ID: 945598312

View in Genome Browser
Species Human (GRCh38)
Location 2:211824038-211824060
Sequence GAACACTCCATGCCCAAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 131}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945598312_945598313 6 Left 945598312 2:211824038-211824060 CCAGGCTTGGGCATGGAGTGTTC 0: 1
1: 0
2: 0
3: 11
4: 131
Right 945598313 2:211824067-211824089 AATCTGTATACTTTTCCTTATGG 0: 1
1: 0
2: 4
3: 34
4: 348

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945598312 Original CRISPR GAACACTCCATGCCCAAGCC TGG (reversed) Intronic
900465305 1:2822392-2822414 GCACCCCCCAAGCCCAAGCCCGG - Intergenic
901153765 1:7122067-7122089 GAACACTCCATGGCCTTTCCCGG - Intronic
901292241 1:8133170-8133192 GAATACGCCATCCCCAGGCCGGG - Intergenic
903773949 1:25781185-25781207 TTCCACTCCAGGCCCAAGCCAGG - Intronic
908775162 1:67632587-67632609 AGACACTCCAGCCCCAAGCCAGG + Intergenic
911605876 1:99904611-99904633 GACCACTCCACCCCCAACCCTGG + Intronic
917132330 1:171755508-171755530 GAACGCTCCTTGCCCCAGGCTGG - Intergenic
921702563 1:218284734-218284756 AAACCCTCCAGGCCCCAGCCGGG + Intergenic
923470124 1:234282764-234282786 GAACAACCCATGCCAATGCCAGG - Intronic
1063092530 10:2879806-2879828 GAACAGGCCATGACAAAGCCCGG - Intergenic
1063933221 10:11050464-11050486 CGACACTCCATGTTCAAGCCAGG - Intronic
1067415233 10:46097500-46097522 GAAGAGGCCATGCCCAAACCCGG + Intergenic
1069100502 10:64314514-64314536 GAATATTCCATGCCCAACACAGG - Intergenic
1070268019 10:74923594-74923616 GAACACTCCTTCTCCATGCCTGG - Intronic
1071291655 10:84193601-84193623 GGTCACTTCAAGCCCAAGCCAGG - Intergenic
1072262288 10:93690644-93690666 GAACAATCCATGAATAAGCCAGG + Intronic
1073518491 10:104101695-104101717 TAACACTCCATGGGTAAGCCTGG + Intergenic
1076111233 10:127861205-127861227 GAAGACACCATGCACGAGCCAGG + Intergenic
1077579450 11:3407521-3407543 CAACAACCCATGCTCAAGCCAGG - Intergenic
1078019236 11:7641407-7641429 GAACCCTTCTTCCCCAAGCCTGG - Intronic
1078543553 11:12229972-12229994 GAACAAACAATGCCCATGCCAGG - Intronic
1080178697 11:29396972-29396994 GAACACTCCATGTGAAAGTCTGG - Intergenic
1082281100 11:50272157-50272179 GAACTCTGCTTGCCCAAGCCTGG - Intergenic
1082805403 11:57446231-57446253 TCACACTCCTTGCCCAAGACTGG + Intergenic
1083722761 11:64611574-64611596 GAAGCCCCCATGCCCTAGCCTGG - Intronic
1085337029 11:75704151-75704173 GAACACCCCATGCAGTAGCCTGG - Intergenic
1088841279 11:113629642-113629664 GAAGACCCGATGCCCAAGGCAGG + Intergenic
1089325898 11:117656783-117656805 GTCCAGTCCATGCCCAGGCCAGG + Intronic
1089601226 11:119616607-119616629 GGATACTCCATGTCCAGGCCAGG + Intergenic
