ID: 945619670

View in Genome Browser
Species Human (GRCh38)
Location 2:212119109-212119131
Sequence TTTATTTAACAGTTGATGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 336
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 309}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945619670 Original CRISPR TTTATTTAACAGTTGATGCA TGG (reversed) Intronic
904839211 1:33360833-33360855 TTCATTTGACAGGTGAGGCATGG + Intronic
905756494 1:40514494-40514516 TTTCTTTAACATGTTATGCAGGG + Exonic
906350318 1:45053198-45053220 TTTATTTTACAGTTTAAGAAGGG + Intronic
907032923 1:51190243-51190265 GATATTTAACATTTGAAGCATGG + Intergenic
907636090 1:56135871-56135893 GTCATTTAAGAGGTGATGCAAGG + Intergenic
908080487 1:60572574-60572596 TTTATTTAAAAGATCAGGCATGG + Intergenic
908119567 1:60973132-60973154 CTTATCTAATAGTTTATGCACGG - Intronic
909042260 1:70668664-70668686 TATAGTTAACAGTTGCTTCAGGG - Intergenic
910465856 1:87498962-87498984 TATATTAACCAGTTGAAGCATGG + Intergenic
911247491 1:95535020-95535042 TTTATTTAGGAGTTGATCCCAGG + Intergenic
911281115 1:95930242-95930264 GTTAATTAAAAGCTGATGCATGG - Intergenic
911690491 1:100828216-100828238 TTCTTTTAACATTTCATGCAAGG + Intergenic
911849757 1:102803239-102803261 TTTATTTAAAATTTGAGGCAAGG + Intergenic
912011453 1:104969270-104969292 TTTTTTTAACATTTCTTGCAGGG + Intergenic
912344601 1:108952899-108952921 ATTATTTGACTGTTTATGCAGGG - Intronic
913367435 1:118056094-118056116 TGTCTTTAACTGTTGATGAAGGG - Intronic
915012454 1:152699986-152700008 TTTATTTAACAGTTGTTTCGTGG - Intergenic
915019054 1:152762526-152762548 TTTATTCATCAGTGGATGGATGG + Intronic
915172880 1:153990359-153990381 TTAATTTAACAGTTTAGGCCGGG - Intergenic
915382980 1:155460306-155460328 TTTATTAAAAAGTTGATGTGAGG + Intronic
915652640 1:157328885-157328907 TGTCTTGAACAGTTGATGTAAGG + Intergenic
916468696 1:165099726-165099748 TTTATTTAATAAATGATGCTGGG + Intergenic
918958797 1:191243625-191243647 TTTATTTAAAGCTTGATGCCAGG + Intergenic
919183308 1:194113717-194113739 TTTAATTAACACTATATGCATGG - Intergenic
919247458 1:195006491-195006513 TTTGTATAACAGTTGAGTCATGG - Intergenic
919356095 1:196523685-196523707 TTAATTTAAAGGTAGATGCATGG - Intronic
919395492 1:197042339-197042361 TAAATTTAAAAGTTGATTCATGG + Intronic
920045957 1:203132529-203132551 TTCATTTAACAGATGGTGAAGGG - Intronic
1062930740 10:1350907-1350929 TTTGTCTCACAGTGGATGCAAGG - Intronic
1063657038 10:8000770-8000792 TTTATTTATTATTTGAGGCAGGG - Intronic
1063822502 10:9854019-9854041 TTTATTTAAGAGTTGTTTTATGG - Intergenic
1063933508 10:11053255-11053277 ACTAATTAACAGTTGATCCAAGG - Intronic
1064875417 10:19988507-19988529 TTTACTTAATAGTGGATTCAAGG + Intronic
