ID: 945611250

View in Genome Browser
Species Human (GRCh38)
Location 2:212006190-212006212
Sequence AAGAATAATTAGAAAGATTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 592
Summary {0: 1, 1: 0, 2: 5, 3: 46, 4: 540}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945611250 Original CRISPR AAGAATAATTAGAAAGATTC TGG (reversed) Intronic
900665683 1:3814115-3814137 AAGGATAGTTAGAAAGGTTTGGG - Exonic
901209595 1:7517241-7517263 AAGGATAATTAGAAGGATCCTGG - Intronic
901257888 1:7847556-7847578 AAGAATAATTATAAATTTTCAGG + Intronic
901589653 1:10330007-10330029 AAGAAAAATTAGCAAAATTATGG - Intronic
902641779 1:17771458-17771480 AAGAATAATGATAAAGATCAAGG - Intronic
903123185 1:21229985-21230007 AAAAAAAATTACAAAAATTCCGG + Intronic
903438019 1:23367224-23367246 AAACATGATTAGAAATATTCAGG + Intronic
904368353 1:30032787-30032809 AAGAATAATTTGAATGTTTCTGG - Intergenic
906588498 1:47001649-47001671 AAGTAGAATTAGAAAGCTACAGG - Intergenic
907100064 1:51824080-51824102 TAAAATAATTAGAAAGAACCTGG - Intronic
907579689 1:55560372-55560394 AAGAATAATAACAAACAATCAGG - Intergenic
907886826 1:58599584-58599606 AGGACTACTTAGAAAGATTTGGG - Intergenic
908917504 1:69147185-69147207 AATAATAAAAAGAAATATTCAGG + Intergenic
909036990 1:70604578-70604600 AAGAATAGTCAGAAAATTTCTGG - Intergenic
909662230 1:78097015-78097037 AACAATAAGCAGAAAAATTCAGG - Intronic
910077456 1:83298154-83298176 AAGAATCATTGGATAGATTTAGG + Intergenic
910916707 1:92297250-92297272 AAAAAGAATTAGAAATATTTAGG - Intronic
911214478 1:95177433-95177455 ATGAATAATTTCAAAGATACTGG + Intronic
911413623 1:97542499-97542521 AAGAAAAATTAGAATAATACTGG - Intronic
911418904 1:97614232-97614254 AAGAATAATTATAAAGATATAGG + Intronic
911701616 1:100959695-100959717 AAGATTAAGTAAAAAGACTCTGG - Intronic
913370469 1:118093483-118093505 AAGAAGAAGAAGAAAGGTTCAGG - Intronic
914260304 1:145993595-145993617 AAAAATAACTAGAAAAACTCAGG - Exonic
914889314 1:151608710-151608732 AAAAATATTTAGAAAGGATCAGG - Intergenic
914964833 1:152246528-152246550 AAGACTAATTAAGAAGATTCTGG - Intergenic
914977856 1:152382092-152382114 TAAAATAATTAAAAACATTCTGG + Intergenic
917258789 1:173144948-173144970 AAAAATCATTAAAAAGATCCAGG - Intergenic
917760001 1:178146431-178146453 AAAAATAATTAGAGAAATTTTGG + Intronic
918123604 1:181561434-181561456 AAGATTAACTAGAAAGAGGCTGG - Intronic
918450908 1:184657000-184657022 AACAATCATTAGAAAGTTTCAGG - Intergenic
918660259 1:187079437-187079459 AATAATAATTATAAAGATAAGGG - Intergenic
918854593 1:189734583-189734605 AGGAATATTCAGAAAGATTGCGG - Intergenic
918903779 1:190462466-190462488 AAGAATAATAATAAAGAAACAGG + Intronic
919204928 1:194409619-194409641 AAGGATAATAAGAAAGTTTCAGG + Intergenic
919277172 1:195435219-195435241 AATAATAACTAAAAAGATGCAGG - Intergenic
919526385 1:198657699-198657721 AAGAATATTTAGCAAGAATGGGG - Intronic
919565363 1:199178722-199178744 AGGAAAACTTAGAAGGATTCAGG - Intergenic
920579665 1:207094635-207094657 CAGAATAAACAGAAAGAATCTGG - Intronic
920761250 1:208785553-208785575 AAGGATATTGAGATAGATTCTGG - Intergenic
923295889 1:232594626-232594648 AAGAATAGCTAGAAAGAGGCTGG - Intergenic
923805386 1:237251896-237251918 AAGAATAATTAGAAGGGTTTAGG - Intronic
924272706 1:242350274-242350296 AAGATAAATTAGATAAATTCTGG + Intronic
924717299 1:246589087-246589109 AACAATAATAATAATGATTCAGG - Intronic
1063998670 10:11644305-11644327 AAGAATAACCAGAAAGAGGCCGG - Intergenic
1064042168 10:11976593-11976615 AAGTATCATAAGAGAGATTCTGG + Intronic
1064632229 10:17328347-17328369 AAAAGGAATAAGAAAGATTCAGG - Intronic
1064696643 10:17974042-17974064 AAAAATAATTTAAAAAATTCTGG - Intronic
1064828565 10:19434845-19434867 AATAATAAATAAAAAGATTCAGG - Intronic
1065347311 10:24760800-24760822 AAGAATAAGAAGAAAGAATCAGG + Intergenic
1065748877 10:28867364-28867386 AAGAATATTTTTAAAGCTTCAGG - Intronic
1066079457 10:31915830-31915852 AAAAATAATTAAAATGATTATGG + Intronic
1066292053 10:34023285-34023307 AAAAAAAATCAGAAAGATTTGGG - Intergenic
1066712004 10:38246353-38246375 AAGATAAATTAGATAAATTCTGG - Intergenic
1067347305 10:45445801-45445823 AAGAATAAATGGAAAGGTACTGG - Exonic
1068110778 10:52678337-52678359 AAGAATAATGAGTAAGTTTTAGG + Intergenic
1068145668 10:53067312-53067334 AAAAATATTTAGAAAAATTTTGG + Intergenic
1068319734 10:55396579-55396601 AAGAAATATTAGAATGATGCAGG + Intronic
1068674099 10:59752285-59752307 AGAGATAATTAGGAAGATTCAGG + Intergenic
1068986953 10:63116407-63116429 AGGGATAATTTGAAAGTTTCAGG + Intergenic
1069206065 10:65687299-65687321 AAAAGTAATCAGAAACATTCTGG - Intergenic
1070002443 10:72390282-72390304 TGGAATAATTTGAAAGATCCAGG - Intronic
1070012345 10:72488715-72488737 AGGAGTAATTAGGAAGATGCTGG - Intronic
1070222560 10:74464654-74464676 AAAAATAATTAAAAAGTTTTTGG - Intronic
1072047364 10:91670573-91670595 AAGAATAAAGAAAAGGATTCAGG + Intergenic
1072146948 10:92649749-92649771 AAGATTAATTAGGAAGTTTTAGG + Intronic
1072558142 10:96541361-96541383 AAAAAAAATTAGATTGATTCTGG - Intronic
1073911116 10:108345986-108346008 AAAAAGAATTTGAAAGATACTGG - Intergenic
1074167157 10:110891812-110891834 AACAATTATTAGAAAAATTGAGG + Intronic
1074526585 10:114268338-114268360 GAGAGAAATTAGAAAAATTCTGG + Intronic
1074797921 10:116967831-116967853 AAGAATAATTAAATACATTATGG + Intronic
