ID: 945618982

View in Genome Browser
Species Human (GRCh38)
Location 2:212109473-212109495
Sequence AAGTAATAGCTGAAAGAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 397
Summary {0: 1, 1: 0, 2: 0, 3: 41, 4: 355}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945618982 Original CRISPR AAGTAATAGCTGAAAGAAGT GGG (reversed) Intronic
903582781 1:24384677-24384699 AAGTAAATGTTGACAGAAGTTGG + Intronic
903713336 1:25343274-25343296 AAAGAATAGCTGAGAGAAGCTGG - Intronic
904070596 1:27793576-27793598 AATGAATTGCTGAAAGAATTAGG + Exonic
905847698 1:41246505-41246527 AAGGAGCAGCTGAAAGGAGTTGG + Intergenic
905984436 1:42266071-42266093 AAGTAATGGCTAAATGCAGTTGG - Intronic
908901169 1:68958209-68958231 ATGTAAATGCTGAAAGAATTAGG + Intergenic
909162017 1:72164035-72164057 AAGTAAAAGCAGAAACAAGAAGG + Intronic
909368112 1:74852568-74852590 AATCAATAGCAGAAAGAACTTGG - Intergenic
910524566 1:88163368-88163390 AAGCAAAAGGTGAAAGAAGTGGG + Intergenic
911098085 1:94071950-94071972 AATTAATAGAAGAAAGAAATAGG + Intronic
911500140 1:98675568-98675590 ATGTAGTAGGTAAAAGAAGTAGG + Intronic
912359148 1:109080435-109080457 AAGAAAAAGGGGAAAGAAGTTGG + Intergenic
913396746 1:118379895-118379917 AATTAAATGCTCAAAGAAGTCGG - Intergenic
913594893 1:120365840-120365862 AAGCAACAGCTAACAGAAGTGGG + Intergenic
914092375 1:144513146-144513168 AAGCAACAGCTAACAGAAGTGGG - Intergenic
914306157 1:146420725-146420747 AAGCAACAGCTAACAGAAGTGGG + Intergenic
914595895 1:149152084-149152106 AAGCAACAGCTAACAGAAGTGGG - Intergenic
915170767 1:153975712-153975734 ATGGAATATCTGAAAGAAGAGGG - Intronic
916913405 1:169377723-169377745 CATTAATAACTGAAAAAAGTGGG - Intronic
917545624 1:175964153-175964175 AAGTATTAGCTGTAAGACTTTGG - Intronic
918188459 1:182148444-182148466 CAGTAATAGGAGAAGGAAGTAGG - Intergenic
918244397 1:182646307-182646329 GAGGAATAGCTGAAAGACTTGGG - Intronic
918574372 1:186038815-186038837 ATGTAATAACTGAAAGAAGAAGG - Exonic
918854716 1:189736510-189736532 AAATAATAAATGAAATAAGTAGG + Intergenic
919320801 1:196035033-196035055 AAGTACTAGAAGAAAGTAGTAGG - Intergenic
919355205 1:196513630-196513652 AAGTGAGAGCTGAAGGAAGAAGG - Intronic
920537712 1:206750285-206750307 ACGAAATAACAGAAAGAAGTAGG - Intergenic
921000958 1:211042222-211042244 AAGTAACAGAAGAAAGAAGTGGG - Intronic
921493509 1:215808007-215808029 AACTAAGAGGTGAAAGAAATGGG + Intronic
921655615 1:217732760-217732782 AATTAATATCTGAAAGCATTTGG + Intronic
921839949 1:219817767-219817789 AACTAAAAGCAGAAAAAAGTAGG - Intronic
921943293 1:220865949-220865971 AATTAATAACAGAAAGAAGTTGG - Intergenic
923655881 1:235916572-235916594 ATTTCATAGCTGAAAAAAGTTGG - Intergenic
1063733811 10:8729696-8729718 AAGTAGAAGCTGAGAGATGTAGG + Intergenic
1063811218 10:9710307-9710329 AAGTAAGAGCAGAAATAATTAGG - Intergenic
1063850820 10:10187930-10187952 AAATAATTGCTAAAAGAAATAGG - Intergenic
1063956377 10:11271313-11271335 AAGGAATGGCTGAGAGAACTGGG - Intronic
1064529058 10:16288601-16288623 AATTATTAGCAGTAAGAAGTTGG + Intergenic
1064587469 10:16852590-16852612 ACGGAGTTGCTGAAAGAAGTGGG + Intronic
1064945386 10:20782077-20782099 CAGAAATAGATGGAAGAAGTCGG + Exonic
1065831176 10:29615307-29615329 AAGAAACAGCTGGGAGAAGTAGG - Intronic
1066035836 10:31482743-31482765 ATGTATTACCTGAAAAAAGTTGG + Intronic
1067658264 10:48213698-48213720 TATTACTAGGTGAAAGAAGTAGG + Intronic
1069236425 10:66081285-66081307 AAGTAATTGCTCAAAAAAGAAGG + Intronic
1069672805 10:70223822-70223844 AAGTAAAAGCTGAAACCAGTTGG - Intronic