1065955146 10:30687195-30687217 TTTATTTAACAGGTGTTATATGG + Intergenic
1067927774 10:50527803-50527825 GTTATTTAACACATGCTGCAGGG + Intronic
1068377553 10:56202461-56202483 TTCATTTAACATTTATTGCATGG - Intergenic
1068505309 10:57893041-57893063 TTTCATTGACAGTAGATGCATGG - Intergenic
1069529246 10:69203730-69203752 TTTATTTTATATTTGAGGCAGGG + Intronic
1071669797 10:87597745-87597767 TTTATTTGAAAGATGATCCAGGG - Intergenic
1071699013 10:87909152-87909174 ATTATTTGACAATAGATGCAAGG + Intronic
1072386165 10:94930561-94930583 TTTATTTAACATTTTTTGCAAGG - Intergenic
1072455601 10:95572919-95572941 TTTTTTTAACATTTGAAGAAGGG - Intergenic
1073654727 10:105401159-105401181 TTTAGTTAACAATTCTTGCAAGG - Intergenic
1073880824 10:107977726-107977748 TTTATATAACAGATTTTGCAAGG + Intergenic
1074989290 10:118688438-118688460 TTTATTTAACCTTTGAGGAATGG - Intronic
1075312249 10:121424217-121424239 GTTATTTAGCAGTTAATCCATGG + Intergenic
1075914439 10:126155411-126155433 TTTTTTTAACAGATAATCCAAGG + Intronic
1077997930 11:7469851-7469873 TTTATTTTACACTTGAGTCAGGG + Intergenic
1081057312 11:38426449-38426471 TTTATTTAATAGTTCATGAAGGG + Intergenic
1081136447 11:39445366-39445388 TTTATTAACCATTTGAGGCAGGG + Intergenic
1084407508 11:68984082-68984104 TTTATTGGACAGCTGATGAATGG + Intergenic
1085029126 11:73258952-73258974 TTTATTTCAGAGGTGATCCAGGG - Intergenic
1086005003 11:82027377-82027399 TTTGTTTCACAGTGGAGGCAAGG - Intergenic
1086558784 11:88143007-88143029 TTTATTGAGCAATTGATACATGG - Intronic
1087850396 11:103021559-103021581 TCTCTTTAACAGATGATGCTGGG + Intergenic
1088136681 11:106563810-106563832 TTTATTTAAAAGCGGATGGAAGG + Intergenic
1088434875 11:109801144-109801166 TTTATTTAATATTTTATGTAGGG - Intergenic
1088554946 11:111052351-111052373 TTTGTTTCACAGTGGAGGCATGG - Intergenic
1088942012 11:114468734-114468756 TTTATTAAATATTTGAAGCAGGG - Intergenic
1089241472 11:117084961-117084983 TTTGTTAACCTGTTGATGCAGGG - Intronic
1090109592 11:123891849-123891871 TCTATATAACAGTGGATGTAGGG - Intergenic
1090496659 11:127219522-127219544 TTTATTTAACAGCTGTTGATTGG + Intergenic
1090545566 11:127763119-127763141 TTTATTTAAAATGTTATGCATGG + Intergenic
1090571720 11:128054401-128054423 TTAATATAAGAGATGATGCATGG + Intergenic
1091307575 11:134546535-134546557 TTCATTTAACATTTCTTGCAAGG - Intergenic
1091646987 12:2280929-2280951 TTATTTTAACAGTTGCTGTAGGG + Intronic
1093115805 12:15209514-15209536 TTTTTTTAACACTTGATCCGAGG + Intronic
1093285014 12:17248173-17248195 TTTATTTAATGGTTGATTTAGGG - Intergenic
1094354262 12:29561023-29561045 TTTATTTTACAGTTGAGGAAAGG + Intronic
1095105776 12:38231186-38231208 TTTCTTTAACAATTGATTCTAGG - Intergenic