1074841975 10:117362554-117362576 AAGAATAATTACTAAGAGTCTGG + Intronic
1074926049 10:118072727-118072749 TAAAATAACTAGAAAGATACAGG + Intergenic
1074939708 10:118222775-118222797 AATAATAATTTCAAAGATGCAGG - Intergenic
1076089556 10:127670374-127670396 AGGAATAACTACACAGATTCAGG + Intergenic
1076282941 10:129265224-129265246 AAGAATATTTACAGACATTCAGG + Intergenic
1078203571 11:9207512-9207534 AAGAACCATTAGAAAGCTTTGGG + Intronic
1078330830 11:10418232-10418254 AAGAAAAATTTGAAACATTCAGG - Intronic
1078699297 11:13665697-13665719 AAGCATAAGTAGAAAGATAATGG + Intergenic
1078756136 11:14212173-14212195 CAGAATAATTAGATGGAGTCCGG + Intronic
1078945042 11:16056307-16056329 AAGAATCCTTAGAAATGTTCAGG - Intronic
1079335291 11:19565336-19565358 TTGAATAATTTGAAAGATTAGGG - Intronic
1079361068 11:19770675-19770697 AAGACTAATTTGAAAGCTCCAGG - Intronic
1079414061 11:20216406-20216428 AACAATAAAGAGAAAGATCCAGG - Intergenic
1079663797 11:23077271-23077293 AAGAATAAACAAAAAGATTGAGG + Intergenic
1079800874 11:24867102-24867124 AAGAAAAAGAAGAAAGACTCTGG - Intronic
1079804526 11:24912504-24912526 CTGCATAATTAGAAATATTCTGG + Intronic
1080128743 11:28767905-28767927 AATAAAAATAAGCAAGATTCTGG + Intergenic
1080535999 11:33222354-33222376 AAGAATAATGAGAAAAGTTCAGG - Intergenic
1081170579 11:39865546-39865568 AAGAAGAAATAGAAATATACAGG - Intergenic
1081894648 11:46574740-46574762 AAGAATACTTTGAAAAATACTGG + Intronic
1081999323 11:47384785-47384807 AAGAATAATTATAAAGCAGCCGG + Intergenic
1082198240 11:49329151-49329173 AATATTAAAAAGAAAGATTCTGG - Intergenic
1083531498 11:63427733-63427755 AAGAAAAATTTGAAACATTAAGG - Intergenic
1084141507 11:67233745-67233767 AGGAAAAAGTAGAAAGATTTGGG + Intronic
1085656889 11:78323779-78323801 AAAAAAAAAAAGAAAGATTCAGG - Intronic
1086187978 11:84042350-84042372 AACAATAATGAGAGAGATCCAGG - Intronic
1086320047 11:85636625-85636647 AAATATAATAAGAAACATTCTGG + Intergenic
1086526291 11:87730326-87730348 AAGAAAAAATAGAAAGTTTTAGG + Intergenic
1086579272 11:88378661-88378683 AATAATAATTCTAAAAATTCTGG + Intergenic
1086622908 11:88909370-88909392 AAGAATAATATGAACGAGTCTGG - Intronic
1086657571 11:89378995-89379017 AATATTAAAAAGAAAGATTCTGG + Intronic
1086744669 11:90410058-90410080 AATAATAATTATAAAGATTGGGG + Intergenic
1087114582 11:94511835-94511857 AAGAGCAAGTAGAAAAATTCAGG - Intergenic
1087433506 11:98082378-98082400 AACAAAAGTTATAAAGATTCTGG + Intergenic
1087749753 11:101994239-101994261 AAGATTTTTTAAAAAGATTCTGG + Intronic
1087813676 11:102635277-102635299 AAAAAAAATTAGAAAGAATTGGG - Intergenic
1088024764 11:105164720-105164742 AATAATAAAAAGATAGATTCAGG + Intergenic
1089008993 11:115117824-115117846 AATTAAAATTAGAAAAATTCTGG - Intergenic
1089762288 11:120736599-120736621 ATGAATAATTAGAATAATTATGG + Intronic
1090162702 11:124511904-124511926 CAGATTAATTATAAAGATTATGG + Intergenic
1090620982 11:128561022-128561044 AGGAGGAATAAGAAAGATTCAGG + Intronic
1092585078 12:9891657-9891679 AAAAAAAATTGAAAAGATTCAGG - Intronic
1093373558 12:18394432-18394454 GAAAATAATTGGAAAGAATCAGG + Intronic
1093509157 12:19905173-19905195 AAGAATAATAAGACAGGTTAAGG - Intergenic
1094236455 12:28172854-28172876 AAGACTCATTACAAATATTCTGG - Intronic
1095355908 12:41274951-41274973 CAGTATAATTAGGTAGATTCAGG + Intronic
1097427515 12:59465344-59465366 AAGAAAAATTAAAAAGCCTCAGG + Intergenic
1098605516 12:72384886-72384908 TAGAATATTTATAATGATTCTGG + Intronic
1099110265 12:78551367-78551389 AAGAATAAATAGAAAGCCTAAGG + Intergenic
1099118370 12:78656191-78656213 AAGAAAAATTAGAAACAAGCTGG + Intergenic
1099690232 12:85942749-85942771 AAGAAATATTCCAAAGATTCAGG + Intergenic
1099691967 12:85966482-85966504 AAGAATTTTTAAAAAGATTTTGG - Exonic
1099805195 12:87509719-87509741 CAGAAAAATTATAAAGATTAAGG + Intergenic
1099893562 12:88618043-88618065 AAGAATAAATGGACAGATTTTGG + Intergenic
1100554436 12:95678895-95678917 AAGAATCATTTTAAAAATTCAGG + Intronic
1101068125 12:101044580-101044602 GAGAGTAATTAGATAGATCCAGG - Intronic
1101354993 12:103968422-103968444 AAGAAGAATAAAAAAGATTTGGG + Intronic
1104126604 12:125852758-125852780 AAGAACAATTGCAAAGATTTTGG - Intergenic
1104199662 12:126576138-126576160 AAGAATGCTTAGAATGATTCAGG - Intergenic
1104248581 12:127067207-127067229 AAAGATAATTAGAAAGATTATGG + Intergenic
1104603882 12:130173151-130173173 AAGAATAAAAAGAAAGATCCAGG - Intergenic
1105519465 13:21118770-21118792 TAGAATAGTTTGAAAGATTTAGG + Intergenic
1105621847 13:22075463-22075485 AATAAAAATCAGAAATATTCTGG - Intergenic
1105768328 13:23582407-23582429 AAAAATAATAATAAAGATTTGGG + Intronic
1106986570 13:35358924-35358946 AAGAAATATTACAAAGACTCTGG + Intronic
1107198114 13:37679377-37679399 AAAAATAATTAAAAATATTATGG + Intronic
1108906934 13:55487684-55487706 AAAAATAATTAGAAAAATAAAGG - Intergenic
1108949703 13:56075697-56075719 AAAAATAATTAGAACCATACAGG + Intergenic
1109162778 13:58996562-58996584 ATGTTTAATTAGAAAGAATCTGG - Intergenic
1109247101 13:59968069-59968091 AATACTAGTTAGAAAGATTAAGG - Intronic
1109526058 13:63578223-63578245 TAGAATAATTTGGGAGATTCAGG + Intergenic
1110078373 13:71279172-71279194 AATAATATTTAGCAAGATTTTGG - Intergenic
1110206049 13:72914915-72914937 CAGAAAAATTAGGAAGTTTCAGG - Intronic
1110675019 13:78232125-78232147 AAGAATAAATAGAAATGTTCTGG - Intergenic