1096183816 12:49565689-49565711 GAACACTCCTTACCCCACCCTGG + Intronic
1097346845 12:58502768-58502790 GAACAGCCCCTGCCCAAGTCAGG + Intergenic
1099319748 12:81131249-81131271 GAACACTCCATGCTCATGGATGG - Intronic
1099944995 12:89234140-89234162 CAACACTCCATACCCCAGTCAGG - Intergenic
1100508336 12:95243080-95243102 GAAAACTCCATGGCCAGGCCTGG + Intronic
1102518754 12:113466428-113466450 GCTCACCCCAGGCCCAAGCCTGG + Intronic
1109594586 13:64533607-64533629 CAACACTCCACGCCCCACCCTGG + Intergenic
1117436161 14:55717006-55717028 GAGCCCCCGATGCCCAAGCCTGG + Intergenic
1118037648 14:61885316-61885338 AAACACTCCATGGCCAAGGGAGG - Intergenic
1122321067 14:100856176-100856198 GAACACTCCATAGGCAAACCTGG + Intergenic
1124617295 15:31250931-31250953 CACTACTCCATGCCCAAGACTGG + Intergenic
1127581226 15:60340867-60340889 CAACATTCCATGCCCAGGCCGGG + Intergenic
1128494390 15:68185297-68185319 CATCAGTCCATGCCCAAGCAAGG - Intronic
1129266213 15:74394636-74394658 AAACACCCAATGCCCAGGCCAGG - Intergenic
1130100395 15:80889326-80889348 GAGCCATCCATGCCCCAGCCTGG + Intronic
1131543924 15:93299714-93299736 GAAGATTCCAAGCCCAAGCTGGG + Intergenic
1133348070 16:5083581-5083603 ACACACCCCATGCTCAAGCCAGG - Intronic
1133770336 16:8863930-8863952 GGACACTCCAAGGCCATGCCTGG - Intronic
1135376842 16:21954361-21954383 GAACATTCCATGCCCAGGTCTGG - Intronic
1138653707 16:58477462-58477484 GAACTCCCAATGGCCAAGCCTGG + Intronic
1141475640 16:84271449-84271471 GAACAGTCTCTGCTCAAGCCAGG + Intergenic
1141912089 16:87067083-87067105 GAGCCCTCCATGCTCAAGGCAGG + Intergenic
1143873132 17:9971962-9971984 GAACACTCCAGGGCCAAGCAGGG + Intronic
1146288824 17:31593853-31593875 CAACACTCCAGGGCCCAGCCTGG - Intergenic
1148040584 17:44703554-44703576 GATCACTCGAAGCCCAGGCCAGG - Intergenic
1148659346 17:49315692-49315714 AAACAATTCATACCCAAGCCAGG + Intronic
1151678618 17:75612798-75612820 GAACCGTCCCTGCCCAGGCCAGG + Intergenic
1152504316 17:80737558-80737580 GCAGCCCCCATGCCCAAGCCTGG - Intronic
1154315408 18:13300129-13300151 GCAAATTCCATGCCCCAGCCTGG + Intronic
1155557818 18:27040879-27040901 TAACACTCCTTGCACAAGCCAGG + Intronic
1156067607 18:33163320-33163342 CAACACTCAATGACTAAGCCAGG + Intronic
1157582603 18:48782241-48782263 GAGAAGTCCATGCCCAACCCAGG - Intronic
1159314392 18:66752872-66752894 GAAAACTGCATGCACATGCCTGG - Intergenic
1161391947 19:4025621-4025643 GAGGCCTCCATGGCCAAGCCTGG - Intronic
1162520291 19:11175680-11175702 GAACACTCACTGGCCAAGCCTGG - Intronic
1163512033 19:17741225-17741247 AGACACTCCACTCCCAAGCCTGG - Intergenic
1164532447 19:29058685-29058707 GAGCACCCCAAGCCCCAGCCTGG + Intergenic
927325739 2:21802998-21803020 GAACACTCCATTCCCTCACCTGG + Intergenic
