ID: 945615873

View in Genome Browser
Species Human (GRCh38)
Location 2:212065807-212065829
Sequence AATCCTAGCTCTATGGGGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 209}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945615873 Original CRISPR AATCCTAGCTCTATGGGGTT GGG (reversed) Intronic
900699306 1:4034214-4034236 AATCCCTCCACTATGGGGTTTGG - Intergenic
900976219 1:6018188-6018210 AATCCCAGCACTTTGGGATTGGG - Intronic
902177447 1:14661636-14661658 AATCCCAGCACTTTGGGATTGGG + Intronic
903110746 1:21130977-21130999 AATCCCAGCACTTTGGGATTTGG + Intronic
903116545 1:21183129-21183151 AATCCCAGCACTTTGGGATTAGG + Intergenic
903577286 1:24346743-24346765 AAACCTAGCTCCAAGGGGTAAGG - Intronic
905581217 1:39083742-39083764 GAACCTAGCCCTATAGGGTTGGG - Intronic
907040412 1:51253878-51253900 AATCCTAGCACTTTGGGATGTGG + Intronic
907054983 1:51358059-51358081 AATCCTAGTTCTGTGGGTGTGGG + Intronic
908335218 1:63115817-63115839 AATGTAAGCTCCATGGGGTTAGG - Intergenic
909802565 1:79830525-79830547 AATCCCAGCTTTATGAGTTTGGG + Intergenic
912994835 1:114522353-114522375 AATCCTAGTTGTAGGGGGTGGGG - Intergenic
914217339 1:145644088-145644110 AAGCCTAGCTCTTAGGAGTTTGG - Intronic
914469908 1:147966773-147966795 AAGCCTAGCTCTTAGGAGTTTGG - Intronic
915524523 1:156467728-156467750 AATCCTGGCCCTATGGGGAGAGG - Intronic
918690056 1:187468472-187468494 AATTATAGTTCTATGGTGTTTGG + Intergenic
921436335 1:215127696-215127718 AATGCAAGCTCTATGAAGTTAGG + Intronic
921983480 1:221284693-221284715 CATCCTAGCTCTGTGGTTTTGGG - Intergenic
922844817 1:228676396-228676418 AATCCTAGCACTTTGGATTTTGG + Intergenic
923423294 1:233842739-233842761 AATACAAGCTCCATGGGGTAAGG + Intergenic
924057059 1:240134362-240134384 AATCCCAGCACTTTGGGATTGGG + Intronic
1063561660 10:7133935-7133957 AATCCTAGCCCTTTGAAGTTAGG - Intergenic
1064404688 10:15050834-15050856 AATCCTAGCACTTTGGGGCCAGG - Intronic
1064980080 10:21157754-21157776 ATTCCGAGGTCTGTGGGGTTAGG - Intronic
1065316009 10:24464736-24464758 AATCCTAGCACTTTGGGATGTGG - Intronic
1065547568 10:26837351-26837373 TACCCTAGCTCTATGGGATCAGG + Intronic
1066079980 10:31921021-31921043 AATCCCAGCTCTTTGGGAGTCGG + Intronic
1069439438 10:68414604-68414626 AATCCTAGCAAAATGGGCTTTGG + Exonic
1069656342 10:70092041-70092063 AATCCTATGCCTCTGGGGTTAGG - Intronic
1070225181 10:74496720-74496742 AATCCTAGCACTATGGGAGGTGG - Intronic
1072155719 10:92721912-92721934 AATCCTAGCTGTATGACCTTAGG + Intergenic
1074605380 10:114958874-114958896 AATCCTAGCACTTTGGCTTTGGG + Intronic
1078463149 11:11530618-11530640 AGTCCCAGCTCTATGTGGTCTGG - Intronic
1082266633 11:50126174-50126196 GATCTTAGCTCTTTGGGGTATGG + Intergenic