1110699778 13:78533478-78533500 AAAAATGATTAGAAAGAATGTGG + Intergenic
1110750139 13:79104232-79104254 AAGAATAATTCCTAAGATCCAGG + Intergenic
1111197813 13:84896403-84896425 CAGAATATTTAGAAACATTTTGG + Intergenic
1111213605 13:85113642-85113664 AAGAATAATTAGAAAAATTGTGG - Intergenic
1111465884 13:88609686-88609708 AATAATAATTACATAGATTATGG + Intergenic
1111529745 13:89521377-89521399 AAAAATATTGAGAAAGTTTCTGG - Intergenic
1111640955 13:90969142-90969164 ATAAATAATTAGTAAGATTTAGG + Intergenic
1112109331 13:96277162-96277184 AAGTATATTTAGCAAGATACAGG - Intronic
1112588696 13:100743993-100744015 AAGAAGAATTGGACAGATTCGGG + Intergenic
1113084491 13:106554327-106554349 AAGAAGAATGAGAAGCATTCTGG - Intronic
1113211092 13:107982187-107982209 ATGAAGATTCAGAAAGATTCAGG + Intergenic
1114191675 14:20443808-20443830 AAAAATAAATAAAAAGACTCTGG + Intergenic
1115779051 14:36749336-36749358 AAGCATGATTTCAAAGATTCTGG - Intronic
1115828954 14:37312905-37312927 AATAATAATCTGAAAGATCCTGG - Intronic
1116109297 14:40556107-40556129 AAGAATTATCAGAAGGATTTGGG + Intergenic
1116573365 14:46545559-46545581 AAGGAAGATTAGAAAGACTCAGG - Intergenic
1116948984 14:50861508-50861530 AAGTATATATAGGAAGATTCTGG - Intronic
1118131895 14:62975539-62975561 AATAATAATTTGAAAGATGAAGG + Intronic
1118236120 14:64006858-64006880 AACAAAAATCAGAAAAATTCTGG + Intronic
1118656203 14:67952085-67952107 AAGAAAAATTAAAGAAATTCTGG - Intronic
1120129713 14:80791348-80791370 AAAAATAATTGGAAGTATTCTGG + Intronic
1120517104 14:85483836-85483858 AAGAATGTTTAGAAATAGTCAGG + Intergenic
1120928696 14:89825265-89825287 AAGAAAAATTAGAAAGTATTTGG + Intronic
1121188854 14:92005357-92005379 AAGAAGAATTGGAACGACTCAGG - Exonic
1121825855 14:97008776-97008798 AAGAAGCATTTGAAAGATTCAGG - Intergenic
1122683330 14:103484472-103484494 AAAATTTATTTGAAAGATTCTGG - Intronic
1202894209 14_KI270722v1_random:188690-188712 AAGAAGAAGTAGAAGAATTCAGG - Intergenic
1202927859 14_KI270725v1_random:8439-8461 AAGGAAAATTACAAAGATTTTGG + Intergenic
1124254222 15:28127903-28127925 AGGAATATTTAAATAGATTCAGG + Intronic
1125038125 15:35150722-35150744 AAAAACAATCACAAAGATTCAGG + Intergenic
1125131012 15:36284696-36284718 AAGAATAATTTAAAATATTAAGG + Intergenic
1126123851 15:45277830-45277852 AAAAATTTTTAGAAGGATTCAGG + Exonic
1126898768 15:53289211-53289233 AAGAATGATTAGACATTTTCTGG + Intergenic
1126949594 15:53866556-53866578 AAGAATAGTTAGAAACAATAAGG + Intergenic
1127345655 15:58095174-58095196 AAGAATAATTAAATAAATTTAGG - Intronic
1128933645 15:71727392-71727414 GAGAATTATAAGAAAAATTCTGG + Intronic
1129594394 15:76950011-76950033 AAGAATAATTTGACAGTTTTGGG - Intronic
1129974900 15:79813833-79813855 GAGATTAAATAGAAGGATTCAGG - Intergenic
1130323799 15:82862671-82862693 AAGATTATTTAGAAAGATTCAGG + Intronic
1130634526 15:85604850-85604872 AAGAAAGATTAGGAAGATTTGGG + Intronic
1131469153 15:92681236-92681258 AACAGTAATTACAAATATTCTGG + Intronic
1133312724 16:4860692-4860714 AAGAAGAAGAAGAAATATTCTGG + Exonic
1133678720 16:8100050-8100072 AATAATAATTGGAAAGCTTTGGG + Intergenic
1135010994 16:18878629-18878651 AAGAAAAAAAAGAAAGAATCTGG + Intronic
1135014158 16:18910093-18910115 AAGAAAAAAAAAAAAGATTCTGG - Intronic
1135232479 16:20722222-20722244 AACAATAATTGGTAAGATTAAGG + Intronic
1136385384 16:29922725-29922747 AAAAAGAATTAGAAAGCTCCTGG + Intronic
1136984583 16:35087492-35087514 AAGAATCATTCGAAAGAAACTGG - Intergenic
1137962113 16:52892289-52892311 AAGAATAAGGGGAACGATTCTGG + Intergenic
1138685485 16:58721704-58721726 AAGAATTATTAGAAATAGTGTGG + Intronic
1138804849 16:60080451-60080473 AAGGAAGATTAGAAAGACTCAGG - Intergenic
1139031023 16:62880752-62880774 AAAAATAATTAGTCAGATTCTGG - Intergenic
1139136687 16:64212983-64213005 AAGAAAAATTAGCTAGATTAAGG + Intergenic
1139411745 16:66767633-66767655 GTGAATAAACAGAAAGATTCTGG + Intronic
1139826166 16:69758934-69758956 AAGACAAATTAGACAGACTCTGG - Intergenic
1140022530 16:71252125-71252147 AAGAATAAATAGCAAGAGGCAGG + Intergenic
1140637716 16:76935954-76935976 AAGATAAATGAGAAAGATTAAGG + Intergenic
1140791753 16:78398731-78398753 ATTAAGAATTAGAAAGATTAAGG - Intronic
1141394425 16:83691982-83692004 AATAAGGATTAGGAAGATTCAGG + Intronic
1141501364 16:84446509-84446531 AAGGATAATTTGAAAGTTCCTGG + Intronic
1142914970 17:3128951-3128973 AACAATAATAATAAAGGTTCAGG - Intergenic
1143607254 17:7995040-7995062 AAGAATTATCAGGAAAATTCTGG + Intergenic
1144480516 17:15625245-15625267 AATAAAAATAAGATAGATTCTGG + Intronic
1144917794 17:18738500-18738522 AATAAAAATAAGATAGATTCTGG - Intergenic
1144939420 17:18927353-18927375 AATAATAATTAGAAAGACAGGGG - Intronic
1145813913 17:27781875-27781897 AAGAAAAAAGAGAAAGACTCAGG - Intronic
1146105463 17:30031723-30031745 AAGAATAATGATAATGATGCTGG + Intronic
1148996621 17:51715989-51716011 AATAATAATTAGAAAGAATGAGG - Intronic
1149107052 17:52982250-52982272 ACCACGAATTAGAAAGATTCAGG - Intergenic
1149243875 17:54682556-54682578 AAAAAGAAATAGAAATATTCAGG + Intergenic
1149918002 17:60629709-60629731 AAGATTAATGAGAAGGAATCAGG - Intronic
1150841297 17:68608804-68608826 AACACTAATTAAAAAGAATCTGG + Intergenic
1151522503 17:74640497-74640519 AGGAATACATAGAAAGACTCTGG - Intergenic
1153251961 18:3131768-3131790 AAAAAGATGTAGAAAGATTCAGG + Intronic