1070005213 10:72417740-72417762 AAGTAATAGTTTGAAGAACTGGG - Intronic
1070546058 10:77453592-77453614 AAGTCACAGCAGAAAGAAGGAGG + Intronic
1072241499 10:93499386-93499408 AAATAAAGCCTGAAAGAAGTAGG - Intronic
1072813085 10:98478747-98478769 AGGGAATAGCTGAAGGAAATGGG - Intronic
1073499686 10:103925150-103925172 AAATAATAGCACAAAGAAGGTGG - Intergenic
1073668428 10:105560076-105560098 AAGAAATAAATGAAAGAAGAAGG - Intergenic
1073710594 10:106033540-106033562 TAGTAATAGCTGAAAGGTGAGGG + Intergenic
1074041079 10:109789563-109789585 TGGTAATAGGTGAAAGAAGCAGG - Intergenic
1074395714 10:113096477-113096499 AAGTAAAAGGTGAAAGATGATGG - Intronic
1075824238 10:125340825-125340847 AAGCAATATTTGTAAGAAGTAGG + Intergenic
1078457844 11:11489279-11489301 AACTGATAGCTGAGAGATGTGGG + Intronic
1078691536 11:13584950-13584972 AATGGAAAGCTGAAAGAAGTAGG + Intergenic
1079031412 11:16988947-16988969 AAGCAACAGCTGAATGAACTGGG - Intronic
1079816871 11:25072111-25072133 AATTAGTAGGTGAAAGAACTGGG + Intronic
1080861809 11:36156462-36156484 TAGCATGAGCTGAAAGAAGTTGG + Intronic
1081138546 11:39469796-39469818 AATTAATATGTGAAACAAGTGGG + Intergenic
1086242534 11:84712782-84712804 AAGTTTTATCTGCAAGAAGTTGG - Intronic
1086283157 11:85214190-85214212 AAGTAGCAGCTGAAAGGAGAGGG - Intronic
1087351495 11:97039046-97039068 AACAAACAGCTGAAAGCAGTTGG + Intergenic
1087570349 11:99919432-99919454 ATGTAGTAGCTGAATGAAGAGGG - Intronic
1087648383 11:100834665-100834687 TAGTAGTAGCTTAAAGAAGTGGG + Intronic
1088039861 11:105366867-105366889 AAGTAGAAGCTGTAAGAAGAGGG - Intergenic
1088997280 11:115012220-115012242 GAGGAATAGTTGAAAGAACTGGG - Intergenic
1089527210 11:119105330-119105352 AAGTAATGGAAGAAAGAAGGAGG + Intronic
1089904092 11:122020162-122020184 AAGTAATCCCTGAAGGAACTGGG - Intergenic
1091089279 11:132754589-132754611 AAGAAACAGCCTAAAGAAGTAGG + Intronic
1091125507 11:133091993-133092015 ATGTGATAGCTGTAAGAGGTGGG + Intronic
1091426041 12:390157-390179 AAGTGAGAGCAGAAAGAATTAGG - Intronic
1092129987 12:6104086-6104108 AAATAATATCAGCAAGAAGTGGG + Intronic
1093585132 12:20826340-20826362 AAGAGAAAGCTGAAAGCAGTGGG + Intronic
1094287522 12:28812111-28812133 AAGGACTAGCAGAAAGAATTTGG - Intergenic
1096368724 12:51050715-51050737 AAGAAATAGATGCAAGAAGCCGG + Intronic
1096732170 12:53622664-53622686 AAAAAATAGCTTAAAGAACTTGG + Intronic
1097494367 12:60312165-60312187 AAGTAAAAGCTGTAAGAAAAGGG + Intergenic
1097855590 12:64458331-64458353 AAGTAATAAATGTAAGAATTTGG - Intronic
1098232426 12:68386042-68386064 AGGGGAAAGCTGAAAGAAGTAGG - Intergenic
1098693450 12:73520315-73520337 AAGTTATAGCTTAAAAAAGCAGG - Intergenic
1099275254 12:80567103-80567125 AAACAATAGTTGAAAGTAGTTGG + Intronic
1100161618 12:91867223-91867245 AAATAATGGATGAATGAAGTGGG - Intergenic
1100199077 12:92279217-92279239 AAGGAATTGCTGAAGAAAGTGGG - Intergenic
1100864331 12:98840330-98840352 AAGTAATAGCAGAAGGAAAAGGG - Intronic
1100958547 12:99936754-99936776 AAGTAATGGCTGAAAATAGCGGG - Intronic
1101285974 12:103312985-103313007 AAGGGATAGCTACAAGAAGTGGG - Intronic
1102649868 12:114432742-114432764 AAGAAACAGATGAAAGAACTGGG - Intergenic
1102936282 12:116899707-116899729 AAGTGAAAGCTGAAAGAGGTTGG + Intergenic
1105665142 13:22546866-22546888 TAGTAATAGATGTAAAAAGTAGG - Intergenic
1106202294 13:27549544-27549566 ATGAAATAGCTGAAAGTGGTTGG - Intronic
1108179056 13:47822867-47822889 CAGCAATAGCTGACAGAAGTTGG + Intergenic
1108315503 13:49233147-49233169 ATGTAATAACTGAAGGAAATGGG + Intergenic
1109039132 13:57309079-57309101 AAGAAAAAGGAGAAAGAAGTGGG - Intergenic
