ID: 945600269

View in Genome Browser
Species Human (GRCh38)
Location 2:211853910-211853932
Sequence GGTTATGTGTGTTCAGAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 242}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945600266_945600269 -3 Left 945600266 2:211853890-211853912 CCAGATGCCACTGTGAGATTGGT 0: 1
1: 0
2: 0
3: 5
4: 102
Right 945600269 2:211853910-211853932 GGTTATGTGTGTTCAGAAAAGGG 0: 1
1: 0
2: 2
3: 25
4: 242
945600267_945600269 -10 Left 945600267 2:211853897-211853919 CCACTGTGAGATTGGTTATGTGT 0: 1
1: 0
2: 0
3: 14
4: 152
Right 945600269 2:211853910-211853932 GGTTATGTGTGTTCAGAAAAGGG 0: 1
1: 0
2: 2
3: 25
4: 242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945600269 Original CRISPR GGTTATGTGTGTTCAGAAAA GGG Intronic
900678366 1:3902272-3902294 GGATGTGTGTCTTCAGAAAAGGG + Intergenic
903944964 1:26956847-26956869 AGTTATGTGTGTGTAGAGAAAGG + Intronic
905305707 1:37016377-37016399 GGTTAAATGAGCTCAGAAAAGGG + Intronic
908868895 1:68584888-68584910 AGTTAGCTGTGTTGAGAAAAAGG - Intergenic
910108518 1:83657058-83657080 GGTCAGGTGTGTTGAGAGAATGG - Intergenic
910764841 1:90771396-90771418 AGTTCTGTGAGTTCAGAAAAGGG + Intergenic
911191923 1:94956928-94956950 TATAATGTGTGTTCAGAAGAGGG - Intergenic
911758627 1:101590212-101590234 GGTTATTGGAGTTCAAAAAATGG - Intergenic
911768197 1:101704677-101704699 TGTTATGTTTTTTCATAAAAAGG - Intergenic
912157983 1:106945794-106945816 GGTGATGTGTTTTCAAAAATAGG - Intergenic
913137085 1:115901971-115901993 GGTTCTGTGGGTACAGAAATTGG - Intergenic
913219876 1:116650805-116650827 GGACATGTGTGCACAGAAAATGG + Intronic
913382696 1:118228514-118228536 GGTTAAGAGAGTACAGAAAATGG + Intergenic
915432629 1:155878420-155878442 GGTAAGCTGTGTTCAGAGAATGG - Intronic
918686278 1:187419615-187419637 GTTTATAAGAGTTCAGAAAAAGG + Intergenic
919429356 1:197473661-197473683 GGGTATGTCTTTTCAGGAAAAGG + Intronic
919818432 1:201456781-201456803 GGTTATGTGTGTTTTGGAAATGG + Intergenic
920317539 1:205088935-205088957 GGTTATGTATTTTCTTAAAAAGG - Intronic
922430897 1:225552013-225552035 GGGTATGTTTGTTTAGATAAAGG + Intronic
922610638 1:226924484-226924506 GGGTATGTGTGGCCAGGAAAGGG - Intronic
923172718 1:231431643-231431665 AGTCATCTGTGTTCACAAAAAGG - Intergenic
1065322843 10:24524924-24524946 GGTCATGTGGTTTCAGAGAAGGG + Intronic
1066354834 10:34672675-34672697 GGTTATGTGTTTTTAGAAATAGG - Intronic
1068713932 10:60166020-60166042 CTTTATGTGTTTTCAGAAATTGG - Intronic
1069150625 10:64954500-64954522 GGGGGTGTGTGTTCAGAAGACGG + Intergenic
1071051548 10:81456219-81456241 GGTTATGTGAGTTGAGAACAAGG - Intergenic
1071670591 10:87605998-87606020 GGTTATCTGTGTACAAAACATGG - Intergenic
1071927294 10:90424793-90424815 GGCTATGTGTATTCAGATAACGG - Intergenic
1073354850 10:102845690-102845712 GGTTTTGTTTGTTTACAAAAAGG + Intergenic