1082289456 11:50352394-50352416 GATCTTAGCTCTTTGGGGTATGG - Intergenic
1082635907 11:55593510-55593532 AATCCTAGCACTATGGGAGATGG + Intergenic
1084320831 11:68372626-68372648 ACTCCCCGCTCCATGGGGTTTGG + Intronic
1084837270 11:71812001-71812023 AATACTAACCCTATGGGCTTGGG - Intergenic
1087488808 11:98795109-98795131 AATACTAGCTGTATGAGTTTGGG - Intergenic
1094408478 12:30144861-30144883 AAGCCTAGCTCTATAGAGATGGG + Intergenic
1094865510 12:34526085-34526107 AGTCCTAGCTCTGTGGAGATAGG - Intergenic
1096281546 12:50259068-50259090 AATCAAAGTTCTGTGGGGTTAGG - Intronic
1097665200 12:62470158-62470180 AATCCTAGCACTTTGGGAGTAGG - Intronic
1100922292 12:99501637-99501659 AATCCTAGTTCTATGGAGGAAGG + Intronic
1102486543 12:113261845-113261867 AATCCTAGATGTAAGGGGGTGGG - Intronic
1104395405 12:128428069-128428091 AATCCTATTTGTGTGGGGTTTGG + Intronic
1107103689 13:36621459-36621481 AATCCTAGCACTTTTGGGATTGG + Intergenic
1107575636 13:41717830-41717852 ATTTCTAGCTATATGCGGTTGGG + Intronic
1108975108 13:56432115-56432137 AATCCTAGCTCTTTGGGACTTGG + Intergenic
1109853014 13:68092113-68092135 AATCCTAGCAAGATGGAGTTTGG - Intergenic
1110218466 13:73048651-73048673 AATCCTAGCACTTTGGGGGCAGG + Intergenic
1111110887 13:83707652-83707674 AATCCCAGCACTTTGGGATTGGG - Intergenic
1112079062 13:95947707-95947729 AATCCCAGCACTTTGGGATTTGG - Intronic
1113204170 13:107896637-107896659 ACTCCTAACTCTTTGGAGTTGGG - Intergenic
1114073886 14:19140349-19140371 ATTACTAGCTCTATGGCTTTTGG - Intergenic
1114088380 14:19259624-19259646 ATTACTAGCTCTATGGCTTTTGG + Intergenic
1116378948 14:44240437-44240459 AATCCTAGCACTTTAGGCTTTGG - Intergenic
1117711217 14:58531055-58531077 AATCCCAGCACTTTGGGCTTTGG + Intronic
1119099480 14:71866913-71866935 AATCCTAGCACTTTAGGGGTCGG + Intergenic
1119196143 14:72718001-72718023 GATCCTACCTCCAAGGGGTTTGG + Intronic
1120312439 14:82846879-82846901 AATCCTGGCTATATAGGGTATGG - Intergenic
1121313488 14:92947511-92947533 ACTCCTAGCTCTGTGGACTTCGG + Intronic
1125919925 15:43519286-43519308 AACCCACGCTGTATGGGGTTTGG + Intronic
1126896620 15:53264484-53264506 AATTCTTGAACTATGGGGTTGGG - Intergenic
1127196973 15:56597739-56597761 TATCCTAGCTCAAAGGGGGTTGG + Intergenic
1127958222 15:63871409-63871431 AAGCCTAGATTTATGAGGTTGGG + Intergenic
1129103355 15:73286932-73286954 AAGAATAGCTCTGTGGGGTTGGG - Intronic
1131037433 15:89232532-89232554 AATACTATCTCTTTGGGGCTTGG - Intergenic
1131070004 15:89460214-89460236 TCTCCTAGCTCTGTGGCGTTGGG + Intergenic
1131278515 15:91002369-91002391 AATCCCAGCACTTTGGGTTTGGG + Intronic
1135049502 16:19181081-19181103 AATGGTAGCTGTATGGGATTGGG + Intronic
1136240831 16:28942842-28942864 AATCCCAGCACTTTGGGCTTTGG - Intergenic