1095311350 12:40700966-40700988 GTTATTAAAAAGTTAATGCATGG + Intronic
1095878992 12:47112162-47112184 TTTATTTAACACTTGTTCTATGG + Intronic
1097115776 12:56695905-56695927 TATATTTAGCAGTTGAGGAAAGG + Intergenic
1097202909 12:57294837-57294859 TTAATTTGACATTTGATGCTGGG - Intronic
1098962998 12:76758654-76758676 TTTATTCAACAGATGGTGCTGGG + Intergenic
1099043110 12:77680398-77680420 TTTACTTAACTGTGGATTCATGG + Intergenic
1099363500 12:81737651-81737673 TTTGTTTAACAGTTGAAACATGG - Intronic
1099586324 12:84520927-84520949 TTCTTTTAACAGTTTCTGCAAGG + Intergenic
1099692343 12:85973470-85973492 TTTATTTAAGAGTTGTTTAAAGG - Exonic
1099762572 12:86940956-86940978 TTTGTTTCACAGTGGAGGCAAGG - Intergenic
1101484748 12:105143960-105143982 TTTTTTTAACAGTTATTACAAGG + Intronic
1104222081 12:126794879-126794901 CTTATTGAACAGATGATGGATGG - Intergenic
1106712564 13:32353693-32353715 TTCATTAAATAGTTGATGGATGG + Intronic
1108940117 13:55942368-55942390 TTTATTTAACAATATGTGCATGG + Intergenic
1108947423 13:56042468-56042490 TTTGTCTCACAGTGGATGCAAGG - Intergenic
1108952960 13:56115973-56115995 TTTGTCTCACAGTGGATGCAAGG + Intergenic
1110182204 13:72630877-72630899 CTTATTTAACAGATGGTGCTGGG + Intergenic
1110293651 13:73837153-73837175 TTTATTTACTATTTAATGCAGGG + Intronic
1111086905 13:83387401-83387423 TTTATTTAAAACTTTATACAGGG - Intergenic
1111341307 13:86890274-86890296 TTTATTTTACAAATGATGAACGG - Intergenic
1111491578 13:88983358-88983380 TTTATTGAACTGTTGATTCCAGG - Intergenic
1111839317 13:93429546-93429568 TTTACTTAACAGGTCATGAATGG - Intronic
1112299704 13:98218605-98218627 TTTCTTTAACAGTAGACACACGG - Intronic
1112922685 13:104634962-104634984 TTTATGGAACAGATGAAGCAGGG - Intergenic
1112925670 13:104671631-104671653 ATTATTTCACATTTCATGCAAGG - Intergenic
1117137168 14:52747428-52747450 TTTTTTTGACAGTTGAGACATGG + Intronic
1119499068 14:75107477-75107499 TTTATTTCACAGAACATGCAAGG - Exonic
1122255287 14:100471834-100471856 TTTATTTAAGTGTTGATTCATGG - Intronic
1123141598 14:106084849-106084871 TTTATTTTACTGTTGTTGGACGG - Intergenic
1123607766 15:22053087-22053109 TGTATTTAAGAGTTCAAGCATGG - Intergenic
1123882508 15:24689134-24689156 TTTGTTTCACAGTGGAGGCAAGG + Intergenic
1124035856 15:26053085-26053107 TTTATTTAAAAGATGTTGCAAGG - Intergenic
1124624440 15:31300047-31300069 TTTCTCTTGCAGTTGATGCATGG - Intergenic
1125066507 15:35492614-35492636 TTTATTTAACAGCTCAATCATGG - Intronic
1127422924 15:58825914-58825936 TTTCTTTAACAGTTGTTCCTAGG + Intronic
1127532425 15:59857513-59857535 TTTTTTTAACTGTAGATGCATGG - Intergenic
1127600599 15:60532707-60532729 TCTATTTAATAGTTGATCTAAGG - Intronic
1130033437 15:80336324-80336346 TTTATTTAATATTTGATAGATGG + Intergenic