1074919330 10:117991440-117991462 GGTTATATGTTTTCAGAGACAGG - Intergenic
1074923412 10:118043160-118043182 GGTGCTGTGTGGTCAGAAATGGG + Intronic
1076537409 10:131188935-131188957 GTTCATTTGTGTACAGAAAAAGG - Intronic
1076669091 10:132109742-132109764 GCTTCTGTGTGGTCAGAAACAGG + Intronic
1079099188 11:17530230-17530252 GTTTTTGTGTGTTGAGATAAAGG - Intronic
1080915740 11:36656820-36656842 GGTTATTTGTGTTCTGTAGAGGG + Intronic
1081069458 11:38593394-38593416 GGTTATGTGAGATCAGATAAGGG - Intergenic
1081691894 11:45084089-45084111 GGTTATGTGTGTGCACAAGTAGG - Intergenic
1082995460 11:59251016-59251038 AGGTATGAGAGTTCAGAAAAGGG - Intergenic
1086764080 11:90673224-90673246 GGTTATGTGTCTTCACTATATGG - Intergenic
1087866503 11:103234218-103234240 TGTAATGTATGTTAAGAAAAAGG + Intronic
1088895750 11:114077099-114077121 GGTTTTGTGTGTTGAGATGAAGG + Intronic
1089007904 11:115107970-115107992 GATTATCTCAGTTCAGAAAAGGG + Intergenic
1090447662 11:126777670-126777692 GGTTTTATGTGTTCACAAAGGGG - Intronic
1092910643 12:13142019-13142041 GGTTAGGTGTCTTCAGAGATGGG + Intronic
1097379345 12:58876510-58876532 GGGTACGTGTCTTCAGAAAGTGG - Exonic
1098573082 12:72011122-72011144 AGTTATGTAAGTTCAGCAAAGGG + Intronic
1098834231 12:75402361-75402383 GTTTCTGTGTGTTTAAAAAATGG + Intronic
1099057654 12:77865374-77865396 CATTATGTGTGTTTAGAAGAGGG - Intronic
1101909631 12:108851389-108851411 GGAAATATGTGTTCAGAAATTGG - Intronic
1104220777 12:126783014-126783036 ATATATGTGTGTTCAGAAACAGG + Intergenic
1107863993 13:44685968-44685990 GGTAATGTGTATATAGAAAAAGG + Intergenic
1107912577 13:45119274-45119296 TTTTATGTGTGTTCAGCATAGGG - Intergenic
1108905293 13:55463022-55463044 AGTTATGCGTGTTCATAAAAAGG + Intergenic
1108910498 13:55545061-55545083 GATTATATGAGTTCAGAAATGGG + Intergenic
1108945067 13:56012134-56012156 GGTTAAGTAAGTTCAGAAAAAGG - Intergenic
1108974538 13:56421901-56421923 GGTTATGAGAGCTCAGAAATCGG + Intergenic
1111116754 13:83788821-83788843 TGTTATCTGTTTTTAGAAAAGGG + Intergenic
1111570228 13:90074236-90074258 GATTATTTGTCTTTAGAAAATGG - Intergenic
1111872272 13:93847850-93847872 AGTTGTGTGTATTCAGAACATGG - Intronic
1112067160 13:95805413-95805435 GGATATGTATGTCCAGAAATAGG - Intronic
1113538724 13:111089635-111089657 GGTGATCTATGTTCAGGAAAGGG + Intergenic
1114415087 14:22537557-22537579 GGGGATGTGTCTTCAGAGAAGGG + Intergenic
1115519396 14:34218210-34218232 GGTTATGCCTGTTCAGTAAAAGG - Intronic
1116626404 14:47270216-47270238 TGTTATTTGTGTTCCAAAAAAGG + Intronic
1117718246 14:58602716-58602738 GGTTATGTTTGTTAAGACACGGG - Intergenic
1118056519 14:62084810-62084832 AGTTAGCTGTGTTCTGAAAAGGG - Intronic
1118372922 14:65153003-65153025 TGAGATGTGTGTTCAGAGAAAGG + Intergenic
1118434876 14:65761629-65761651 GGTAATGGATGGTCAGAAAATGG + Intergenic
1119325436 14:73757507-73757529 GGAAATGAGTGTTCAGAAGATGG + Intronic