927862265 2:26567577-26567599 GAACCCTCCCTTCCCAAGCCTGG - Intronic
930411039 2:51027418-51027440 GAAGACCCCATGCACCAGCCCGG + Intronic
933159339 2:79007176-79007198 GAACACTCCATGTCCAGACAAGG - Intergenic
933684939 2:85134510-85134532 CCCCACTCCATGGCCAAGCCCGG - Intronic
935171930 2:100616905-100616927 CTACTCACCATGCCCAAGCCCGG + Intergenic
940791535 2:158034467-158034489 GCACACTCCATTATCAAGCCAGG - Intronic
945598312 2:211824038-211824060 GAACACTCCATGCCCAAGCCTGG - Intronic
946358859 2:219206976-219206998 GGAAACTCCATCGCCAAGCCGGG - Exonic
1169862128 20:10163911-10163933 GAACACTCCATGCTCATGGATGG + Intergenic
1170593709 20:17790222-17790244 GAGCACTCCAAGCCTCAGCCTGG + Intergenic
1172135605 20:32684686-32684708 GAGCTCTCCTTGCCCCAGCCTGG - Intergenic
1172962314 20:38807388-38807410 GAACACTCCTTGGCCAATACTGG + Intronic
1174094728 20:48079116-48079138 GAACACACGATGCCCAACACTGG + Intergenic
1174582329 20:51580690-51580712 GCACACTCAATGGCCCAGCCTGG - Intergenic
1175266919 20:57709022-57709044 GAACACTCCAGACACACGCCCGG + Intronic
1175705085 20:61170837-61170859 GAGCATTCCATGCCGAAGCAAGG - Intergenic
1176136116 20:63522700-63522722 CAACACTCCATGCCTATACCAGG - Intergenic
1178846045 21:36175030-36175052 GAAGACACCATCTCCAAGCCAGG - Intronic
1180663265 22:17487643-17487665 GATCGCGCCATGCACAAGCCTGG + Intronic
1180898439 22:19353905-19353927 GCACAGTCCCTGCCCAGGCCTGG - Intronic
1181473259 22:23153558-23153580 CAGCCCTCCTTGCCCAAGCCTGG - Intronic
1184396269 22:44243495-44243517 GAACACTCAATGCCAATGGCAGG - Intergenic
1184662126 22:45970336-45970358 GCACACTCCAGGAGCAAGCCTGG + Intronic
949689624 3:6620978-6621000 CTAAACTCCATCCCCAAGCCTGG + Intergenic
950063781 3:10094433-10094455 GAACACTCCCAGCCCCACCCAGG - Intronic
950634550 3:14305711-14305733 CCATGCTCCATGCCCAAGCCTGG + Intergenic
953494454 3:43374053-43374075 GTCCACTCCATGCTGAAGCCTGG - Intronic
954762855 3:52889613-52889635 GAGGACTAAATGCCCAAGCCTGG + Intronic
961452074 3:127006739-127006761 ACACACTCCCTGCCCAAGCAGGG - Intronic
961532876 3:127550465-127550487 GACCACCCCATGCCCCAGACAGG - Intergenic
963467217 3:145698541-145698563 GAACACTGCATGCCCTTGCACGG - Intergenic
963719966 3:148851041-148851063 GAAAATTTCATGGCCAAGCCTGG + Intronic
964684593 3:159381623-159381645 GTACACTCCATTACCAAGGCTGG + Intronic
968442020 4:628979-629001 TCACAATCCATGCCCAGGCCTGG - Intronic
969103363 4:4786615-4786637 GAACTCTCCATGTCCATGCTTGG - Intergenic
969283758 4:6189753-6189775 GAAAACTCCATCCCCAGGCTGGG - Intronic
970316292 4:14831443-14831465 GCACACCCCCTGCCCATGCCTGG - Intergenic
975256543 4:72242806-72242828 GAACACTCCAGGCCCAGCCCTGG + Intergenic