1109072373 13:57786568-57786590 AAGAATGAGCTGACAGAAGTAGG - Intergenic
1110799296 13:79676255-79676277 AAGAAATACCTGAAAGGAGCAGG - Intergenic
1111171911 13:84538276-84538298 AAGTAATATCAGAAAGGATTTGG + Intergenic
1111306652 13:86421855-86421877 AAGTAATAGCTTATGGAGGTAGG - Intergenic
1111552122 13:89827024-89827046 AAGAAACAGCAGGAAGAAGTGGG - Intergenic
1111868856 13:93804818-93804840 ATGTAATAGCTGCATGACGTTGG + Intronic
1112145348 13:96693643-96693665 AATAAATAGCTGAAACAATTTGG - Intronic
1112625320 13:101097319-101097341 TAGTTTTAGCTGAAAAAAGTGGG - Intronic
1112803302 13:103135720-103135742 ATTTAATAGATGAAAGAATTGGG + Intergenic
1112894809 13:104285959-104285981 AAGCAGGAGCTGAAAGAAGTTGG + Intergenic
1113284471 13:108831141-108831163 AAGTGATAGCATTAAGAAGTAGG - Intronic
1113594185 13:111519723-111519745 GAGTAGTGGCTTAAAGAAGTGGG + Intergenic
1114937582 14:27561966-27561988 GAGTAAGAGCTGCAAGAAGATGG - Intergenic
1115471454 14:33772696-33772718 GAGAAATAGCTAAAAGAAATGGG - Intronic
1116377410 14:44221191-44221213 AAATAATAGTAGAAAGAAGAAGG + Intergenic
1116847433 14:49878242-49878264 AAAAAATAGCTAAAAGAAGTTGG - Intergenic
1117199015 14:53369728-53369750 AAGTAATAGGTGGAAGTAGAAGG + Intergenic
1117348939 14:54861791-54861813 AAGTAATAGCAGAAAGTAACAGG + Intronic
1117479111 14:56125533-56125555 AAGTAAAAACCGAAAGAAGTGGG - Intronic
1117610073 14:57473997-57474019 AAGAAGTAGCTGGATGAAGTGGG - Intronic
1117743298 14:58841557-58841579 AAATCACAGCTGAAAGAATTAGG - Intergenic
1118039754 14:61903980-61904002 CAGTAATTCCTGAGAGAAGTTGG + Intergenic
1119202401 14:72766315-72766337 AAGAAATAACTGAAAGATGAAGG + Intronic
1119828818 14:77682605-77682627 TAGTAAAAGATGAAAGAAGTTGG + Intronic
1120772864 14:88400159-88400181 AATTAATAGCTGTAAGAAAATGG + Intronic
1122452221 14:101818739-101818761 AAATAATATTTGAAATAAGTGGG + Intronic
1122676185 14:103415865-103415887 AAGAAAGAGCTTAAAAAAGTTGG - Intronic
1124057910 15:26259830-26259852 CAGTCATAGCTGAAAGCAATTGG + Intergenic
1126361802 15:47854248-47854270 AACTAATGACTCAAAGAAGTGGG + Intergenic
1126538447 15:49794906-49794928 GAGCAAGAGCTGAGAGAAGTAGG + Intergenic
1130769426 15:86909753-86909775 ATGTAATTGCTGAGAGAGGTGGG + Intronic
1132917483 16:2359645-2359667 AGGAAATATCTGAAAGTAGTAGG + Intergenic
1133389343 16:5396649-5396671 AAGAAAAAGATGAAAGAAGGAGG + Intergenic
1133667314 16:7981552-7981574 AGGTAAGACCTGAAAGCAGTAGG - Intergenic
1135246961 16:20865207-20865229 AAGAAAAAACTGAAAAAAGTGGG + Intronic
1137533313 16:49298170-49298192 AAGTCCCAGCTGGAAGAAGTAGG - Intergenic
1137713878 16:50585763-50585785 TAGTAATAACTGATAGCAGTGGG + Intronic
1140100854 16:71915300-71915322 AAGGCACAGCTGAAAGAATTTGG - Intronic
1140104696 16:71949064-71949086 AAATAATAGATGAAACAAATTGG + Intronic
1140568546 16:76073864-76073886 AAGTTATAGCTGACAGATCTTGG - Intergenic
1141471529 16:84241821-84241843 AAGAAACAGCTGAGAGAGGTGGG - Intergenic
1143707644 17:8710156-8710178 ATGTAACAGCTGGAAGAAGTAGG - Intergenic
1146364668 17:32212842-32212864 AAGAAAAGGCTGAAAGAAATGGG - Intronic
1147367245 17:39967034-39967056 AAGTAGTGGTTGAAAGAAGGAGG + Intronic
1147367399 17:39968151-39968173 AAGTAGTGGTTGAAAGAAGGAGG + Intronic
1148317883 17:46720206-46720228 ATATATTAGCTGAGAGAAGTGGG + Intronic
1149619637 17:58033767-58033789 AAGTAATAGTATTAAGAAGTAGG + Intergenic
1150515474 17:65805384-65805406 AAGTAACAACTGAAAGAAAAGGG + Intronic
1155068530 18:22290825-22290847 AGGTAATTGCTGAAATAATTGGG + Intergenic
1156222493 18:35066623-35066645 AAGCAGGAGCTGAAAGAATTGGG + Intronic