1130642377 15:85690354-85690376 TCCATTTAACATTTTATGCATGG + Intronic
1131305072 15:91235270-91235292 TTTCTTGTACAGTTTATGCAAGG + Intronic
1202980000 15_KI270727v1_random:344885-344907 TGTATTTAAGAGTTCAAGCATGG - Intergenic
1134295816 16:12944854-12944876 TTTATTTGAGAGTTGATCCCAGG + Intronic
1138101663 16:54256777-54256799 TTTTTTTAAAAATTGAGGCAGGG + Intronic
1139044274 16:63037721-63037743 ATTATTTAAAAGTTGCTGAAAGG - Intergenic
1139841394 16:69883734-69883756 TCTGTTTAACAGTTTTTGCAGGG - Intronic
1140136563 16:72210993-72211015 GTTCTTTAACAGTTGGTGAAGGG + Intergenic
1140561487 16:75987293-75987315 TTTATCCAACATTTGATGGATGG - Intergenic
1140678627 16:77361280-77361302 ATTTTTTAAAAGTTGATGGATGG - Intronic
1141240223 16:82258997-82259019 TTCACTTAACACTTTATGCAGGG + Intergenic
1141512499 16:84521728-84521750 TTTTTTTAAAAATTGAGGCAGGG + Intronic
1146428601 17:32768207-32768229 TTTATTTTCCAGGTGAGGCAAGG + Intronic
1147054251 17:37822248-37822270 TCCATTTATCAGTTGATGAATGG + Intergenic
1147548365 17:41420564-41420586 TTTATTGACCATTTAATGCAGGG + Intergenic
1149294224 17:55247118-55247140 TTTACTTAACACTTGTTGAAGGG - Intergenic
1151099927 17:71545116-71545138 TTTATTTATCTTTTGAGGCAGGG - Intergenic
1152129869 17:78469680-78469702 TTTATGTACCTGTTCATGCATGG - Intronic
1153432637 18:5035505-5035527 TTTATTCAACAAATGATGCTTGG - Intergenic
1153434764 18:5057639-5057661 TTTAATAAAGAGTTGTTGCATGG - Intergenic
1155283454 18:24264915-24264937 TTTATTTTACAGAGGATGCTAGG - Intronic
1156082136 18:33350122-33350144 ACTATTTAATAGTTGATGCTGGG - Intronic
1156782021 18:40861760-40861782 TCTATTTTACAGTTCATGGAAGG - Intergenic
1156915805 18:42463727-42463749 TTTCTTTCACAGTGGAGGCAAGG - Intergenic
1157550699 18:48580055-48580077 TTTATTTCTCAGTAGATGAATGG - Intronic
1159524745 18:69573640-69573662 TTTTTTTAAGAGTGTATGCAAGG + Intronic
1161143743 19:2664735-2664757 TTTTTTTGCCAGTTAATGCAAGG + Intronic
1162608456 19:11730613-11730635 ATTATTTCACAGTAGATGAAAGG + Intronic
1164848375 19:31456007-31456029 TTTTTTTAACTACTGATGCATGG - Intergenic
1165016293 19:32882653-32882675 TTAGGTTACCAGTTGATGCAGGG - Intronic
1165870362 19:38968038-38968060 TTTCTTTAAAAGTTGAGGCCAGG + Intronic
1166155199 19:40906023-40906045 TTTATTTATCAGTTTATCCAGGG + Intergenic
1167978085 19:53248471-53248493 TTTGCTTAACATTTCATGCAGGG + Intronic
927582901 2:24270349-24270371 TTCTTTTAACAGTTGCTGTATGG + Intronic
930793103 2:55355908-55355930 TTCATTCAACAGTTCATGCATGG + Intronic
931371961 2:61671992-61672014 TTTATTTCACAGAAGAGGCAAGG + Intergenic
932192942 2:69756376-69756398 TTCATTTTACAGTTGAGGAAAGG - Intronic
933329536 2:80878018-80878040 TTTATCTCACAGTGGAGGCAAGG + Intergenic