1153334332 18:3906735-3906757 GTGAAAATTTAGAAAGATTCTGG + Intronic
1153437433 18:5082760-5082782 AAGTATAATAAGAAAAATACAGG + Intergenic
1153547162 18:6219685-6219707 AAGAATAATTAAAAATCATCTGG + Intronic
1154995540 18:21636872-21636894 AAAAAAAAAAAGAAAGATTCAGG + Intergenic
1155413723 18:25572984-25573006 AATAATAATTATAAATATCCAGG - Intergenic
1155738920 18:29261404-29261426 AAGAACATGTAGAAAGATTTAGG - Intergenic
1155830204 18:30507455-30507477 AAGAAAAATCAGAAAGGTTCAGG + Intergenic
1155917110 18:31567980-31568002 AAGAATGATTAACAAAATTCAGG - Intergenic
1157026520 18:43851101-43851123 AAGAATAATCAGAAGTATTTTGG - Intergenic
1157251309 18:46098452-46098474 ATGAATGATTAGATATATTCCGG + Intronic
1157517276 18:48320060-48320082 AAGAGAAATGAGGAAGATTCAGG + Intronic
1158495116 18:57948502-57948524 TACAATAATGAGAAAGAATCAGG - Intergenic
1158770532 18:60511624-60511646 AATAAGTATTAGAAAGCTTCAGG + Intergenic
1158915462 18:62122186-62122208 CAGAATAATTAAAAAGATCCTGG + Intronic
1159599088 18:70411556-70411578 AAGAAGAAAGAGAAAGATGCTGG - Intergenic
1159741584 18:72177704-72177726 AAAAAAAATGAGAAAGATTCCGG - Intergenic
1159960654 18:74553645-74553667 AAGAATAGTTATAAATATTCTGG - Intronic
1160293353 18:77615985-77616007 ATGAATAATTAAAAAGAATAAGG - Intergenic
1163487184 19:17595013-17595035 AAGGAAGATTAGAAAGACTCAGG - Intergenic
1164852563 19:31496672-31496694 AATACTAAATAGAAAGTTTCAGG - Intergenic
1165648439 19:37465710-37465732 CAGAATAATTGGATAGGTTCTGG + Intronic
1167717752 19:51154837-51154859 ATGAGGAATTAGAAAGATGCAGG - Intergenic
1167957267 19:53076142-53076164 AAGAATAATAAGACAGAATTAGG - Intronic
925503395 2:4532334-4532356 AACAAGAATTAGCAATATTCTGG + Intergenic
925696479 2:6585574-6585596 TAGAATAATTACAAAGAGTAGGG + Intergenic
926073553 2:9921780-9921802 GAGAAAAACTAAAAAGATTCAGG + Intronic
926244876 2:11115448-11115470 AAGAATAGTTAGAAAAACTGTGG + Intergenic
927418805 2:22907821-22907843 AAGAATCATTAGAAATCTTGAGG - Intergenic
927625324 2:24710785-24710807 AGAAATAATTAGAATGATTGGGG - Intronic
927749676 2:25656316-25656338 AAGCATAATTACAAAGATACAGG - Intronic
928271549 2:29859625-29859647 AAAAATAAATAGAAAAAATCAGG + Intronic
928369369 2:30730016-30730038 AAGCATGAGTAGAAAGTTTCAGG + Intronic
928500677 2:31891261-31891283 AACAAAACTTAGAAATATTCTGG + Intronic
929073616 2:38058961-38058983 AAGAATCATGAGAAATACTCAGG - Intronic
929589037 2:43133421-43133443 AAGCAGAATTGGAAAGACTCGGG + Intergenic
930272473 2:49272940-49272962 AAAAACAATTAGAAAGCTTGGGG - Intergenic
930298166 2:49580930-49580952 AACAATACTTTGAAAGATTGAGG - Intergenic
930524042 2:52503949-52503971 CAGGATATTTAGAAAGATACAGG + Intergenic
930583737 2:53245384-53245406 AACAATGACTAGAAAGTTTCTGG - Intergenic
930685575 2:54303880-54303902 AGTAATAGGTAGAAAGATTCTGG + Intronic
930956580 2:57210194-57210216 AAAAAGAATTAGAAAGACTAAGG + Intergenic
932534543 2:72579185-72579207 AAGAATAACTACAAGTATTCTGG + Intronic
935070560 2:99690147-99690169 AATAATAATAATAAAGATTGTGG - Intronic
937758521 2:125570896-125570918 GAGAATAATTTGAATGTTTCTGG + Intergenic
938640848 2:133277976-133277998 AAGAATAAATAAATAGATCCAGG + Intronic
939507135 2:143059399-143059421 AAGAAAGATAAGAAAGAATCTGG - Intergenic
939662460 2:144907075-144907097 AAGGATAAATAGTAACATTCGGG - Intergenic
939701504 2:145398358-145398380 AAGAAATATTAGGAAGATTGAGG + Intergenic
940286424 2:152037613-152037635 AAGAAGAATGAGAAAAATTTAGG - Intronic
940592169 2:155743105-155743127 CACAATAATTAAAAAGACTCTGG + Intergenic
940983794 2:160032207-160032229 TAGAATAATTTGTAAAATTCAGG - Intronic
941035849 2:160568368-160568390 AAGAAAAGTCAGAAAAATTCAGG - Intergenic
941271890 2:163440510-163440532 AAGAAAAGTTAAAAAGAATCAGG + Intergenic
943166518 2:184333650-184333672 TGGAAAAATTAGAATGATTCAGG + Intergenic
943600356 2:189911626-189911648 AATATGAATTAGAAAAATTCAGG + Intronic
943989860 2:194674371-194674393 ATGAAAGATTAGAAAGTTTCAGG + Intergenic
944587781 2:201187843-201187865 ATCAATGATTAGAAAGATGCTGG + Intronic
945378561 2:209110681-209110703 AAGAACAATTAGAAAATTTAAGG - Intergenic
945611250 2:212006190-212006212 AAGAATAATTAGAAAGATTCTGG - Intronic
945664936 2:212729377-212729399 AAAAAAAATTAAAAAAATTCAGG - Intergenic
945764185 2:213953486-213953508 CAGAATACTTAGAAAAATTAAGG + Intronic
947661754 2:231874720-231874742 AAGAATGATCAAAAAGAGTCTGG - Intergenic
948398992 2:237668833-237668855 AAAAATAATAAGGAAAATTCAGG + Intronic
1169669815 20:8084339-8084361 AAGGATCATGAGAAAGTTTCTGG - Intergenic
1169764919 20:9138744-9138766 TAGAATAATTAGAAGGAATAAGG - Intronic
1169790890 20:9409448-9409470 AAGAAAAATGAGAAATATTTTGG - Intronic
1170350200 20:15432016-15432038 AAGAATATTTAGAGAGCTTTAGG - Intronic
1171169730 20:23005094-23005116 AAGAACAATGAGAAGGATTAGGG + Intergenic
1171430063 20:25077539-25077561 AAAAATAATAAGAACGGTTCTGG + Intronic
1171566808 20:26201706-26201728 AAAAATATTGAGAAAGATTGGGG - Intergenic
1173483163 20:43419340-43419362 AAGAATAATTAAAAAGTGGCTGG + Intergenic
1176589882 21:8637098-8637120 AAGGAAAATTACAAAGATTTTGG + Intergenic
1176886818 21:14266482-14266504 AAAAATAATCACAAAGATCCTGG + Intergenic
1177242912 21:18484120-18484142 AAGAATAACTAAATAGATTGTGG - Intronic
1177342170 21:19817528-19817550 AAGAATAATGAGAGAGAAACAGG + Intergenic