1159414140 18:68122358-68122380 AAGTAATATCAGAAAGCCGTGGG - Intergenic
1159492503 18:69155860-69155882 AAGTAATTGCAGTAAGAGGTGGG - Intergenic
1162258268 19:9510829-9510851 GAGTAATAGCTCAAAGCTGTAGG + Intergenic
1163333801 19:16658926-16658948 AAGAAATAGATGACAGAGGTAGG + Intronic
1163491172 19:17617933-17617955 AAGTAGTAGCGGGAAGAATTGGG - Intronic
1164535601 19:29084558-29084580 AAGAAGTAGCTGAAAGAGGAAGG + Intergenic
1164944528 19:32282331-32282353 AAGAAAAAGCTGAAAGATGCTGG - Intergenic
1165562513 19:36692322-36692344 TAGTGATATCTGAAAGAAGTTGG + Intronic
925440441 2:3880771-3880793 ATGCAATAGCAGTAAGAAGTGGG + Intergenic
925502725 2:4523590-4523612 AAATAAAAGCTGAGAGAATTCGG + Intergenic
925603586 2:5635186-5635208 AAGCAACAGCTAACAGAAGTGGG + Intergenic
925694713 2:6564106-6564128 AATTAATTGCTGAAAGCAGAAGG - Intergenic
925722394 2:6841756-6841778 ATGAAATAGCTGAAGGAAATAGG - Intronic
926668889 2:15556116-15556138 GAGTAAAAGCAGAAAGACGTTGG + Intronic
926795468 2:16615759-16615781 CAGTAATAGCTGCAATAGGTAGG - Intronic
926882947 2:17568653-17568675 AAGAAATAGATGAAAAAAGTTGG - Intronic
929260519 2:39861954-39861976 AAGTAATTATTGAAAGAAGTAGG + Intergenic
930915992 2:56688874-56688896 AAGTATAAGCTGAAAGGAGGAGG + Intergenic
930961700 2:57270061-57270083 AAGTCTTAGCTGAAACAATTAGG + Intergenic
931126065 2:59277877-59277899 AAGTAATAGATGAACTAACTAGG + Intergenic
931150069 2:59563118-59563140 AAGAAAAAGGTGAAAGAGGTAGG + Intergenic
932095259 2:68841803-68841825 GAGTAAAATCTTAAAGAAGTGGG + Intergenic
932319776 2:70813095-70813117 AAGAAAGAGCTGACAGAATTGGG - Intronic
933279584 2:80318237-80318259 AAGTAACATCTCAAAGAAGGAGG - Intronic
933671143 2:85008613-85008635 AAATGAGAGCTGAAAGAAGGAGG + Intronic
934932495 2:98438633-98438655 CAATAATAGCACAAAGAAGTGGG - Intergenic
934945137 2:98535332-98535354 AAGGAATAACTCAAAGTAGTAGG + Intronic
935049496 2:99512409-99512431 AAGTAATAGCAGAAATAAATTGG - Intergenic
936266386 2:111012062-111012084 CAGTAATTGATGAAATAAGTAGG + Intronic
936524323 2:113232627-113232649 AATTAACAGCTGACAGTAGTTGG + Intronic
937753933 2:125513445-125513467 AAGTAATAGCAGAATGCAGTTGG + Intergenic
938027179 2:127959884-127959906 ATGTAATAACTGAAATAAGACGG + Intronic
938368386 2:130753934-130753956 AAGAAACAGCTCAAAGCAGTAGG + Intergenic
939106896 2:137959626-137959648 GAGTAAAATCTGAAAGAAGTTGG + Intergenic
939237196 2:139510811-139510833 ATGTAGTAGCTTAAAGATGTTGG + Intergenic
939463624 2:142529415-142529437 AATTAATATATGAAAGAAGGTGG + Intergenic
939511035 2:143104960-143104982 AAGTAGTTGCTGAATGAATTAGG + Intronic
941739457 2:169017858-169017880 ACGTAATATCTGAAAGCACTAGG - Intronic
942079573 2:172387238-172387260 AAGTAACAGCAGAAAGAAATGGG + Intergenic
942670706 2:178373681-178373703 AAGGAATAGTTGAAAGGTGTTGG - Intronic
942872626 2:180753672-180753694 AAGTCAAAGATGAAAGGAGTTGG + Intergenic
943275396 2:185861005-185861027 AGGTAATAGGGGAAAGAAATAGG - Intergenic
943377817 2:187101944-187101966 AGGTAATAATTGAAAGAACTAGG + Intergenic
943559633 2:189445220-189445242 ATGTATTAGCTGAATGATGTTGG - Intronic
943852240 2:192738746-192738768 CACTAATAGTTGAAAGAATTGGG - Intergenic
943940262 2:193984983-193985005 AAGCAATATATGGAAGAAGTTGG + Intergenic
945455311 2:210045645-210045667 AAGTAAAAACTGAGAGAATTCGG - Intronic
945618982 2:212109473-212109495 AAGTAATAGCTGAAAGAAGTGGG - Intronic
948339971 2:237241928-237241950 TACTAATATTTGAAAGAAGTTGG + Intergenic
1169290374 20:4344517-4344539 AAGTAATATTTGAAGAAAGTAGG + Intergenic
1170310749 20:14989155-14989177 AAGTAATATATGAAATAATTGGG - Intronic