934101727 2:88659802-88659824 TTTATTTACCAGTTTATTCCGGG + Intergenic
934473163 2:94574072-94574094 TTTAATTAACAGTAGATGGTGGG + Intergenic
937384956 2:121421146-121421168 ATTATTTAACATTTGAACCATGG - Intronic
937598036 2:123693712-123693734 TTTGTTTAACACTTCATGCAAGG - Intergenic
937677312 2:124606328-124606350 TTTATTTAACAGTTGGAAAATGG - Intronic
938548579 2:132358677-132358699 TTTATTTAATAAATAATGCAGGG + Intergenic
939201977 2:139047484-139047506 TTTTTTTAACAGTTCTTGCAGGG - Intergenic
940332916 2:152494622-152494644 TTTAATTAACAGTTGTTTGAAGG + Intronic
941562463 2:167064895-167064917 TTCATTTATCAGTGGATGCTTGG + Intronic
941860415 2:170273233-170273255 TTTAATTATCAGTTGAGGCTTGG - Intronic
942478455 2:176355100-176355122 TTTATTTTGCTGTTGTTGCATGG + Intergenic
943450117 2:188035403-188035425 TTTCTTTCACAGTGGAGGCAAGG - Intergenic
944270113 2:197773293-197773315 TTTATTTAGCAGGTAAAGCATGG - Intronic
944929410 2:204501181-204501203 TTTATTTGAGAGTTGACGCCAGG + Intergenic
945202023 2:207291462-207291484 TTTATCTAACAGTGCATGCCAGG + Intergenic
945361632 2:208901399-208901421 TTTGTTTCACAGTGGAGGCAAGG - Intergenic
945462749 2:210129501-210129523 TTTATGTAACAGTTTTTACATGG - Intronic
945619670 2:212119109-212119131 TTTATTTAACAGTTGATGCATGG - Intronic
946149748 2:217756364-217756386 TTTATTGAACAGAAGAGGCAGGG - Intronic
947771081 2:232670545-232670567 ATTATTCAACAAATGATGCAAGG + Intronic
1169482258 20:5994940-5994962 TTTATTTAACAATTAACACATGG - Exonic
1170022971 20:11856163-11856185 TTTTTTTAACATTTCTTGCAAGG - Intergenic
1170160744 20:13307813-13307835 TTTATTTAACAGTTCTACCATGG + Intergenic
1170766964 20:19298529-19298551 TTTATTTAGGAGTTGATCCCAGG + Intronic
1173307385 20:41863277-41863299 TTTATTTAGGAGTTGATCCTAGG + Intergenic
1173440727 20:43073220-43073242 TATATTTAACAGTTAAAACATGG - Intronic
1174987514 20:55471659-55471681 TTTGTTTAATAATTGATGGAAGG + Intergenic
1177856120 21:26402432-26402454 TTTATGTCACAGTTGAAGAAGGG + Intergenic
1179083751 21:38198025-38198047 TTTATTTAACAAATGGTGCTGGG - Intronic
1183470196 22:38001217-38001239 TTTATTCATGAGTTGTTGCAAGG + Intronic
949827424 3:8179175-8179197 TTTGTTTCACAGTGGAGGCAAGG - Intergenic
950511025 3:13427058-13427080 TTTTTTTAACTTTTGTTGCATGG - Intergenic
950925800 3:16740593-16740615 ATTATTCAACAAATGATGCAGGG - Intergenic
951513990 3:23537374-23537396 TTTATTTGAAAGGTGATGCAGGG - Intronic
951601557 3:24381661-24381683 TTTATTTAACATTTTATACCGGG - Intronic
951992896 3:28695818-28695840 TTTAGTTGAGAGTTGATGGAAGG + Intergenic
953065913 3:39471061-39471083 TACATTTAACATTTAATGCATGG - Intronic
953847934 3:46443640-46443662 TTTACCTAACAGCCGATGCAGGG + Intronic