1177572626 21:22906860-22906882 AATAATAAATAGATACATTCAGG - Intergenic
1177659506 21:24064518-24064540 GAGAATATTTATAAAGTTTCTGG - Intergenic
1177663878 21:24126274-24126296 AAGAAGAAATAAGAAGATTCAGG - Intergenic
1177688619 21:24473934-24473956 AACAAAAACTATAAAGATTCAGG + Intergenic
1177958503 21:27631084-27631106 AAGAATAATTATAAATACCCTGG + Intergenic
1178407017 21:32333197-32333219 AAGAATTATTTCCAAGATTCAGG + Intronic
1179391054 21:40991593-40991615 CAGAATATTTAAAGAGATTCTGG + Intergenic
1180015893 21:45083596-45083618 AAGAATATTTCGAATAATTCTGG + Intronic
1180272715 22:10614115-10614137 AAGGAAAATTACAAAGATTTTGG + Intergenic
1181775517 22:25157448-25157470 AAGAATAGTTAAAAAGAATGAGG - Intronic
1181777654 22:25171096-25171118 AAAAATAATAATAAAGATTATGG + Intronic
1181867518 22:25870612-25870634 AAGAACAATTCCACAGATTCAGG - Intronic
1183390534 22:37543305-37543327 AAAAGTATTTTGAAAGATTCAGG + Intergenic
1183862036 22:40677328-40677350 AAGCATGCTTAGAAATATTCTGG - Intergenic
949137404 3:584598-584620 AAGGAAAATTACAAAGATTTTGG - Intergenic
949803698 3:7931770-7931792 AAGAAAATTTTCAAAGATTCAGG + Intergenic
951308059 3:21090390-21090412 AAGAATAATTTGAATGTTCCTGG + Intergenic
951413995 3:22400758-22400780 AAGAAAAATGAGAAAGATCAGGG - Intergenic
951872354 3:27378061-27378083 AAGAATATTTAGAAAAATTCTGG + Intronic
952351739 3:32545921-32545943 AAGCTTAATAAGAAAAATTCAGG - Exonic
952546094 3:34420959-34420981 CAGGATGAATAGAAAGATTCGGG - Intergenic
952692925 3:36230975-36230997 AAGCATAAGAAGAAAGATCCAGG + Intergenic
953549044 3:43886301-43886323 AAAAAAAAAAAGAAAGATTCTGG - Intergenic
954157104 3:48691841-48691863 AAGAAAAAAAAGAAAGTTTCTGG - Intronic
954663978 3:52240813-52240835 AAGATTAATGAAAAAGATTAAGG + Intergenic
955294878 3:57725924-57725946 AAGAATCATCAGAAAAATTCTGG - Intergenic
955616901 3:60818966-60818988 AAAAATAAGCAGACAGATTCTGG - Intronic
955651407 3:61198181-61198203 AAGAATTATTGGAAGGATACTGG + Intronic
956088875 3:65642699-65642721 CCCCATAATTAGAAAGATTCTGG + Intronic
956549081 3:70438967-70438989 AAGAAAGATTAGAAAGACTCAGG + Intergenic
956571211 3:70697419-70697441 AATAATAAATAGAAAGAATGAGG + Intergenic
956709122 3:72024595-72024617 AAGGAAGATTAGAAAGACTCAGG - Intergenic
957202669 3:77157167-77157189 GAGAATAATAAGAAAGATAGGGG - Intronic
957955235 3:87177868-87177890 AAGAATTATGAGAGAGCTTCAGG - Intergenic
957986325 3:87576188-87576210 AAGAGTATTTACCAAGATTCTGG - Intergenic
959485863 3:106926806-106926828 AAGGAAGATTAGAAAGACTCAGG + Intergenic
959897964 3:111626933-111626955 AATAATAATTATAAACATTCAGG + Intronic
960235831 3:115280967-115280989 AAGAACAAGTAGTAAGAATCAGG - Intergenic
960520556 3:118649816-118649838 AACAATAAAAATAAAGATTCTGG - Intergenic
960816533 3:121679360-121679382 AAGAAAATTTAGAAAGATGGTGG + Intronic
961685586 3:128627955-128627977 AACAATAATTAGAAAAATTCAGG + Intronic
963456760 3:145555266-145555288 AAGGAAGATTAGAAAGACTCAGG + Intergenic
963634564 3:147777885-147777907 AATAATGTTTAGAAAAATTCTGG + Intergenic
964794421 3:160481701-160481723 AAAAAAAAATAGAAAGATTTAGG + Intronic
965587741 3:170334085-170334107 AAGAAAGAAAAGAAAGATTCTGG + Intergenic
965862075 3:173160036-173160058 AAGGAGGATTAGAAAGACTCAGG + Intergenic
966298155 3:178447971-178447993 AACATTAAAAAGAAAGATTCAGG + Intronic
967710813 3:192705906-192705928 ATGAATAATTGTAAAGAATCAGG - Intronic
968022282 3:195403658-195403680 AAGTATAATTTCAAAGTTTCAGG + Intronic
968120001 3:196119528-196119550 AAGAATGATTAGAAGGAGGCTGG + Intergenic
968421162 4:485990-486012 ATAAATAAATAGATAGATTCTGG + Intronic
968785641 4:2620550-2620572 AAGAATAATTAGCAAGTGGCAGG + Intronic
970356415 4:15258059-15258081 AAGAAGAAAAAGAAAGATTTAGG - Intergenic
970397841 4:15688551-15688573 AAGAAAAATTTGAAACATTAAGG + Exonic
970543428 4:17102179-17102201 AAGAATATCTAGAAAGGTTGTGG + Intergenic
971046671 4:22812693-22812715 AAGAATCAATGGAAAAATTCAGG - Intergenic
971112081 4:23598113-23598135 AACAAAAATTATAAAGATTCTGG - Intergenic
971310821 4:25524282-25524304 AAGAATAATAAAAAAGACTGTGG + Intergenic
971775118 4:30953379-30953401 TAGAAAAATTAGAAAGACTGGGG - Intronic
972255968 4:37355704-37355726 AAGACTACTAAGGAAGATTCTGG - Intronic
972992117 4:44833554-44833576 AAGATTAATTATAAAGATTATGG - Intergenic
973071682 4:45868123-45868145 AAGAATAAGTAGAAAGCTGCTGG + Intergenic
973169228 4:47118629-47118651 ATGATTAATAAGAAAGATTCAGG - Intronic
973571607 4:52245591-52245613 AGGAATATCTTGAAAGATTCTGG - Intergenic
974017037 4:56656788-56656810 AAGCATACTTAGAAAGAGTGGGG - Intronic
974364185 4:60925163-60925185 AACAATAATAGGAAAGCTTCTGG + Intergenic
974460630 4:62183254-62183276 AAGAAAGATTAGAAACATTAAGG - Intergenic
974869710 4:67625665-67625687 AACAATAATTAGAAGGATCTTGG - Intronic
974989545 4:69067889-69067911 AAGGATTATAAGAAAGATTGAGG + Intronic
975227377 4:71890362-71890384 AAAACTAAGTAGAAAGATTTAGG - Intergenic
975262641 4:72321574-72321596 AAAAACATTGAGAAAGATTCTGG + Intronic
975418547 4:74135346-74135368 AAGAATCATTAGAAACAATTAGG + Intronic
975419233 4:74142845-74142867 AAGAATCTTTACTAAGATTCAGG - Intronic
975594630 4:76037710-76037732 GTAAATAATTAGAAAAATTCAGG - Intronic
976221179 4:82758067-82758089 AGGAATAAGTAGAAACAATCTGG + Intronic
976572277 4:86626173-86626195 AAGAATAAGAAGAAAAACTCTGG - Intronic