1171162931 20:22944901-22944923 AAGGAAGAGATGAAAGAAATTGG + Intergenic
1171339622 20:24417148-24417170 AAGTCCTAGCTGTAAGAATTTGG - Intergenic
1172726192 20:37043874-37043896 AAGTGATAGCTAAAGGATGTAGG + Intronic
1173713407 20:45180050-45180072 AACTACTCTCTGAAAGAAGTTGG + Intergenic
1173874526 20:46361897-46361919 AAGCAGGAGCTGCAAGAAGTTGG - Intronic
1174056057 20:47799342-47799364 AAGTAATAACTCATAGGAGTTGG - Intergenic
1174706862 20:52665281-52665303 AAATAAAAGTGGAAAGAAGTTGG + Intergenic
1175368910 20:58473644-58473666 AAATAACAGCTGAAAGCAGATGG + Intronic
1175640060 20:60621318-60621340 CATTAACAGCTGAAAGTAGTTGG - Intergenic
1179283401 21:39954128-39954150 TACTAAAAGCTGAAAGAGGTTGG - Intergenic
1180578761 22:16809041-16809063 AAGTAGTAGTTAAAAAAAGTGGG + Intronic
1181633060 22:24161524-24161546 AAGTAGCAGCTGAGAGAAGCAGG - Intronic
1185093900 22:48795323-48795345 AAGTAAGAACTGGAGGAAGTAGG - Intronic
949472584 3:4412500-4412522 GAGTAATAGCTGGGAGAGGTAGG + Intronic
950334332 3:12181717-12181739 AAGAAAAAGATGAAAGAATTAGG + Intronic
951208806 3:19951912-19951934 AAGAAAAAGATGAAAGAAGAAGG + Intronic
952466106 3:33587697-33587719 AGGTTATAACTGAAAGAAATTGG - Intronic
953023927 3:39134109-39134131 AAGGCAGAGCTGATAGAAGTGGG + Intronic
953976169 3:47383099-47383121 CAATAAATGCTGAAAGAAGTGGG - Intronic
955757022 3:62235366-62235388 AAGTAATAGCTGGAAGTCTTGGG + Intronic
955937821 3:64119369-64119391 AAATAAAAGTTGAAAGAAATGGG + Intronic
957604916 3:82385869-82385891 TAATAATAGGTGAAAGAAGGAGG + Intergenic
957905335 3:86546107-86546129 AATTAGCAGCTGAAAGAGGTGGG - Intergenic
958533667 3:95367360-95367382 AAGTAATACATGACAGAAGTGGG - Intergenic
958988598 3:100813727-100813749 CAGTCAGAGCTGAAAGAAGAGGG + Intronic
959369276 3:105503687-105503709 AAATAATAGCTTAAACAATTTGG - Intronic
960058126 3:113290760-113290782 AAGTAAAACCTGAAAGAAAATGG + Exonic
960718208 3:120598664-120598686 AATAAAGATCTGAAAGAAGTGGG + Intronic
960873149 3:122271064-122271086 TCGTATTAGCTGAAAGAAGTAGG - Intronic
961429380 3:126870445-126870467 AAGGAATACCTGAAAGAACTGGG - Intronic
963554217 3:146766650-146766672 AAGTAAAAACTGAAAGGAGAAGG + Intergenic
964348532 3:155779716-155779738 AAGAAAGAGTTAAAAGAAGTAGG + Intronic
965859615 3:173132839-173132861 AAGTAATTGCTGATAGATTTTGG - Intronic
966037076 3:175431998-175432020 AAGTAATAGCTGCATGAATTAGG - Intronic
967395974 3:189009373-189009395 AAATAATACCTAAGAGAAGTGGG + Intronic
967668943 3:192209200-192209222 TGGCAATAGCTGGAAGAAGTAGG - Intronic
967773639 3:193361647-193361669 AAATAATAGCTGAAGAAAGCAGG + Intronic
967898244 3:194418116-194418138 AAGCAATTGCTGAAACAAATGGG + Intronic
968637076 4:1685979-1686001 AAGTAATGGCTGAGAGGGGTGGG - Intergenic
969283440 4:6187128-6187150 AAGCAAAAACTGACAGAAGTGGG - Intronic
969638510 4:8383049-8383071 ATGTAACAGCCGAAAGCAGTCGG - Intronic
970786397 4:19802168-19802190 AAATCATACCTGAAAGAATTTGG + Intergenic
971259494 4:25043402-25043424 AGGTAGAAGCTGAAAGAAGATGG + Intergenic
971823180 4:31586232-31586254 AAGCAGTAGCTGAAATAAGGAGG + Intergenic
972293684 4:37716032-37716054 AAGGAACAGCTGCAAAAAGTTGG + Intergenic
973130666 4:46644343-46644365 AAGTCATAGGAGAAAGAAGGAGG + Intergenic
973170932 4:47142715-47142737 AAGTAATAAATGAAGGAAATTGG + Intronic
974802511 4:66836451-66836473 ATGTAATTGATGAAAGAACTAGG - Intergenic
975122268 4:70741693-70741715 GAGAAAAAGCTGAAAGATGTTGG - Intronic
975137194 4:70886568-70886590 TTGTAATAGATGATAGAAGTAGG + Intergenic
975275559 4:72495665-72495687 AAAAAATAACTGAAAGAGGTAGG - Intronic