1138620750 16:58209243-58209265 AATCCCAGCACTTTGGGATTTGG - Intergenic
1139496810 16:67326278-67326300 AATCCTGGCTCTGAGGAGTTGGG - Intronic
1140738721 16:77922783-77922805 AATCCTGGCTCCATGGGGAGGGG - Intronic
1142364296 16:89641888-89641910 ATTCCCAGCTCTCTAGGGTTGGG - Intergenic
1142827792 17:2525094-2525116 AATCCTAGCACTTTGGGGCCGGG - Intergenic
1145800390 17:27679343-27679365 AATCCTAGCACTTTGGGAGTCGG + Intergenic
1146080889 17:29779584-29779606 AATCCCAGCACTTTGGGGTCAGG + Intronic
1146940840 17:36843345-36843367 AATCCTAGCACTTTGGGAGTGGG + Intergenic
1147057898 17:37848248-37848270 AATCCTAGCACTTTGTGATTGGG + Intergenic
1147467513 17:40621792-40621814 AATACTAGCTCTGTGGGTTTCGG - Intergenic
1148027560 17:44599263-44599285 AATCTTTGCTCTGTGGGGCTGGG + Intergenic
1148051305 17:44771374-44771396 GTTCCTAGCCCTCTGGGGTTAGG - Intronic
1149355922 17:55839473-55839495 AAACCAGGCTCCATGGGGTTGGG - Intronic
1152086367 17:78221586-78221608 AATCCCAGCACTTTGGGTTTGGG - Intronic
1152172997 17:78766000-78766022 AATCCCAGCACTTTGGGGGTGGG + Intronic
1153191240 18:2541873-2541895 AATCATAACTCTAGGGGTTTGGG - Intronic
1153223733 18:2882497-2882519 AATCCCAGCACTTTGAGGTTGGG + Intronic
1153892053 18:9526445-9526467 AATCCTAGCACTTTGGGGGGTGG - Intronic
1161236089 19:3198921-3198943 AATCCAAGCCCTGTGGGGTGGGG - Intronic
1162290927 19:9779824-9779846 AATCCTAGCACTTTGGGAGTTGG - Intronic
1162913715 19:13863603-13863625 AATCATACCTCCATGGGGTTGGG - Intronic
1163436462 19:17298701-17298723 AATCCCAGCACTATCGTGTTTGG - Intronic
1163505704 19:17704762-17704784 AATCCTAGCACTTTGGGATGCGG + Intergenic
1165033090 19:33012428-33012450 AATCCCAGCACTTTGGGGTGTGG - Intronic
1167291573 19:48627913-48627935 ACTCCTGGGTCTATGGGGCTGGG + Intronic
926063793 2:9821386-9821408 AATCCCAGCTGTTTGGGGTGAGG + Intergenic
927727488 2:25437860-25437882 AATCTGAGCTCCATGGGGGTGGG - Intronic
928143368 2:28750426-28750448 AATCCTAGCTCTATGTCATCTGG + Intergenic
930457102 2:51618868-51618890 AATCCCAGCACTTTGGGATTAGG - Intergenic
930546248 2:52771098-52771120 AATCCTAGCACTTTGGGAGTTGG + Intergenic
930687283 2:54323390-54323412 AATCCTAGCTCTGTGACTTTAGG - Intergenic
931421982 2:62136446-62136468 AATCCCAGCACTTTGGGCTTTGG - Intronic
932723379 2:74156893-74156915 AATCCTAGCACTTTGGGATTTGG - Intronic
932765935 2:74469920-74469942 AATCCCAGCACTTTGGGATTTGG - Intergenic
934027830 2:88015849-88015871 AATCCCAGCACTTTGGGGTTGGG + Intergenic
934552289 2:95269881-95269903 AATCCCAGCACTATGGGGGCCGG - Intergenic
935347060 2:102118236-102118258 AATCCCAGAACTCTGGGGTTTGG + Intronic
938487819 2:131731739-131731761 ATTACTAGCTCTATGGCTTTTGG - Intronic
938641381 2:133284288-133284310 AATCCCTACTCTATGGGGTAGGG - Intronic