977440012 4:97053794-97053816 AAGAATGGTTAGAATGTTTCTGG + Intergenic
977533987 4:98235320-98235342 GAGAATAATTTGAATGTTTCTGG - Intergenic
978320668 4:107491397-107491419 AAAAATATTGAGAAAGTTTCAGG + Intergenic
978507131 4:109470936-109470958 AAGAATAATAAACATGATTCAGG + Intronic
979133707 4:117082173-117082195 AAGAATAAAGGGAAAGATGCTGG - Intergenic
979843616 4:125478973-125478995 AAGAATAGTTAGATATGTTCAGG - Intronic
980017418 4:127667128-127667150 AAAACGACTTAGAAAGATTCAGG - Intronic
980381443 4:132024648-132024670 AAGAATAATTAGAATTACTGTGG + Intergenic
980606894 4:135103984-135104006 AAAAATAATTAGAAGGTCTCAGG - Intergenic
981766370 4:148254667-148254689 GTAAATAATTAGAAAGAGTCAGG + Intronic
982406657 4:155027966-155027988 GAAAATAATTAGAACGATTAAGG + Intergenic
982849709 4:160297104-160297126 AAAAGTAATTATAAAGATTGTGG - Intergenic
983321783 4:166203998-166204020 AAAAAAAACTAGAAAGATACTGG - Intergenic
984238623 4:177192221-177192243 CAGACTACTTATAAAGATTCAGG - Intergenic
984322091 4:178208751-178208773 AAGGAAGATTAGAAAGACTCAGG - Intergenic
984616899 4:181908596-181908618 AAGCATAAATAGAGAAATTCGGG + Intergenic
985389971 4:189483558-189483580 AAGGAAGATTAGAAAGACTCAGG + Intergenic
986576539 5:9219252-9219274 AGGAATAAGAAGAAAGACTCAGG + Intronic
986919682 5:12666634-12666656 AAGGAAGATTAGAAAGACTCAGG + Intergenic
987537138 5:19204074-19204096 TCCAATAATTAGAAAGAGTCTGG + Intergenic
987567175 5:19605531-19605553 AAGTTTAAATAGAAAGATTATGG - Intronic
987811492 5:22841846-22841868 AAGAATACTTAGGAAGCTGCTGG + Intronic
987921443 5:24286414-24286436 ATGATTATTTAAAAAGATTCTGG - Intergenic
988736737 5:34029985-34030007 AAAAAAAATTAGAAAAGTTCTGG - Intronic
990093650 5:52085839-52085861 AAGAATAATTAGGAATTTTTAGG - Intergenic
990178423 5:53133010-53133032 GAGCATAAGTGGAAAGATTCTGG - Intergenic
990196193 5:53319150-53319172 AAGATTAAATAGCAAGATGCAGG + Intergenic
991279445 5:64894942-64894964 AGGAATAATTAGAAATAAGCAGG + Intronic
991287444 5:64993648-64993670 AAAAAGAAATAAAAAGATTCTGG - Intronic
991316843 5:65318494-65318516 AAGAATAAATAGAGAAAATCTGG + Intronic
991400608 5:66247069-66247091 AAAAATAACTAGAATGAATCTGG + Intergenic
992014602 5:72563154-72563176 TAAAATAATTAGAAAGAGCCTGG + Intergenic
992888005 5:81178286-81178308 AGGAATAATTCCAAAGTTTCAGG + Intronic
993070375 5:83154598-83154620 AAGAAAAACCAGAAAGACTCAGG - Intronic
993198334 5:84780161-84780183 AAGAATAATTAATTAAATTCAGG + Intergenic
993677915 5:90839604-90839626 AAGAATAATTACAAAGGCACTGG - Intronic
993703548 5:91144904-91144926 AAGAATTATAAGAGAGAATCTGG - Intronic
993795561 5:92262515-92262537 AAGAATAATTCAAAAGAATTTGG + Intergenic
993953815 5:94207745-94207767 AAGAAAGATTTGAAAGATACAGG - Intronic
994086358 5:95763543-95763565 AGGAAGAAGTTGAAAGATTCTGG + Exonic
994496472 5:100518949-100518971 AAAAATAATTAAAATAATTCTGG + Intergenic
994819454 5:104630457-104630479 AAGAATACTTAGAAAAATATGGG + Intergenic
995281940 5:110345589-110345611 AAAAAAAATTACAAGGATTCTGG - Intronic
995420139 5:111955731-111955753 AAGAATAATGAGAAATATCCAGG + Intronic
995546948 5:113242144-113242166 CAGATTCATTAGAAATATTCTGG + Intronic
995616311 5:113968182-113968204 AAGAATATTCCGAAATATTCAGG - Intergenic
996149128 5:120013873-120013895 GAGAAGAATTAAAAAGCTTCGGG + Intergenic
996163832 5:120200216-120200238 ATAAATAATCAGAAAAATTCAGG + Intergenic
996255715 5:121401196-121401218 AAGAATAATGGGAGAGATTAGGG + Intergenic
996413952 5:123189333-123189355 AAAAAAAATTAGAAATATACAGG - Exonic
996424309 5:123296058-123296080 TAGAATACCTAGAATGATTCAGG + Intergenic
996613928 5:125416708-125416730 AAAAATAAATAGAAAGATGTCGG - Intergenic
997194940 5:131973110-131973132 AGGAAGAATGAGAAAGAGTCAGG + Intronic
999970764 5:156859919-156859941 CAGAATAGGAAGAAAGATTCTGG - Intergenic
1000331575 5:160209930-160209952 AAGTATAATAAGAAAATTTCAGG + Intronic
1000448562 5:161356253-161356275 AAAAATAAATAGAATTATTCTGG - Intronic
1000784365 5:165525790-165525812 AAGAATCATTACAAACATACAGG + Intergenic
1000790959 5:165606711-165606733 CAGAGAAATTAGAAAGATTTTGG - Intergenic
1000974852 5:167753475-167753497 AAGAGTAATTAGGAAGAGACTGG + Intronic
1001116366 5:168944144-168944166 AAGAATAATTACAAAATCTCGGG - Intronic
1001515040 5:172349736-172349758 TAGACTAATTAGAAGGTTTCTGG + Intronic
1003588459 6:7415722-7415744 AGGAATAGTTACACAGATTCAGG + Intronic
1004378539 6:15112512-15112534 AAGAATAATTATAAACAGCCTGG + Intergenic
1004723728 6:18291316-18291338 AAGAATAATTAGAAAAGTCATGG + Intergenic
1004847548 6:19662075-19662097 ATGAACAATTAGAAACTTTCAGG + Intergenic
1005014751 6:21365587-21365609 AAGGAAGATTAGAAAGACTCAGG + Intergenic
1005078631 6:21934158-21934180 AACAATGATTAGAATGATTATGG - Intergenic
1005089830 6:22044737-22044759 AAGAATAATTCAAAATATTTTGG - Intergenic
1005614788 6:27561893-27561915 CAGAATAATTGGAGAGCTTCCGG - Intergenic
1005721067 6:28602516-28602538 AAAAATTATTAGGAAGATTTAGG - Intronic
1006008699 6:31024383-31024405 AAGGATAATGAGACAGATTCAGG + Intronic
1006306644 6:33225241-33225263 ATGAATAAATAGAGAGATTATGG + Intergenic
1006696508 6:35934878-35934900 ATGAATGAATAAAAAGATTCAGG + Intergenic
1007943246 6:45801805-45801827 AGGAATAATGAGAAAGCTTCTGG + Intergenic
1008342236 6:50381296-50381318 AAAAATAACTGCAAAGATTCTGG - Intergenic