975764367 4:77651687-77651709 AAGAAAGAGCTTAAAGATGTGGG + Intergenic
976385733 4:84455819-84455841 AAGGAATTGGTGAAAGAAGTTGG - Intergenic
976887411 4:90002654-90002676 AAGCAATAGCTGGATGAAGGCGG + Intergenic
977861827 4:101970446-101970468 AAGAAATTGATGAAAGAAATTGG - Intronic
978269147 4:106868002-106868024 GAGGAATAGCTGAGAGGAGTAGG + Intergenic
978718799 4:111879534-111879556 CAGGAATAGCTGACACAAGTTGG - Intergenic
979380442 4:119999668-119999690 AAGTAATAGCATAGAAAAGTGGG + Intergenic
980693303 4:136323675-136323697 AAATAATAGATAACAGAAGTTGG + Intergenic
981267062 4:142798467-142798489 AAGTTATAGCTCACAGATGTTGG + Intronic
981631317 4:146822028-146822050 TAGAAATAGCTAAAAGAATTTGG - Intronic
981640070 4:146931975-146931997 AAGAAAAAGCAGAAAGAAGAAGG - Intronic
982229949 4:153199364-153199386 AAATATATGCTGAAAGAAGTAGG + Intronic
982330218 4:154173366-154173388 AAGCAAAAGTTGAAAGAACTAGG - Intergenic
983402491 4:167282554-167282576 AAGGAAAAACTGAAAGAAGGAGG + Intergenic
984517843 4:180763252-180763274 AAATAAAAGATAAAAGAAGTAGG + Intergenic
985059499 4:186062514-186062536 AAGTAAAAGTGGAAAGAACTGGG - Intergenic
985329137 4:188808027-188808049 AATCGATGGCTGAAAGAAGTGGG + Intergenic
985387173 4:189460570-189460592 AAGAAATGAATGAAAGAAGTAGG + Intergenic
986412670 5:7496491-7496513 ATATAATAGCTGAATGAATTCGG + Intronic
987802272 5:22714416-22714438 CAGTAATCGCTGAAAGAGGCTGG - Intronic
988246748 5:28694202-28694224 AAGAAGTAGCTGAAAGAATATGG + Intergenic
988284472 5:29193454-29193476 AATTAATAGTTGATAAAAGTAGG + Intergenic
988965851 5:36417040-36417062 AAGGAATGGCTGAAAGACTTTGG + Intergenic
988977304 5:36527989-36528011 AAGGAGTAGCTGAAATAAATAGG + Intergenic
989213961 5:38884632-38884654 CAGTAATAGCTGCATGCAGTAGG + Intronic
989306259 5:39960126-39960148 AAGTGGAAGCTGGAAGAAGTGGG + Intergenic
990636780 5:57736844-57736866 AATTCATAGCTGAAAGCAGTTGG - Intergenic
992398411 5:76388685-76388707 ATGAAATAGCTGAATGAAGAAGG - Intergenic
992466628 5:77012503-77012525 AAGAAATAGGTGAAAGAATTTGG + Intergenic
992578490 5:78145793-78145815 AAAGAAGAGGTGAAAGAAGTGGG - Intronic
993274561 5:85840059-85840081 AAGTAATAGCTAAAATTAGAAGG - Intergenic
993423508 5:87732785-87732807 AAGCAATAGATTAAAGGAGTTGG + Intergenic
993523379 5:88933776-88933798 AAGAAATGTCTGAAAGAATTTGG - Intergenic
993966026 5:94361880-94361902 AAGAATTACCTGAAAGCAGTAGG - Intronic
994408741 5:99379478-99379500 TATTAAAAGGTGAAAGAAGTTGG - Intergenic
995095150 5:108227157-108227179 AACTCAGAGCTGAAAGGAGTGGG + Intronic
995981943 5:118114622-118114644 AAGCATTAGCTGAAAGAAGGAGG - Intergenic
996287781 5:121815169-121815191 AAGTAAAGGCTAACAGAAGTTGG + Intergenic
996467620 5:123821828-123821850 AAGAAATAGCTCAAAGGGGTGGG - Intergenic
999265737 5:150265643-150265665 AAGAAATAACTGAATGAAGCTGG + Intronic
999815822 5:155174967-155174989 AATTAAGAGGTGAAAGAAATAGG - Intergenic
1000042109 5:157492393-157492415 AAGTAATAGCAGAATTTAGTTGG - Intronic
1000678694 5:164156588-164156610 AAAAAAGAGCTGAAAAAAGTGGG + Intergenic
1000977498 5:167781437-167781459 AAATAATATGTGAAGGAAGTAGG + Intronic
1003036462 6:2644601-2644623 AAGTAATCGCAGGAAGCAGTGGG + Intergenic
1003258841 6:4497750-4497772 AAATAACAGCTGAATGAAGTGGG + Intergenic
1004051483 6:12084845-12084867 AAGGATGAGCTGATAGAAGTAGG + Intronic
1004538861 6:16529639-16529661 AGGTAATAAATGAAAAAAGTTGG - Intronic
1005329687 6:24737597-24737619 AAGACATAGCTGACAGAAGTTGG + Intergenic
1005396937 6:25392514-25392536 AAGGAAAAGCTGAAGGAAGTAGG - Intronic