1119863084 14:77951092-77951114 GGTTATGTGGTTTCCCAAAATGG - Intergenic
1119965128 14:78906489-78906511 GGTTAAGGGTGTTCAGAAAAGGG - Intronic
1120379837 14:83762805-83762827 GGTTATGTGAGGTCAGAGGATGG + Intergenic
1121368476 14:93336077-93336099 GGTTATGTGTGGTAAAAAAGGGG - Intronic
1124125453 15:26934955-26934977 GCTGATGTGTGGTCAGAAGAGGG + Intronic
1125439646 15:39688293-39688315 GGTTAGGTGTATTAAGTAAATGG - Intronic
1129784679 15:78301388-78301410 GGCTATGTGTGGTGAGAAATTGG + Intergenic
1131774739 15:95782519-95782541 GGTTATGGGGACTCAGAAAAAGG - Intergenic
1133761804 16:8804781-8804803 GATTATGTGTTTCCAGAAAATGG + Exonic
1135185198 16:20309681-20309703 GGCTATGTGGCTTCAGAAAGAGG + Intronic
1136142656 16:28297457-28297479 GGAGACCTGTGTTCAGAAAAAGG - Intronic
1136548651 16:30969751-30969773 GGTCATGTGGGCTCAGAAAAGGG - Intronic
1141566956 16:84909034-84909056 GAATATTTGTCTTCAGAAAATGG + Exonic
1143988479 17:10936194-10936216 AGAAATGTGTGTTCAGAAATAGG + Intergenic
1144777668 17:17792916-17792938 GGTTATCTGTGAAAAGAAAAAGG - Exonic
1148637223 17:49158099-49158121 GGCTGTCTGTGTGCAGAAAAGGG + Intronic
1149336760 17:55643681-55643703 GGTTATGTGAGTACAAAGAAAGG + Intergenic
1151085871 17:71380066-71380088 GATTATGTGTGGTGAGAAGAAGG + Intergenic
1153796454 18:8627497-8627519 GATTACCTGTGGTCAGAAAAAGG + Intronic
1153880313 18:9416569-9416591 GGTTATCAGTGCCCAGAAAATGG + Intergenic
1154017923 18:10636862-10636884 GATTACGTGTTTCCAGAAAATGG + Intergenic
1154408955 18:14125160-14125182 GGATATGTGTGTTGTGATAAGGG - Intronic
1156750766 18:40452092-40452114 GGTGATCAGTGTTCAGAAATGGG + Intergenic
1157534371 18:48447669-48447691 AGTTATGTGTGTTCCGGGAAGGG + Intergenic
1157649596 18:49314136-49314158 GGTTCTGTGTGTAAAGAAAAGGG - Intronic
1157842647 18:50973569-50973591 TGTTATGATTGTTCAGAGAAAGG + Intronic
1158094664 18:53756929-53756951 GTTAATGTGTGTTCAGGAATGGG + Intergenic
1159999381 18:75002152-75002174 GCTTATGTGTTTTTAAAAAATGG + Intronic
1161620811 19:5296067-5296089 GGAAATGTTTGTTTAGAAAAGGG - Intronic
1162734855 19:12741013-12741035 GGAGATTTGTGTTCAGAAGAGGG + Intronic
1167092704 19:47355484-47355506 GATTATGAATGCTCAGAAAATGG - Intronic
926903733 2:17786344-17786366 GGAGATGTGTTTTCAGAAGAAGG + Exonic
928352152 2:30568389-30568411 AGTTATGTCTGTTCCAAAAAAGG - Intronic
928995389 2:37284311-37284333 GCTTATATTGGTTCAGAAAATGG - Intronic
929811322 2:45191367-45191389 GAGTGTGTGTGTTTAGAAAAAGG + Intergenic
935590157 2:104840322-104840344 GCTCATTTGTGTTAAGAAAATGG - Intergenic
936107822 2:109640561-109640583 GCTTAAGTCTGTCCAGAAAAGGG - Intergenic
937446819 2:121965557-121965579 GGTTAGTTGTGTTGAGAGAAGGG + Intergenic
938602940 2:132861727-132861749 GCTGATGGGAGTTCAGAAAATGG - Intronic
939090513 2:137775256-137775278 GGTTTTGTATGTACATAAAATGG + Intergenic