940642013 2:156354954-156354976 AATCCCAGCAGTTTGGGGTTTGG + Intergenic
940795112 2:158069651-158069673 AATCCTCGCTCTAGGGTGTCAGG - Intronic
943619409 2:190131374-190131396 AATCCCTGAACTATGGGGTTTGG + Intronic
944275180 2:197829184-197829206 AACCCTAGCTGTATGTGATTGGG + Intronic
945615873 2:212065807-212065829 AATCCTAGCTCTATGGGGTTGGG - Intronic
945979004 2:216293846-216293868 AAACCAAGCTATATGGGGTCTGG + Intronic
946919398 2:224562699-224562721 AATCCCAGCTCTATGATTTTGGG - Intronic
946964663 2:225025130-225025152 AATGCAAGCTCTCTGGGCTTTGG + Intronic
1170257752 20:14364011-14364033 AATCCGAACTCTAGGGGTTTGGG + Intronic
1170643978 20:18180120-18180142 AATCCTAGCACTATGGGAGACGG - Intronic
1170647856 20:18212804-18212826 AATCCCAGCACTTTGGGCTTTGG + Intergenic
1174026845 20:47584039-47584061 GATCCTAGCACTTTGGGGATTGG + Intronic
1175528304 20:59652282-59652304 AATCCCAGCACTTTGGGGTGGGG + Intronic
1176981452 21:15385939-15385961 AATTCAAGTCCTATGGGGTTGGG + Intergenic
1178878173 21:36428504-36428526 AATCCCAGCTATTTGGGGGTGGG - Intergenic
1179270385 21:39846147-39846169 AAGCCAAGCTCTATGGGGACAGG + Intergenic
1179784285 21:43720663-43720685 ACTCCTAGCTTGAGGGGGTTGGG + Intronic
1180492333 22:15862713-15862735 ATTACTAGCTCTATGGCTTTTGG - Intergenic
1181751630 22:24992960-24992982 AATCCTACCTCTATGAGCATGGG - Intronic
1182038214 22:27215995-27216017 AATACTTGCTCTAAGTGGTTGGG - Intergenic
1183917232 22:41131420-41131442 AATCCTAGCTCTCTAGGGGTGGG + Exonic
1183923032 22:41184429-41184451 AATCCCAGCACTTTGGGTTTGGG + Intergenic
1184259388 22:43305929-43305951 ATTTCTAGCTGTATGTGGTTGGG + Intronic
1184299537 22:43548282-43548304 AATCCCAGCCCTTTGGGATTAGG + Intronic
949782713 3:7708165-7708187 AAACCTAGCTAGATGGTGTTGGG - Intronic
953101163 3:39829632-39829654 AGTCCTGGCTCAATGGGGTTGGG + Intronic
953796431 3:45989561-45989583 AATCATAGGTCCAAGGGGTTGGG - Intronic
954208944 3:49082944-49082966 AATCCTAGCACTATGGACTTTGG + Intronic
954539609 3:51384972-51384994 ACTGCTAGCTGAATGGGGTTCGG - Intergenic
955341277 3:58127202-58127224 AATCCTAGCTATGTGGGGTGGGG + Intronic
955347091 3:58169395-58169417 GATCCTAGTTGTATGGGGGTGGG + Intronic
955391160 3:58523352-58523374 AATGTTAGCTCTATGAGTTTGGG + Intronic
955693426 3:61612197-61612219 AATCCCAGCACTTTGGGATTAGG - Intronic
956859690 3:73309923-73309945 AATCCCTGCCTTATGGGGTTTGG + Intergenic
957305900 3:78458618-78458640 ACTCATAGCTCTATGTGGCTGGG + Intergenic
957807658 3:85170584-85170606 AATCCTAGCACTATGGGAGATGG - Intronic
961203895 3:125065896-125065918 GATCCTTGCTATATGAGGTTGGG - Intergenic
963060945 3:141225714-141225736 AATCATAGTTGTATTGGGTTTGG + Intergenic
963715512 3:148798458-148798480 AATTCTAGCTCTAAGGGGTATGG - Intronic