1005887852 6:30110733-30110755 AATTAATGGCTGAATAAAGTGGG - Intronic
1007872078 6:45051913-45051935 AATTAATGGCTGAAATAAATTGG + Intronic
1009338844 6:62528377-62528399 AATTAATAAAAGAAAGAAGTTGG + Intergenic
1010088968 6:71956622-71956644 AAGAAATAGCTGTATGAAGTCGG - Intronic
1010232031 6:73543207-73543229 AAGTAATAGCTGGACGTGGTGGG + Intergenic
1010377450 6:75187827-75187849 AAGTAATAACTAATAGAAATGGG + Intronic
1011044469 6:83066459-83066481 AAGTAAAAACTAAGAGAAGTTGG + Intergenic
1011758386 6:90529494-90529516 AAGTAGTAGCAGTAAGAAGTTGG + Intronic
1012135678 6:95552855-95552877 AAATAATAAGTGAAAGAAGTGGG - Intergenic
1012197539 6:96362598-96362620 AAGTGATAACTGAAAGAAAGTGG + Intergenic
1012320755 6:97842351-97842373 AGTTAATTGCAGAAAGAAGTAGG - Intergenic
1012335899 6:98057143-98057165 AAGCAAGAGCTGAAAGCTGTAGG + Intergenic
1013029300 6:106316027-106316049 AAGAAAAAGCTGTAAGAACTTGG - Intronic
1013164514 6:107577766-107577788 AAGAATTAGATTAAAGAAGTTGG + Intronic
1014149379 6:118036034-118036056 AAGTAACAGCAGAAATAAATGGG - Intronic
1014197638 6:118577678-118577700 AAATATTAGCTGAAAAAGGTGGG + Intronic
1015377053 6:132522905-132522927 TAGTAATTGATGAAATAAGTAGG - Intergenic
1017912500 6:158806060-158806082 AAGTAATAGTGGAAAAAACTGGG + Intronic
1018239870 6:161763263-161763285 AAGCAAAGGCTGAAAGAAGCAGG + Intronic
1020494665 7:8834375-8834397 AAGGAATAGTTGAATGAAGAGGG + Intergenic
1020610899 7:10396610-10396632 CAGTAATCGCTGAGAGAAGGTGG - Intergenic
1022827038 7:34025526-34025548 AAGTTCTAGCTGCAAGAAGGAGG + Intronic
1024033130 7:45482051-45482073 AAACAATAGCTGTAATAAGTAGG - Intergenic
1024171443 7:46791569-46791591 AAGAAAGAGATGAAAAAAGTGGG - Intergenic
1024244775 7:47460856-47460878 GAGGAAGAGCTGAAAGTAGTTGG - Intronic
1027602859 7:80260643-80260665 AAGGAAGAGCTGAGAAAAGTAGG - Intergenic
1027878804 7:83805050-83805072 AAGCAATAGATTAAAGAAGAAGG - Intergenic
1029027026 7:97427697-97427719 ATGCAGTAGATGAAAGAAGTAGG + Intergenic
1029534884 7:101151341-101151363 AAGTAAAAGAAGAAAGAAGTTGG + Intergenic
1030407011 7:109127934-109127956 AAACAGTAGCTGAAAGAAATAGG + Intergenic
1030511169 7:110483731-110483753 GAGTGATAGATGAAAGAAGAGGG - Intergenic
1030695165 7:112577274-112577296 AAGTAAGAGTTGAATGAAATAGG + Intergenic
1030938904 7:115620348-115620370 AAGTAATTGCTGTAAGAAAAAGG + Intergenic
1031146673 7:118004375-118004397 AAGTCATATCTGAATGAAGCAGG - Intergenic
1031555734 7:123173892-123173914 GAGTAAGAGTTGAAAGAGGTGGG - Intronic
1032282656 7:130517036-130517058 AGGTGACAGCTGAAAGAAGGAGG + Intronic
1033296889 7:140146944-140146966 CAGTAAGATCTGAAAGAATTTGG - Intronic
1034504191 7:151473000-151473022 GAGAAACAGCTGAAAGAACTAGG + Intronic
1034626230 7:152494888-152494910 AAGAACTACCTGAAAGAAGCAGG + Intergenic
1035032208 7:155868846-155868868 AAGTGATAACTGATGGAAGTAGG + Intergenic
1037270431 8:17123746-17123768 AAATAATAACTGAAAAAAGTAGG + Intergenic
1038077097 8:24088620-24088642 GACTAATAGATGAAAGATGTTGG + Intergenic
1038297877 8:26312990-26313012 AAGAAATAGCTAAAAGAGTTTGG - Intronic
1038592310 8:28851060-28851082 AAGTAAAAGCTTAATGAAGAAGG + Intronic
1039717269 8:40123385-40123407 AAGGAAGAGATGAAAGAAGGAGG + Intergenic
1039859637 8:41445922-41445944 GAGTAAGAGCTGAAACAAGAAGG - Intergenic
1041331784 8:56734577-56734599 AAGGAACAGGTGAAAGAACTGGG + Intergenic
1041797948 8:61766235-61766257 AAGTAATATAGGAAGGAAGTAGG + Intergenic
1042432092 8:68718723-68718745 AAATAATGGCTGAAAAAAGTTGG + Intronic
1042935156 8:74051061-74051083 TAGTAATAGAGGAAAGAAGATGG + Intergenic