939493851 2:142905656-142905678 GGTTATGTGTGCTCACAATAAGG + Intronic
939724934 2:145706740-145706762 GGTTAATGGTGTTCAGTAAATGG - Intergenic
939760805 2:146176063-146176085 GCTTGGATGTGTTCAGAAAAAGG - Intergenic
940566772 2:155373509-155373531 TTTTATTTTTGTTCAGAAAAAGG + Intergenic
941297450 2:163757907-163757929 TGTTATGAGTGGTCAGAAAGAGG + Intergenic
941418125 2:165247035-165247057 GGTTATGTGGGTGCAGAACCTGG - Intronic
941738598 2:169008438-169008460 AGTCATGTGTGTTCTTAAAAGGG - Intronic
942358582 2:175147183-175147205 GGTTAAGTCTGTTGAGGAAAAGG + Intronic
943676325 2:190719337-190719359 TGTCATGTGTATTCAGAAACTGG - Intergenic
944900238 2:204206472-204206494 GATTAAGTGTTTTAAGAAAAAGG + Intergenic
945599059 2:211835400-211835422 AGTTTTATGTGTTCAGGAAAGGG + Intronic
945600269 2:211853910-211853932 GGTTATGTGTGTTCAGAAAAGGG + Intronic
945613553 2:212037170-212037192 GGTTTTGTCTGTTTAGTAAAAGG + Intronic
945812536 2:214566200-214566222 GGATGTTTGTGGTCAGAAAATGG - Intronic
946322884 2:218963696-218963718 GGGTGTGTGTGTGCAGTAAAGGG - Intergenic
946470791 2:219958895-219958917 GGTTATTTGTTTTTATAAAATGG + Intergenic
947840819 2:233206818-233206840 GGCTTTGTGTTTTCAGGAAAGGG + Exonic
1168888038 20:1274020-1274042 TGTTGTGTGTGTTCAACAAATGG - Intronic
1170128849 20:12996975-12996997 GTGTATGTGTGTTGAGAAAAGGG + Intergenic
1171300598 20:24056636-24056658 AATTATGTGTGTGTAGAAAAGGG + Intergenic
1171989103 20:31681970-31681992 GGTAATGTGTGTGCTGAAAGTGG - Intronic
1173471515 20:43326885-43326907 GGCTATTTTTGTTCAGAAGATGG - Intergenic
1174850831 20:53992921-53992943 TGTTATTTGTCTTCAGCAAATGG - Intronic
1176864253 21:14034728-14034750 GGATATGTGTGTTGTGATAAGGG + Intergenic
1177060980 21:16373738-16373760 GGTGATGTGTGTTCTGGACATGG + Intergenic
1177218790 21:18163786-18163808 GGTTTTCTGTGTTAAAAAAAAGG + Intronic
1177446593 21:21204955-21204977 TGATATGTGTGCTTAGAAAAAGG - Intronic
1177781480 21:25626698-25626720 GGTTCTTTGTATACAGAAAATGG - Intergenic
1178040323 21:28633645-28633667 GATTTTGTGTCTTGAGAAAAGGG - Intergenic
1180150003 21:45942591-45942613 GCTTATGTGTGTTGTGGAAAGGG - Intergenic
1180203348 21:46240518-46240540 GGTTAAGTCTGCTCAGAAGATGG - Intronic
1181409058 22:22705294-22705316 GGTTGGGTGAGCTCAGAAAAGGG - Intergenic
1182124787 22:27808541-27808563 GAGTTTCTGTGTTCAGAAAAGGG - Intergenic
1182574026 22:31260843-31260865 GGTTGAGTGTGGCCAGAAAAGGG + Intronic
1183126015 22:35783024-35783046 GGTTATGGTAGTTAAGAAAAAGG - Intronic
1184641859 22:45877103-45877125 GGTTCTGTGTGTCCAGGAGATGG - Intergenic
953197483 3:40747969-40747991 GGTTAAGTGTGCTCAGAATCTGG - Intergenic
955581730 3:60430310-60430332 GGTAATGTTTGTTCAGAAAATGG - Intronic
955822018 3:62906555-62906577 GGTTTTGTTTGTTCATAAAATGG - Intergenic
955881613 3:63552472-63552494 ATTTATGTTTGTTAAGAAAAAGG + Intronic