1008344236 6:50406670-50406692 AAGATTTAAGAGAAAGATTCCGG - Intergenic
1008353903 6:50528419-50528441 AAGAAGGCTTATAAAGATTCAGG - Intergenic
1008506194 6:52232502-52232524 AAGAATAACTAAATAAATTCTGG + Intergenic
1008794320 6:55282801-55282823 AAAAATCATTGGATAGATTCTGG - Intergenic
1009476577 6:64099065-64099087 AAGATAAATTAGAAGGATTGAGG - Intronic
1009551466 6:65099457-65099479 AAGAATAATTAAAAAGAAAGAGG + Intronic
1010319644 6:74490825-74490847 AATAATAATTAAAAAAATTTGGG + Intergenic
1010453807 6:76031780-76031802 AAGAATAGTTAGTAAAATCCTGG + Intronic
1010483418 6:76381439-76381461 TAAAATAATTAGAAAGAATCAGG - Intergenic
1010544961 6:77141689-77141711 TAGAATAATTAGAATAATTCTGG + Intergenic
1010843272 6:80674356-80674378 AAGAATAATTATCCAGATTGAGG + Intergenic
1011957805 6:93045021-93045043 AAGAATAATTAGTTATCTTCAGG + Intergenic
1012094057 6:94935345-94935367 AAGATTAATTAAAAATATCCAGG + Intergenic
1012351994 6:98263244-98263266 AAGAAAGATTAAAGAGATTCTGG - Intergenic
1012556523 6:100520114-100520136 AAGAATAATTAGAATTTTCCAGG - Intronic
1012791799 6:103708356-103708378 AAGAATAATTAAAGAAATTGGGG + Intergenic
1013024644 6:106259207-106259229 AAGTATAATTTGTAAAATTCTGG - Intronic
1013446928 6:110238918-110238940 AAGGACAATGAGAAAGATTGAGG + Intronic
1013759615 6:113501504-113501526 CGGAATAAATAGAAATATTCTGG + Intergenic
1014353937 6:120380086-120380108 AATAAGAATTAAAAATATTCAGG + Intergenic
1014786878 6:125629684-125629706 AGGAAAAATTAGACAGATTATGG - Intergenic
1014909715 6:127077046-127077068 AAGAAAAACTAGAAACATACAGG + Intergenic
1015193245 6:130495253-130495275 AAGAAAAATTATAAAAACTCTGG - Intergenic
1015504636 6:133970321-133970343 AATAATAATTTGATAAATTCTGG + Intronic
1015609553 6:135001323-135001345 ATGAATAATTATAAAGATAATGG - Intronic
1015669779 6:135675321-135675343 AAGAATAAATAGAAATATGAGGG - Intergenic
1016607215 6:145944028-145944050 ATGAAAAATTAGAAAGATAAAGG + Intronic
1016650386 6:146454496-146454518 AAGGAAGATTAGAAAGACTCAGG + Intergenic
1016825389 6:148383651-148383673 TAGAATAAGTTGACAGATTCAGG - Intronic
1016925545 6:149343005-149343027 AAGTTAAATTAGAAATATTCAGG - Intronic
1016977603 6:149824395-149824417 AAGAATAATTTTCAATATTCTGG - Intronic
1017308739 6:152952204-152952226 AAGGATGACTAGATAGATTCAGG - Intergenic
1017671561 6:156774303-156774325 AAGAATAGTTAGAAATATGATGG + Intergenic
1018102079 6:160449347-160449369 GAAAAAAATTAGAAAGAATCTGG - Intronic
1019110583 6:169708278-169708300 AAGCATAATTATTAGGATTCCGG - Intronic
1020028846 7:4919152-4919174 CAGAATTATTAGAAAGATTAGGG + Intronic
1020729255 7:11860849-11860871 AAGAATATTTTGAAAGATCTAGG + Intergenic
1021025797 7:15665559-15665581 AAGAATAATTTGGACCATTCTGG - Intronic
1022308730 7:29174875-29174897 AAGAATTTTTAGAGAGATACAGG + Intronic
1022485697 7:30775912-30775934 AAGAATAATTCCAAAGTTTTGGG - Intronic
1023880419 7:44316952-44316974 GAGAATAATTAAGAAGACTCAGG - Intronic
1024454525 7:49588235-49588257 AAGAAAAATTAGAAAAATGATGG - Intergenic
1025111432 7:56219886-56219908 ATGATATATTAGAAAGATTCAGG + Intergenic
1025723854 7:64040096-64040118 AATAATACTTACAAAGACTCTGG + Intronic
1027008372 7:74718675-74718697 AACAAAAATTAGAAAAACTCTGG - Intronic
1027295231 7:76763358-76763380 AAGAATCATTGGATAGATTTAGG + Intergenic
1027365495 7:77453498-77453520 AAGATGAATTAGAAAGATGCAGG + Intergenic
1027528308 7:79299231-79299253 AAGATTAAGTAGAAATTTTCCGG + Intronic
1027765433 7:82334950-82334972 AAACATAATTAGAAATATTTTGG + Intronic
1028154285 7:87411571-87411593 AATCATAATTAGAAAGTTGCTGG - Intronic
1028556525 7:92132150-92132172 AATAATAATTGGACATATTCTGG - Intronic
1030000606 7:105056202-105056224 AAGTATATTTAGAATCATTCCGG + Intronic
1030136046 7:106249809-106249831 AAGAATCATTCGAAAGAAACTGG + Exonic
1030458751 7:109805340-109805362 CAGAATACTTAGAAAGCTCCAGG - Intergenic
1030512945 7:110507191-110507213 AAGAATAATTTGGAAAATTGTGG - Intergenic
1030711620 7:112757010-112757032 AAGATTAATCAGAAATATTTGGG - Intergenic
1030848383 7:114451999-114452021 AAGAAAAATAAGAAAGTTTAAGG - Intronic
1031453737 7:121954312-121954334 AAGAATAAATGGAAAAATTTGGG - Intronic
1033077450 7:138262859-138262881 AAGATTGTTTAGAAAGATTAGGG - Intergenic
1033182939 7:139198633-139198655 AAGAAGAATCTGTAAGATTCTGG - Intergenic
1033631987 7:143167336-143167358 AAGAATAATTATAAGGGTTGGGG - Intergenic
1033804472 7:144938031-144938053 ATTAATAATTATAAAGATTGTGG - Intergenic
1033947141 7:146734056-146734078 AATAATAATAATAAAGATGCTGG + Intronic
1034386001 7:150741830-150741852 GAGAATTATTAGAAAGAGGCAGG - Intronic
1035291609 7:157842824-157842846 AAGAATAGTTAGAAAGCATTTGG - Intronic
1036007458 8:4682479-4682501 TAGAATAATATGAAAGATACAGG + Intronic
1037083174 8:14812681-14812703 ATGAATAATTAAGATGATTCTGG + Intronic
1037184774 8:16049312-16049334 AAGAATAATTATAATAAATCAGG + Intergenic
1038307329 8:26416717-26416739 AAGAGTAATTGGCAAGCTTCTGG - Intronic
1039839543 8:41284156-41284178 AAGAATAATAAGAAAGAGTCTGG + Intronic
1041335338 8:56775834-56775856 AAGAATATTAAGAAACATTCAGG + Intergenic
1041483086 8:58344863-58344885 TAAAATGATTACAAAGATTCAGG + Intergenic
1041860484 8:62507567-62507589 AAGTATAATTATAAGGCTTCTGG - Intronic
1042093596 8:65187175-65187197 AATTATAATTAGATAGAATCTGG + Intergenic