966556271 3:181263811-181263833 AATCCAAGTTCTTTAGGGTTTGG + Intergenic
971578214 4:28303751-28303773 AACCCTGGCTCTTTGGAGTTGGG + Intergenic
972661913 4:41124461-41124483 AATCCCAGCACTTTGGGATTTGG - Intronic
973239203 4:47939265-47939287 AATCCCTGAACTATGGGGTTTGG + Intronic
977106734 4:92895343-92895365 AATTCAAGCTCTTTGGGTTTTGG - Intronic
982624084 4:157743467-157743489 AATCCTTGCTCTTTTGGATTTGG + Intergenic
983982501 4:174016132-174016154 AATCCTCGCTTGATGGGGATGGG - Intergenic
987257493 5:16171259-16171281 CAACTTAGCTCCATGGGGTTGGG - Intronic
990225410 5:53646878-53646900 AATCATAGGTCTATGTGTTTAGG + Intronic
990629584 5:57653125-57653147 AATACCTGCTCTATGGGGTGTGG - Intergenic
991470546 5:66964504-66964526 AATCCTAATCCTATGGGGCTGGG + Intronic
992237329 5:74724376-74724398 AATCCTAGCACTTTGGGTTTGGG + Intronic
993208378 5:84916353-84916375 CATCCTAGCTCTATGACCTTAGG + Intergenic
993716856 5:91283433-91283455 AATCCTAGCACGTTGGGGGTTGG - Intergenic
994657687 5:102614032-102614054 ACTCATAGTTCTATGGGGCTTGG - Intergenic
994946835 5:106404913-106404935 AACCCAAGCCCTATGGGATTAGG + Intergenic
996191973 5:120555656-120555678 AATGCTATCACTTTGGGGTTAGG + Intronic
997533850 5:134600382-134600404 AATCCTAGCACTTTGGACTTTGG + Intergenic
998304912 5:141065376-141065398 AATCCCAGCACTTTGGGGTGAGG + Intergenic
999293722 5:150444763-150444785 AATCCTAGCACTTTGGGCTTTGG + Intronic
999969507 5:156845147-156845169 AATACTAACACTTTGGGGTTAGG - Intergenic
1000110845 5:158106802-158106824 AATCCCAGCACTTTGGGATTTGG - Intergenic
1000361797 5:160454452-160454474 CATAATAGCTCTATGGGGGTGGG + Intergenic
1001714819 5:173806724-173806746 AATGTCAGCTCTATGGGGTCAGG + Intergenic
1002155134 5:177271892-177271914 AATCCCAGCACTATGGGGTCAGG + Intronic
1003251981 6:4436873-4436895 AATCCCTGAACTATGGGGTTTGG + Intergenic
1004129465 6:12905114-12905136 AAGCCAGGCTCCATGGGGTTGGG - Intronic
1004619081 6:17317577-17317599 AATCCCAGCACTCTGGGGTCAGG - Intergenic
1004724397 6:18297170-18297192 AATCCCAGCACTTTGGGTTTTGG + Intergenic
1004774557 6:18828816-18828838 AATCGTAGCTCTGTGATGTTGGG + Intergenic
1004843358 6:19612738-19612760 AGTTCTTGCTCTCTGGGGTTGGG - Intergenic
1005179376 6:23087069-23087091 AATCCTAACACTATGAGCTTTGG + Intergenic
1005278875 6:24249257-24249279 AATCATAGCTCTGTGGAGATGGG + Intronic
1005682399 6:28219477-28219499 AATCCTAGCACTTTGGGATGAGG + Intergenic
1006242559 6:32698064-32698086 AATCCTTCCTCTAGGGTGTTGGG - Intergenic
1008349743 6:50476098-50476120 AATCCTAGCACTTTGGGTTTTGG + Intergenic
1011129506 6:84038746-84038768 AATCCTAGCACTTTGGGATGTGG - Intronic
1013515985 6:110886374-110886396 AATCCTAGCACTTTGGGATTGGG - Intronic