954816129 3:53282127-53282149 TTTATTCAAAAGTTTATGGATGG + Intergenic
956094367 3:65700599-65700621 TTTATTTATAAGTAGATCCAGGG - Intronic
956601313 3:71025587-71025609 ATTATTTAAAAATTAATGCAAGG + Intronic
956839157 3:73121080-73121102 TTAATGTAAAAGTTGAGGCAGGG + Intergenic
957120711 3:76087500-76087522 TTTTTTTAACATTTCTTGCAAGG - Intronic
957121033 3:76092727-76092749 TTTATTTAAGAATTGTTGCCAGG + Intronic
957462870 3:80545079-80545101 TTTATTTAAAAAGTGATCCAAGG + Intergenic
957558620 3:81793009-81793031 TTTATTTAACAACTGAGGCCGGG + Intergenic
958059775 3:88464888-88464910 TCTATTTTACAGATGATGAATGG + Intergenic
958137180 3:89509649-89509671 TTTATTTAACATTTAATTTATGG + Intergenic
958670112 3:97192856-97192878 TTTATTTAATAATTGATGCTGGG - Intronic
959483115 3:106897440-106897462 CTTTTTGAACAGTTGATGTATGG + Intergenic
959637892 3:108595880-108595902 TTTAATGAACACTTGATGCTAGG + Intronic
960754112 3:120990738-120990760 CTTATTTAATAGATGATGCTGGG + Intronic
961026851 3:123565814-123565836 TTTATTTAACCGTTTATGAAAGG + Intronic
962000942 3:131296462-131296484 TTCATTTAACATTTCTTGCAAGG + Intronic
962312336 3:134335483-134335505 TTAATGTAACAGTGGATGAAAGG - Intergenic
963426155 3:145127732-145127754 ATTATTTTACAGATAATGCATGG + Intergenic
963619711 3:147590922-147590944 TTTCTTTAACAGTTGATATCTGG - Intergenic
963821896 3:149906219-149906241 TCTATTCATCAGTTGATGGATGG + Intronic
964022389 3:152028806-152028828 TTTTTTTTAAAGTTCATGCAAGG - Intergenic
967629269 3:191724344-191724366 TTTTTTTAAAAGTTGTTTCACGG + Intergenic
969521393 4:7679762-7679784 TTTTTTTTACAGCAGATGCAGGG + Intronic
970344227 4:15137667-15137689 TTTGTCTAAGAGTTGATTCAGGG - Intergenic
971207165 4:24582156-24582178 TTTATTTAACAGTGGACTTAAGG - Intronic
971669273 4:29534937-29534959 TTTATTTTACAGATGAGGAAAGG + Intergenic
973800021 4:54468469-54468491 TTCATTTAACATTTCTTGCAAGG + Intergenic
975202160 4:71604338-71604360 TCTATTTAATAGTTGAACCAAGG - Intergenic
976022510 4:80646240-80646262 TTTATTTAACAAATATTGCATGG - Intronic
977737092 4:100429871-100429893 TATATTTAACAGTAAGTGCAAGG + Intronic
978033465 4:103966598-103966620 TTTTTTTAACATTTCCTGCAAGG + Intergenic
978116075 4:105022000-105022022 TTTATTTAAAAGATGATTGAAGG + Intergenic
978136297 4:105265242-105265264 ATTATTTAACAGTTGATACGTGG + Intronic
978801268 4:112757637-112757659 TTTATTTAATAGGTAATCCATGG + Intergenic
979149694 4:117295173-117295195 TTTCCATACCAGTTGATGCAAGG + Intergenic
979214334 4:118144665-118144687 TTTATTTATCAGAAGATGTATGG + Intronic
979399846 4:120235946-120235968 TTTATTTAATAATTGAATCATGG + Intergenic
979450777 4:120868280-120868302 TTTATATAACATTTTCTGCAGGG + Intronic