955892311 3:63663143-63663165 TAATATGTGTGTTCAAAAAAAGG + Intronic
956949824 3:74269540-74269562 GATTATGTATGTACAGAAATGGG - Intronic
957543691 3:81609215-81609237 GGTTTTGAGTTTTCAGTAAAAGG - Intronic
957606876 3:82411158-82411180 GGAAATGTGTGTTAAGAATATGG - Intergenic
959127144 3:102303593-102303615 GCTAATTTTTGTTCAGAAAAAGG + Intronic
959406522 3:105967817-105967839 GGATATGTGTGTTGAGAGAGGGG - Intergenic
959727953 3:109565779-109565801 GATTGTGTGTTTTGAGAAAATGG + Intergenic
962481849 3:135804839-135804861 GGTTATCTCTGCTCAGGAAATGG - Intergenic
963278104 3:143353065-143353087 GGTGCAGAGTGTTCAGAAAATGG - Intronic
963322673 3:143826356-143826378 GGTCATGTGGGTTCACAGAAGGG - Intronic
965917632 3:173870536-173870558 GGTTTTGACTGTTCAGTAAAAGG + Intronic
966645784 3:182245155-182245177 GGTTATTTGTTTTCTGAGAAAGG - Intergenic
967646637 3:191931994-191932016 GGTTATCTGTCTTTTGAAAATGG + Intergenic
967719979 3:192805848-192805870 GTTTATGTGTGGTAGGAAAAGGG - Intronic
970130637 4:12866276-12866298 GGATCTGTGTGTTGAGTAAAAGG + Intergenic
971416465 4:26436240-26436262 GGTTCTTTGTGTTCAGAGTAAGG + Intergenic
976062644 4:81147426-81147448 TGTGAAGTGTGTTCAGATAAAGG - Intronic
977442904 4:97092671-97092693 TATCATATGTGTTCAGAAAATGG + Intergenic
977873730 4:102124701-102124723 TGTTAAATGTGTTCTGAAAATGG + Intergenic
979414776 4:120423108-120423130 GGTTATATTTGTTCATACAATGG + Intergenic
979718533 4:123870525-123870547 TGTTATGTAAATTCAGAAAAGGG + Intergenic
979925059 4:126552048-126552070 TGTTATGTTTCTTCAAAAAAAGG - Intergenic
980247496 4:130266729-130266751 GGTCATGTATGTTCACAAAGAGG + Intergenic
980433251 4:132732348-132732370 GGTAGTCTGTGTTCAGAGAATGG - Intergenic
981638415 4:146907922-146907944 GGTTATGTATATTATGAAAAGGG - Intronic
981805892 4:148714780-148714802 GCATATGTGTGTTGAGAAATGGG - Intergenic
983542632 4:168929501-168929523 TGTTATGCATGTTCATAAAAGGG - Intronic
983678453 4:170323455-170323477 TGATATGTGCATTCAGAAAAGGG - Intergenic
983926191 4:173405271-173405293 GGTTATGTGTTTGTAGAAAGAGG + Intronic
983954484 4:173681212-173681234 GGTCATCTGTGAACAGAAAAAGG - Intergenic
984650098 4:182261978-182262000 GGTAATTTTTATTCAGAAAAAGG - Intronic
984946807 4:184975252-184975274 GGTGATGTGGGCTCAGCAAATGG + Intergenic
986004978 5:3660087-3660109 GGTTATGTGTGGTCATAACAGGG - Intergenic
986004998 5:3660202-3660224 GGTTCTGTGTGGTCATAACAGGG - Intergenic
987904474 5:24058155-24058177 GGTTAGGTTTTCTCAGAAAAGGG - Intronic
989136270 5:38158302-38158324 AGCAATCTGTGTTCAGAAAAAGG - Intergenic
989850598 5:46204565-46204587 GGTTTTGTCCGTTCAGCAAATGG + Intergenic
990260006 5:54012131-54012153 GTTTATATGTGTTCTTAAAATGG + Intronic
993539404 5:89129874-89129896 GCTTCTGTGTTTACAGAAAATGG + Intergenic
994178750 5:96740904-96740926 GTTTCTGTGTGTTCAGAGAAAGG + Intronic
994206178 5:97038338-97038360 GGTTTTGTGTCCTCAGAAATAGG - Intergenic