978951216 4:114561732-114561754 CTACACTCCACGCTCAAGCCTGG - Intergenic
983851628 4:172587868-172587890 AAACACCCCAAGCCCAAGGCTGG + Intronic
984573611 4:181422333-181422355 GAACACTCCAATCCCAGGCCTGG - Intergenic
985672105 5:1212421-1212443 GGACGCTCCATGCGCAGGCCAGG - Exonic
990054968 5:51562877-51562899 GAACACTTCTTTCCCAAGTCTGG + Intergenic
992825997 5:80550753-80550775 AAACACTCCTTGCCCCAGACGGG - Intergenic
994628120 5:102247011-102247033 GAAAACACCAAGCACAAGCCAGG + Intronic
999045140 5:148459148-148459170 GCCAACTCCATGCCCATGCCTGG - Intronic
1007223684 6:40298083-40298105 GAACACTTCATGGCCAAGGATGG - Intergenic
1007326865 6:41068835-41068857 GACCTCTCCATGCCCAGGCAAGG - Exonic
1010468569 6:76198217-76198239 GAACATTCCATGCCCATGCGTGG - Intergenic
1023122812 7:36926284-36926306 AGTCACTCCAGGCCCAAGCCTGG - Intronic
1024233296 7:47379027-47379049 GAAGAGTCCATCACCAAGCCAGG + Intronic
1026109078 7:67444528-67444550 GAACACTCCATGCTAGAGCTTGG + Intergenic
1028930624 7:96409104-96409126 GAACATCCCATGGACAAGCCAGG - Intergenic
1030248134 7:107408634-107408656 AAACACTCTATGACCAAGCTTGG - Intronic
1034329977 7:150273961-150273983 GAACACTCCTGGCCCATGCGAGG - Intronic
1034668080 7:152835899-152835921 GAACACTCCTGGCCCATGCGAGG + Intronic
1034929973 7:155153867-155153889 GGACATTCAATGCCCATGCCAGG + Intergenic
1035846985 8:2875685-2875707 GAACATGCCATGCCCAGTCCTGG + Intergenic
1036454898 8:8897863-8897885 TCACACTCCTTGCCCTAGCCTGG - Intergenic
1036661885 8:10714335-10714357 GACCACCCCATGCCAAGGCCAGG + Intergenic
1037463655 8:19138097-19138119 AAGCACTCCATGGCCAAGCGCGG + Intergenic
1039316603 8:36380252-36380274 GCACACTCCCTTCCCAACCCAGG - Intergenic
1048756843 8:137748669-137748691 GAAGACTTCATGCCCAGACCAGG - Intergenic
1056706438 9:88956009-88956031 GAACACTCGCTGCTCTAGCCAGG - Intergenic
1056825703 9:89874976-89874998 AAACAGGACATGCCCAAGCCTGG - Intergenic
1056927535 9:90847595-90847617 TAGCACCCCATGCCCAGGCCTGG + Intronic
1059550156 9:115220948-115220970 GAAAACTCCATGCGTGAGCCTGG + Intronic
1061735161 9:132650269-132650291 TAACACTCCAGGCACAATCCAGG + Exonic
1185734118 X:2484636-2484658 GAACTCGCCATGCCCCTGCCTGG - Intronic
1193178744 X:78428234-78428256 TCACACTCCATGCCCATGCTTGG + Intergenic
1193540013 X:82759710-82759732 GACCAATCCTTGGCCAAGCCAGG + Intergenic
1197648580 X:129042007-129042029 CAACACTCAGTGCCCCAGCCAGG - Intergenic
1199982191 X:152927353-152927375 GAGCACTCCAGGCCCTGGCCAGG + Intronic
1200010028 X:153113826-153113848 CATCCCTCCAAGCCCAAGCCTGG - Intergenic
1200029572 X:153286096-153286118 CATCCCTCCAAGCCCAAGCCTGG + Intergenic
1200101101 X:153689325-153689347 GAACACTGGGTGCCCGAGCCAGG + Intronic