981115459 4:140984968-140984990 TTTATTTAAAAGTTGATTCCAGG - Intronic
983581545 4:169314429-169314451 TTTATTTGATAGTTAATGAATGG + Intergenic
984411709 4:179405373-179405395 TTTCTCTCACAGTTGAGGCAAGG - Intergenic
984664135 4:182407062-182407084 TTTATTTTACAGTCGAACCATGG - Intronic
988207539 5:28159469-28159491 TTTTTTTTACAGTCAATGCAAGG + Intergenic
990329026 5:54707132-54707154 TTTATTTTGCAGTTGATTCCAGG - Intergenic
993010969 5:82482466-82482488 TTGATTTAAAAATTGATTCAAGG - Intergenic
993297256 5:86156889-86156911 TTTATTTGACAGGTGATCCCAGG + Intergenic
993440267 5:87948365-87948387 TTTATTTCACAATTGAGGAAAGG - Intergenic
993834991 5:92808821-92808843 TTTATTTTCCATTTGATCCAAGG - Intergenic
993908561 5:93651909-93651931 TGTTTTTAACAGTTGATCTAGGG - Intronic
994174265 5:96693919-96693941 TTTATTCTACAGATGATGCCTGG + Intronic
995359983 5:111285018-111285040 ATTTTTTAACATTTCATGCATGG + Intronic
995809366 5:116087005-116087027 TTGATTTTACAGTTGAAACAGGG + Intronic
995917090 5:117261052-117261074 ATTGTTTCACATTTGATGCAAGG + Intergenic
996398085 5:123033137-123033159 TTTATTTTACAGATGAAGAAAGG - Intronic
996490932 5:124095327-124095349 CTTATTTAACAAATGATGCAGGG - Intergenic
996939327 5:128984842-128984864 TTTATTTAAAAATTGGTGGAGGG + Intronic
997310895 5:132881655-132881677 TTTAGTTATCAGTTGGTTCATGG - Intronic
997342537 5:133156113-133156135 TTTATTTCACAGTTCCTGAATGG + Intergenic
998857598 5:146408707-146408729 TTTATTTAAAAGATGTTGGATGG + Intergenic
1000318127 5:160112520-160112542 TTTACTTAACACTGGATGCCTGG - Intronic
1000503068 5:162076959-162076981 TTTATTTAAAAATAGTTGCAGGG - Intronic
1000628128 5:163562717-163562739 TTTATTTATCTGTTGAAACAAGG - Intergenic
1000737364 5:164921877-164921899 TCCATTTAACACTTGATGCCTGG + Intergenic
1001167934 5:169388364-169388386 TATATTTAAAAGTATATGCAAGG + Intergenic
1001538309 5:172515758-172515780 TTTTTTTAACATTTCCTGCAAGG - Intergenic
1003353417 6:5342229-5342251 TTTGTTCATCAGCTGATGCATGG - Intronic
1003843964 6:10153461-10153483 TTTATTTTACAGTTTATGACAGG - Intronic
1004704139 6:18107769-18107791 TTTATTTAAAAATTGAGACAGGG - Intergenic
1005778936 6:29167909-29167931 TTTCTTTAATAAATGATGCAGGG + Intergenic
1006861173 6:37172288-37172310 TGTATTTAACAGTTAATGGCTGG + Intronic
1007501610 6:42302517-42302539 ATGATTTAACATTTGAAGCAGGG - Intronic
1009801261 6:68539314-68539336 TTTATATAACTGTTGATACTTGG - Intergenic
1010120027 6:72364661-72364683 TTTATTTGAGAGTTGATCCCCGG + Intronic
1010605043 6:77878311-77878333 TTTATTTAACACTTCATGTTTGG - Intronic
1011344190 6:86350938-86350960 GCTAGTTAACAGTTGATGCTTGG - Intergenic
1012607444 6:101175229-101175251 TTCATTTAACTGTGGGTGCATGG - Intergenic