1015535805 6:134266353-134266375 AATCCCAGCACTTTGGGTTTGGG + Intronic
1019633385 7:2062315-2062337 AATCCCAGCACTTTGGGATTGGG + Intronic
1020190010 7:5988323-5988345 AATCCTAGCCCTTTGAGGTCAGG + Intronic
1020292909 7:6736350-6736372 AATCCTAGCTCTTTGAGGTCAGG - Intergenic
1022345017 7:29506200-29506222 AATCCCAGCACTTTGGGGGTTGG + Intronic
1024864346 7:53887569-53887591 AATCCTAGCTCTTTGAAGGTTGG + Intergenic
1026612574 7:71873462-71873484 AATTCTAGCTCAATGGCTTTAGG - Intronic
1026862269 7:73798215-73798237 AATCCCAGCACTTTGGGTTTTGG - Intergenic
1027226441 7:76246883-76246905 TTTCCCAGCTCTATGAGGTTGGG + Intronic
1028894477 7:96025722-96025744 AGTTCTCACTCTATGGGGTTGGG + Intronic
1031482630 7:122297855-122297877 AATCCCAGCACTTTGGGATTTGG + Intergenic
1033324476 7:140366165-140366187 AATCCTAGCACTTTGGGAGTGGG - Intronic
1034555260 7:151846219-151846241 AATCCCAGCACTTTGGGGGTGGG + Intronic
1041007236 8:53507465-53507487 AATACAAGCTCTATGGGAGTAGG - Intergenic
1042427557 8:68665866-68665888 AATACTAGCTCCATGAGGTCAGG + Intronic
1044755256 8:95454907-95454929 ACTCCTAGCTCTCTGGGTTGTGG + Intergenic
1045191094 8:99884710-99884732 AAACGTAGCTGTATAGGGTTTGG - Intronic
1047436959 8:124842815-124842837 AATCACAGCTCTTTGGGGGTGGG + Intergenic
1047733359 8:127744910-127744932 AATCTGAGGTCTATGGGGGTGGG + Intergenic
1049144000 8:140984260-140984282 AATCCTGGCTCTATGATCTTGGG - Intronic
1050553708 9:6771182-6771204 AATCCTAGCACTTTGGGGGGAGG - Intronic
1053314810 9:37042190-37042212 AAACCAAGCTCTCTGGGGCTGGG - Intergenic
1055286397 9:74732938-74732960 AATCCCAGCTCTTTGGGGGGTGG + Intronic
1055305395 9:74924058-74924080 ATTCCCAGCTCCATGGGGGTGGG + Intergenic
1057863476 9:98661159-98661181 AATCCTAGCACTATGGGAGGCGG - Intronic
1058150864 9:101461975-101461997 AATGTAAGCTCTATGGGGTCAGG + Intergenic
1061252765 9:129436386-129436408 GATCCTCGCTCTGAGGGGTTTGG - Intergenic
1062519903 9:136953351-136953373 AATCCTAGCACTTTGGGGGCCGG + Intronic
1062519913 9:136953394-136953416 AATCCTAGCACTTTGGGGGCCGG + Intronic
1187934562 X:24322920-24322942 CATCCTGGCTCAATGTGGTTGGG + Intergenic
1189142206 X:38618795-38618817 AATCCTGGCTGTATGGGGTTGGG + Intronic
1190430844 X:50376496-50376518 AGTCTTAGTTCTATTGGGTTTGG + Intronic
1190989118 X:55527461-55527483 CTTGCTAGCTCAATGGGGTTTGG + Intergenic
1195483945 X:105381070-105381092 AATATGAGCTCTATGGGGGTAGG - Intronic
1196566448 X:117210435-117210457 GAGCCTTGGTCTATGGGGTTGGG - Intergenic
1199609057 X:149598427-149598449 AATGCTAGCTCTGTGGTGCTTGG + Intronic
1199630062 X:149770930-149770952 AATGCTAGCTCTGTGGTGCTTGG - Intergenic
1201850456 Y:18474121-18474143 AATCCAAGCTCTCTGGGAGTCGG + Intergenic
1201882862 Y:18846256-18846278 AATCCAAGCTCTCTGGGAGTCGG - Intergenic