1042095230 8:65208290-65208312 AAGAACAATAACAAAAATTCAGG - Intergenic
1042108513 8:65355030-65355052 AGGAATGATTATCAAGATTCAGG - Intergenic
1042190716 8:66184253-66184275 AAGGAAAATTAGAATGATACTGG - Intergenic
1042305600 8:67328459-67328481 AACAATAATCAGAGAGATGCTGG - Intronic
1042636824 8:70885890-70885912 AAGTATAATTAAAAAAAGTCCGG - Intergenic
1042694817 8:71545384-71545406 AAGAAAAATTAGACACTTTCAGG + Intronic
1043197483 8:77315842-77315864 AAGAATATCTAATAAGATTCTGG - Intergenic
1043732860 8:83706794-83706816 AAGAATAATTAAAAATATAGGGG - Intergenic
1044040849 8:87366747-87366769 AACAATAAATAGAAAGCTTAGGG - Intronic
1044688030 8:94846568-94846590 AAGAATAAGTAAAAAGAGGCTGG - Intronic
1044710993 8:95057716-95057738 AAGAATAATTACAAGTATTTAGG - Intronic
1045598575 8:103686755-103686777 AAAAAAAATTACAAAGATACTGG - Intronic
1045635382 8:104180874-104180896 GAGAAGAATTAGAAAGCTACAGG - Intronic
1045753597 8:105515136-105515158 AAGAAAAGTTAGAAAGTTACTGG + Intronic
1046209526 8:111050598-111050620 AAGAATATCTATAAAAATTCTGG - Intergenic
1046272845 8:111918425-111918447 CAGAACATTTAGAGAGATTCTGG - Intergenic
1046279923 8:112013676-112013698 AAGAATAAGAAGAAAGATGTAGG + Intergenic
1046346704 8:112938293-112938315 AAGAATAAAGAGAAAGTTGCAGG - Intronic
1046653977 8:116873885-116873907 AAGAATGATCAGAAAAGTTCAGG + Intronic
1046810364 8:118526581-118526603 AAGACTATTTAGAAAGGTGCTGG + Intronic
1047743834 8:127828944-127828966 AAGCATAATAATAATGATTCAGG + Intergenic
1048612842 8:136042453-136042475 CAGAATAATTTGATGGATTCTGG + Intergenic
1048689135 8:136939201-136939223 AAGAATAATTCTAAAGGTTTTGG - Intergenic
1048994102 8:139779809-139779831 AGCAATAATTAGAAGGATGCAGG + Intronic
1050573145 9:6963581-6963603 AACAATACAGAGAAAGATTCAGG + Intronic
1051103409 9:13549114-13549136 AAGAAGAATTAGAAACCATCAGG + Intergenic
1051530077 9:18092363-18092385 AAGAATGAGTAGAAAGTATCAGG + Intergenic
1051705326 9:19872999-19873021 AAGAAGAAGAAGAATGATTCAGG + Intergenic
1052237535 9:26229941-26229963 ATGAATAAGTAGAAAGATAAGGG + Intergenic
1053898195 9:42765661-42765683 AAGAATAACTAGGAAGCCTCAGG - Intergenic
1054752743 9:68925139-68925161 AAGAATGGTTAAATAGATTCTGG - Intronic
1055302685 9:74898771-74898793 AAGAAAAATAAGAATGCTTCTGG - Intergenic
1056082104 9:83106255-83106277 AAGAATAAACAGAGAGATACGGG - Intergenic
1056668701 9:88604522-88604544 GACTATAATTAGAAAGCTTCAGG - Intergenic
1057413730 9:94842860-94842882 AAGAATAATTTGAATGATGGTGG - Intronic
1058334863 9:103813961-103813983 AACAAAAATTAGAAAAATTTGGG - Intergenic
1058360531 9:104141667-104141689 AAGAAAAACTAGAAAGATTTTGG + Intergenic
1058612307 9:106789800-106789822 AAGGAAGATTAGAAAGACTCAGG - Intergenic
1058782859 9:108356015-108356037 AGGAATAATTATAAGGATACAGG + Intergenic
1060663355 9:125417283-125417305 AATAATATTTAGAAATATTGAGG + Intergenic
1060862889 9:126970059-126970081 AAGAATTATTTGAGTGATTCTGG + Intronic
1203619897 Un_KI270749v1:115749-115771 AAGGAAAATTACAAAGATTTTGG + Intergenic
1186830465 X:13384809-13384831 AAATAAAATTAGAAAGATCCTGG + Intergenic
1187079401 X:15971156-15971178 AAGATTAATTAGAAATAAACTGG - Intergenic
1187296328 X:18004601-18004623 AAGAAAAAGTAGAGAGAATCAGG + Intergenic
1187597619 X:20791171-20791193 ACAAATAATTAGAATGATTCTGG + Intergenic
1188297761 X:28470870-28470892 GAGAATAAGTAGAATAATTCTGG + Intergenic
1188840138 X:35007099-35007121 AGGAATTATTAAAAAGAATCAGG + Intergenic
1189030766 X:37447567-37447589 AAGAAAAATTTGAAACATTAAGG - Intronic
1190582152 X:51899740-51899762 TAGAAAAATTAGAAAAATTCTGG - Intronic
1190689547 X:52902014-52902036 AAAAAGAAATAGGAAGATTCTGG - Intronic
1190696436 X:52953778-52953800 AAAAAGAAATAGGAAGATTCTGG + Intronic
1191046911 X:56148272-56148294 AAGAATAATTGGAAGAATTAGGG - Intergenic
1193131382 X:77923472-77923494 AAAACTAATTAGAAAGTATCTGG + Intronic
1193741741 X:85225581-85225603 AAGAATGAGTAGAAGCATTCTGG + Intergenic
1194605054 X:95968085-95968107 AACAATAATTAGAAATAGTGTGG - Intergenic
1194761033 X:97796187-97796209 AAGTTTAATTAGAAAGTGTCAGG - Intergenic
1195220399 X:102740749-102740771 GAAAATAATTAAAAAGAATCAGG + Intronic
1195227020 X:102807049-102807071 AAGAATAATTCCAATGTTTCAGG - Intergenic
1195268748 X:103210717-103210739 AAGAATATTTTAAAAGATACAGG + Intergenic
1195880985 X:109592337-109592359 AAGAGAAATTAGAGAAATTCAGG - Intergenic
1195936705 X:110132419-110132441 AAGAATAATAACCAAAATTCAGG - Intronic
1196001705 X:110794265-110794287 AAGTATAATTTGAAAAATTAAGG - Intronic
1197106064 X:122717714-122717736 AAGAATAAATTGAAAGCTTGGGG - Intergenic
1197349617 X:125367923-125367945 AAAAATAAATATAAATATTCAGG + Intergenic
1197354740 X:125424293-125424315 CTGAATAATTAGAATAATTCGGG - Intergenic
1197547944 X:127850553-127850575 AAAAATAATTAGAAGAATTGGGG - Intergenic
1197563851 X:128057017-128057039 AAGTATAATTAAAAACATTTTGG + Intergenic
1197973522 X:132140413-132140435 AAGAATAGTCAGGAAAATTCTGG - Intergenic
1198023583 X:132682951-132682973 AATAATAATTAAAATGATCCGGG + Intronic
1199009521 X:142742301-142742323 ACTAATAAATAGAAAAATTCAGG + Intergenic
1199269456 X:145865545-145865567 AAGAATAATTAAAATGATGAGGG + Intergenic
1199331655 X:146567548-146567570 GAGAAAAATTACAAAGATTCTGG + Intergenic
1199674909 X:150180437-150180459 AACAATACTTTGCAAGATTCTGG - Intergenic