCTTGGGGGCAGAGGCGGTGAGG + Intergenic
1040410063 8:47144976-47144998 AGTGGGTACCAGAGGCTGGGGGG + Intergenic
1041113154 8:54506689-54506711 CCTGGACAGCAGAGGCAGGGCGG - Intergenic
1041327382 8:56682710-56682732 CCTTGGTGGGTGAGGCGGGGAGG + Intergenic
1041976696 8:63807278-63807300 GATGGTTAGCAGAGGCTGGGGGG + Intergenic
1045322582 8:101093122-101093144 CCTTTGTAGCAAAGACTGGAAGG - Intergenic
1046223428 8:111245090-111245112 GCGTGGTAGCAGAGGGTGGATGG + Intergenic
1046720385 8:117612485-117612507 CCTGGGAGGCAGAGGTTGGGAGG - Intergenic
1046748025 8:117896941-117896963 ACATGGAGGCAGAGGCTGGGGGG - Intronic
1048716102 8:137272030-137272052 GCTTGGGGGCAGAGGGTGGGAGG + Intergenic
1049066263 8:140318538-140318560 GGTGGTTAGCAGAGGCTGGGAGG - Intronic
1049178075 8:141206230-141206252 TCTTGGGTGCAGAGTCTGGGCGG + Intergenic
1049277736 8:141728364-141728386 CCCGGGTAGCAGCAGCTGGGAGG - Intergenic
1049740431 8:144238387-144238409 CCGTGGCTGCCGAGGCTGGGTGG + Intronic
1050360620 9:4827363-4827385 CTGTGGTAGCTGAGGCTGGAGGG + Intronic
1050526482 9:6550904-6550926 CCTTTGTTGCAGATGATGGGAGG - Exonic
1051182910 9:14429742-14429764 CCATGGTAGCAGTGGTGGGGAGG - Intergenic
1053353061 9:37425676-37425698 CCTTGGTGGCAGAGGCCCTGAGG + Intronic
1056589112 9:87951422-87951444 TCTGGGTAGCACAAGCTGGGTGG - Intergenic
1056710401 9:88987953-88987975 TCCTGGAAGCAGATGCTGGGAGG + Intergenic
1056803324 9:89709111-89709133 CCATGCTAGGAGAGGCTGAGTGG - Intergenic
1056832862 9:89930848-89930870 CATAGGAAGCAGAGGCTGCGTGG + Intergenic
1057337081 9:94164717-94164739 GGTTGGTAGTAGAGGCTGGTGGG - Intergenic
1059755965 9:117293679-117293701 CCTTGGGTGCTAAGGCTGGGAGG - Intronic
1060020725 9:120128380-120128402 TCATGGTCACAGAGGCTGGGGGG + Intergenic
1060268820 9:122127321-122127343 CTTTGGGTGCTGAGGCTGGGGGG + Intergenic
1061234209 9:129333145-129333167 CCTGGGAGGCAGAGGCTGCGGGG - Intergenic
1061333749 9:129915201-129915223 CCTGGGTAGCAGCTGCTGGCTGG + Intronic
1061364294 9:130163388-130163410 CCTGGGAAGCAGAGGCTGCAGGG - Intergenic
1061566612 9:131444883-131444905 CCTTGGAAGCCGAGGGTGGCTGG + Intronic
1062014221 9:134283166-134283188 GGTTGGCAGCAGAGGCGGGGAGG - Intergenic
1062109873 9:134776455-134776477 ACTTGGAAGCAGAGGGTGGAAGG + Intronic
1062538258 9:137030326-137030348 CCTCGGTAGCAGAGGCCCTGTGG - Exonic
1185802990 X:3030161-3030183 GCTTGGAAGCAGAGGCAGGAAGG + Intronic
1189104312 X:38220695-38220717 CCTGGGAAGCTGCGGCTGGGCGG + Exonic
1189201226 X:39197253-39197275 CCTTCATGGCAGAGGCTGGATGG + Intergenic
1189310155 X:40013057-40013079 CCTTGGCCGGAGAAGCTGGGAGG - Intergenic
1189402829 X:40688139-40688161 CCTAGGAGGCAGAGGTTGGGAGG + Intronic
1192040899 X:67620406-67620428 CCTTGGTACTAGAGTCTAGGCGG - Intronic
1192547760 X:72027805-72027827 CCTTGGTAACCGAGGCAGGAAGG + Intergenic
1194226688 X:91269104-91269126 CATTGTTGCCAGAGGCTGGGAGG - Intergenic
1195022460 X:100843651-100843673 GCTTGATAGCAGAGGTTTGGTGG - Exonic
1195505019 X:105646892-105646914 CTTTGGGAGCAAAGGCTGGCTGG - Intronic
1197674524 X:129315050-129315072 CTTTGGTGCCAGGGGCTGGGAGG + Intergenic
1198344493 X:135746463-135746485 CCTTTGTAGCTGTAGCTGGGAGG - Intergenic
1199858110 X:151776911-151776933 CTGTGGGAGCAGAGGGTGGGTGG - Intergenic
1200070517 X:153526868-153526890 CCTTGGGAGTACAGGCTGGGGGG - Intronic
1201221858 Y:11779269-11779291 GCTTGGTAGCCTAGGCTGGAGGG + Intergenic