994910498 5:105899183-105899205 GGTTTTGTGTTTACAGAAAAAGG - Intergenic
995615825 5:113962192-113962214 ATTTATGTGTTTTCAAAAAAAGG + Intergenic
996453197 5:123650866-123650888 ATTTTTGTGTGTCCAGAAAAAGG - Intergenic
997332427 5:133074665-133074687 GGTTTTGAGTGTTCTGGAAAAGG + Intronic
997855123 5:137366337-137366359 GGTACTGAGTGTTCAGTAAATGG - Intronic
999937219 5:156500696-156500718 GCATATGTTTATTCAGAAAAAGG - Intronic
1000207969 5:159080279-159080301 GGCTATGTCTATTCAGAGAAGGG - Intronic
1004935062 6:20499434-20499456 GTGTGTGTGTGTTCAGAAATGGG + Intergenic
1006523554 6:34586191-34586213 GGTCAAGGGTGTTCAGAGAATGG - Intergenic
1006731178 6:36237176-36237198 GTTTCTGTGTGGTCAGAAAAAGG - Intergenic
1009528045 6:64772933-64772955 GGTTATGTGGATACAGAAAGAGG + Intronic
1014112317 6:117632796-117632818 GGTTATGTTTAAGCAGAAAAAGG - Intergenic
1014587169 6:123212861-123212883 GTTTATGTGTGTGCAGAGTAGGG - Intergenic
1014872739 6:126615677-126615699 GGTTATGTGTCTTAAAAAATGGG - Intergenic
1016224213 6:141715137-141715159 GGATATATGTATTCATAAAAGGG + Intergenic
1017147002 6:151243441-151243463 TGTAATGTCTGTTCAGATAAGGG - Intronic
1018211261 6:161484262-161484284 AGTTATAGGAGTTCAGAAAATGG - Intronic
1018717994 6:166549658-166549680 GGGTGTGTGTGTCCATAAAAGGG + Intronic
1019046965 6:169156742-169156764 GGGTCTGTGTGCTCAGAATATGG + Intergenic
1019063821 6:169278404-169278426 GGCCATGTGTGGACAGAAAAAGG - Intergenic
1019809228 7:3152362-3152384 GGTTTTGGGGGTTGAGAAAAGGG + Intronic
1021954923 7:25814939-25814961 CCTTTTGTGTGTTCAGAAATAGG - Intergenic
1022577598 7:31513275-31513297 TGTTCTGTGTGCTCAGAAAATGG - Intergenic
1023118088 7:36882283-36882305 TCTTCTGTGTGTTCAGAACAAGG + Intronic
1023326490 7:39064284-39064306 TGAAATGTGTGTTAAGAAAATGG - Intronic
1023925800 7:44668691-44668713 GGTGATGTGGGTGCAGATAAAGG - Intronic
1024571298 7:50724828-50724850 GTTTATCTGTGGTCAGAAGATGG - Intronic
1025162215 7:56671284-56671306 GTTTTTGTATGTTAAGAAAAAGG - Intergenic
1025973843 7:66353933-66353955 GGCTAAGTGTTTTCAGAAAAGGG - Intronic
1027408525 7:77888479-77888501 GTGTTTGTGTGTTTAGAAAAGGG - Intronic
1031381638 7:121093387-121093409 GTGTGTGTGTGTACAGAAAAAGG - Intronic
1031815921 7:126435093-126435115 GGTGATGCGTTTACAGAAAACGG - Intergenic
1031935363 7:127730535-127730557 CTTTATGTGTGTTCAGACATTGG + Intronic
1032952722 7:136933967-136933989 GGTTTTGTTTTTTCAGAAGATGG + Intronic
1033563231 7:142553939-142553961 TGACATGTGTGTTCAGAGAAAGG - Intergenic
1035003121 7:155632300-155632322 TTTTATTTGTGTTCTGAAAAAGG - Intronic
1038133231 8:24757881-24757903 AGGAATGTGAGTTCAGAAAAGGG - Intergenic
1039222784 8:35353772-35353794 GATAATGTGTGTGTAGAAAAGGG + Intronic
1041151487 8:54939839-54939861 TGTTATGAGAGTTCAGCAAAGGG - Intergenic
1041152194 8:54946397-54946419 TGTGAAGAGTGTTCAGAAAATGG + Intergenic