1043641798 8:82461282-82461304 AAGTAATATTTGAAATCAGTAGG - Intergenic
1043663880 8:82783655-82783677 AAGTAATAGTTGAATGATTTAGG + Intergenic
1045226306 8:100249482-100249504 AAGTAGTAAGTGAAAGAAGTGGG + Intronic
1045823252 8:106366903-106366925 ATGTAATACATGAAAGAAGATGG - Intronic
1045870370 8:106919981-106920003 AAGAGATAGATGTAAGAAGTTGG + Intergenic
1046283556 8:112066287-112066309 AAGAAATAGCTGAAAGAGGCAGG - Intergenic
1046291322 8:112165869-112165891 AAGAAATAAATAAAAGAAGTGGG - Intergenic
1047852854 8:128877762-128877784 AATTAATAGCTGGAGGAATTTGG + Intergenic
1048349237 8:133602611-133602633 CAGTGATAGCAGAAAGAAGAGGG + Intergenic
1048425343 8:134318397-134318419 AAGCAAAAGCTGAGAGATGTTGG - Intergenic
1050040843 9:1491698-1491720 AGGTAATATATGAAGGAAGTAGG + Intergenic
1050335479 9:4585833-4585855 AAGTAATAACTGTTAGAATTAGG + Exonic
1051216170 9:14800147-14800169 AACAAATAACTAAAAGAAGTTGG + Intronic
1051467641 9:17398600-17398622 AAGAACTAGCTGAAATCAGTTGG - Intronic
1051533253 9:18128835-18128857 AAACAATAGCAGAAAGAAGGTGG + Intergenic
1052103375 9:24479565-24479587 AAGACATGGCTGAAAAAAGTTGG - Intergenic
1052518774 9:29515590-29515612 AAGTAATAGCTTAAAAATGGAGG + Intergenic
1052627384 9:30994129-30994151 AAGATATAGGTGAAAGAAATTGG + Intergenic
1052968249 9:34359101-34359123 AATTAATAACAGAAGGAAGTTGG - Intergenic
1053434196 9:38064761-38064783 AAGTAAATGCTGGAAAAAGTGGG + Intronic
1054778494 9:69144506-69144528 AAAAAATAGCTTGAAGAAGTTGG + Intronic
1055253255 9:74334309-74334331 AAGTAATAGATGTCAGAAGGAGG + Intergenic
1057311054 9:93943499-93943521 AGCTTATAGCTGAAAGAACTGGG + Intergenic
1058401930 9:104629651-104629673 AAGTAAGAGGTCATAGAAGTTGG - Intergenic
1058413459 9:104760860-104760882 AAGTATTAGCTGAAGGATGGTGG - Intergenic
1060166787 9:121423966-121423988 ATGTTTTAGCTGCAAGAAGTGGG - Intergenic
1186877993 X:13835855-13835877 ATGTAAAAGTTGAATGAAGTTGG - Intronic
1188021613 X:25164701-25164723 AGATAATAGATAAAAGAAGTAGG - Intergenic
1188046412 X:25430253-25430275 AACAACTAGCTGAATGAAGTTGG + Intergenic
1188057939 X:25563370-25563392 AAGAAATAGCAGAAGAAAGTGGG + Intergenic
1188553675 X:31387804-31387826 AGGAAAGACCTGAAAGAAGTGGG - Intronic
1188913418 X:35879380-35879402 AAGTAACAGCAGGAAAAAGTTGG - Intergenic
1189420464 X:40852735-40852757 AAGTAGAAGCTGAAAGAGGAAGG + Intergenic
1189814903 X:44814818-44814840 ATGTGATGGCTGTAAGAAGTTGG - Intergenic
1190473725 X:50808094-50808116 AAGGAACAGCTGAAAGAGCTAGG + Intronic
1190780890 X:53593704-53593726 ACGTAATAGCTCTAAGAAGAGGG - Intronic
1190875544 X:54457755-54457777 CAGAAAAAGATGAAAGAAGTAGG - Intronic
1192247494 X:69385961-69385983 GAGAAATAGTTGGAAGAAGTGGG - Intergenic
1192284787 X:69723836-69723858 AAATAATAGGTGAAAGAAAGCGG - Intronic
1192815974 X:74592628-74592650 GAGCAAGAGCTGAAAGAAGTAGG - Exonic
1195974545 X:110512024-110512046 AGGTTATAGCTTAAACAAGTTGG + Intergenic
1196646037 X:118117808-118117830 AAGGAATAGGTGTAAGAAGGTGG - Intergenic
1198242483 X:134799316-134799338 AAGAAAAAGCTGAAAGCAGCAGG + Intronic
1198693462 X:139308849-139308871 AAGAAATAGCTGAGAGACATGGG - Intergenic
1199072543 X:143495819-143495841 AAGTTATAGCTGAAAGAATCAGG - Intergenic
1199269402 X:145865105-145865127 AATTAATAGCAGGAAGAGGTAGG - Intergenic
1199792163 X:151165585-151165607 AAGTACTAGCTGAAGCAATTTGG + Intergenic
1201426884 Y:13860916-13860938 AAGTGAGAGCTAAAAGAAGATGG - Intergenic
1202329144 Y:23727849-23727871 AAGTAGTAGTTTAAAAAAGTGGG + Intergenic
1202541627 Y:25942205-25942227 AAGTAGTAGTTTAAAAAAGTGGG - Intergenic