1041494283 8:58468808-58468830 GAGAATGAGTGTTCAGAAAAAGG - Intergenic
1042106875 8:65337441-65337463 AGTTCTGTGGGTTCATAAAAGGG - Intergenic
1044048719 8:87472429-87472451 TGTCATGGGTGTGCAGAAAAGGG + Intronic
1044048957 8:87475258-87475280 GCTTATTTGTATTCAGAATAGGG + Intronic
1045182835 8:99804549-99804571 GGTGATATTTGTTCATAAAATGG - Intronic
1046587459 8:116165399-116165421 GATAATTTTTGTTCAGAAAAGGG - Intergenic
1046885531 8:119362927-119362949 GCTTATGTGATTTTAGAAAAGGG + Intergenic
1047009983 8:120661871-120661893 GTTTATGTATGTTCAGAGAATGG + Intronic
1047040312 8:120987016-120987038 TGTTATTATTGTTCAGAAAATGG + Intergenic
1048740232 8:137550055-137550077 GCTTATTTGTGTACAAAAAATGG - Intergenic
1050372785 9:4939136-4939158 GGTTAGCTGTGTTAAGAGAATGG + Intergenic
1050613242 9:7374978-7375000 GGTTGTGTGGTTTGAGAAAAAGG + Intergenic
1050979221 9:11988126-11988148 AGTTAAGTGTGGTCATAAAAAGG + Intergenic
1051444254 9:17123495-17123517 GGGTAGGTGAGTTCAGGAAAGGG + Intergenic
1054810304 9:69429019-69429041 GGTTATGTATGTTCACCTAAAGG - Exonic
1055118343 9:72629592-72629614 GTTTATGTGTGTTTGGGAAAAGG + Intronic
1056888968 9:90471530-90471552 AGTTATCTTTCTTCAGAAAAGGG - Intergenic
1057392702 9:94652851-94652873 GGTTGTGTGTGTTTTGAATAAGG + Intergenic
1057536072 9:95908075-95908097 GCTTCTGTGTGTGCAGATAAAGG + Intronic
1057593543 9:96394822-96394844 CCTTTTGTTTGTTCAGAAAATGG - Exonic
1059606073 9:115837851-115837873 GGTTATATGTATTTAGAACATGG - Intergenic
1061444964 9:130632450-130632472 GGTTGTGCATGCTCAGAAAAAGG + Intronic
1186770140 X:12810381-12810403 GTTTATTTGTTTTCAGCAAAGGG + Intronic
1186947210 X:14582030-14582052 TGCTATATGAGTTCAGAAAAGGG - Intronic
1187331343 X:18342889-18342911 GTTTAATTGTGTTGAGAAAATGG - Intronic
1189469865 X:41305414-41305436 GTTTATGTGTGCACAGAAAAAGG - Intergenic
1189972660 X:46434019-46434041 GGTCATTTGTGTTGATAAAATGG - Intergenic
1190119380 X:47648136-47648158 GGTTTTTTTTTTTCAGAAAAAGG + Intronic
1190282364 X:48939431-48939453 GTCTCTGTGTGTCCAGAAAAAGG - Intronic
1191872217 X:65757335-65757357 ACTTATGTCTGTGCAGAAAAAGG - Intergenic
1191921883 X:66265681-66265703 AGTAAAGTGTGTTCAGACAAAGG + Intronic
1193643988 X:84044624-84044646 GGGGGTGTGTGTTCAAAAAACGG + Intergenic
1194293059 X:92098987-92099009 GGATCTGTGTGTTCCTAAAAGGG + Intronic
1194663378 X:96650724-96650746 GGTTCTGAGGATTCAGAAAAGGG - Intergenic
1194899531 X:99492257-99492279 GCTTATTTATGATCAGAAAATGG + Intergenic
1195096815 X:101510052-101510074 AGTTATCTGTTTTCGGAAAAGGG - Intronic
1196667307 X:118330172-118330194 GGAGAGGTGTGTTCAGAAAATGG - Intergenic
1197648931 X:129044127-129044149 GGATCTGTGTGTACAGAACATGG + Intergenic
1200413338 Y:2883552-2883574 GGGAACGTGTGTTCACAAAATGG + Intronic
1200610569 Y:5323535-5323557 GGATCTGTGTGTTCCTAAAAGGG + Intronic