1013884826 6:114949622-114949644 TTTATTTAGCAACTGAGGCAAGG + Intergenic
1014505836 6:122254075-122254097 TTTTTTCAACAATTTATGCAGGG - Intergenic
1014881013 6:126724620-126724642 TTTCTTTAACAGTTAGTACATGG + Intergenic
1017123831 6:151048354-151048376 TTTAATTAACAGTAGATGGTGGG - Intronic
1018959610 6:168438799-168438821 TTTAATTAAAAAGTGATGCAGGG - Intergenic
1020368045 7:7401336-7401358 TTTATTTAACAATTTATAGATGG - Intronic
1020589765 7:10120215-10120237 TATATTTTACAGTTGAAGCTTGG + Intergenic
1020794194 7:12661723-12661745 TTTATCTCACAGTGGAGGCAAGG - Intergenic
1021106189 7:16642728-16642750 TTTATTTTATAGTTGAAGAAAGG - Intronic
1021322075 7:19224897-19224919 TTTTTTTAACCATTGATGTAGGG + Intergenic
1021725310 7:23542905-23542927 AATGTTTATCAGTTGATGCATGG + Intergenic
1022028226 7:26468190-26468212 TTTTTTTAACAGCTGCTGAATGG - Intergenic
1022784169 7:33620337-33620359 TTTATTTAACAGTTTTTTTAAGG - Intergenic
1022839730 7:34151716-34151738 TTTAGTTAACAGTTGAGGCAGGG + Intronic
1025008382 7:55373998-55374020 TTGATTAAACAATTGCTGCATGG - Intronic
1026733765 7:72935175-72935197 TTTATTTAACTTTTGAGACAAGG + Intronic
1026784046 7:73289729-73289751 TTTATTTAACTTTTGAGACAAGG + Intergenic
1027109988 7:75429998-75430020 TTTATTTAACTTTTGAGACAAGG - Intronic
1028058961 7:86285382-86285404 TTTATTTATCACTTGTTTCAAGG - Intergenic
1029580380 7:101433316-101433338 TTTATTTATTTTTTGATGCAGGG - Intronic
1030040559 7:105446217-105446239 TTCTTTTAACAGTTTTTGCAAGG - Intronic
1031831819 7:126636895-126636917 TTTATTTAACTTTTGTTGCATGG + Intronic
1032704347 7:134409225-134409247 TTTATTAAACAGTGTTTGCAGGG + Intergenic
1033328293 7:140397626-140397648 TATATATAACAGTTGTTGAAGGG - Intronic
1034315801 7:150131817-150131839 TTTCTTTATCTGTTGATCCATGG - Intergenic
1034791089 7:153968984-153969006 TTTATTTATCTGTTGATCAATGG + Intronic
1036171125 8:6486022-6486044 TTTATTTAAAAGTTAAAGGAGGG - Intronic
1037128454 8:15379546-15379568 TATAATTTACAGTTGATGAATGG + Intergenic
1037514329 8:19615302-19615324 GTTATTTATCAGTTGATTGATGG - Intronic
1037939251 8:22939331-22939353 TTCTTTTAACATTTCATGCAAGG - Intronic
1039132121 8:34277127-34277149 TTTTTTTAACATTTCTTGCAAGG - Intergenic
1039203837 8:35127290-35127312 TTTATTTAATAAAGGATGCACGG + Intergenic
1040694051 8:49974647-49974669 TTCATTTTACAGTTGATGTAGGG - Intronic
1041790016 8:61685023-61685045 TTTATCAAACAGATGATGGAAGG + Intronic
1041892696 8:62889076-62889098 TTTATTGAACAGTCCAGGCACGG + Intronic
1041917553 8:63151852-63151874 TTTATCTCACAGTGGAGGCAAGG + Intergenic
1042412736 8:68482907-68482929 TTTATTTCACAGTTGAAAAAAGG + Intronic
1043105767 8:76108033-76108055 TCTATTTAACAGATGGTGCTGGG - Intergenic
1043649300 8:82568630-82568652 TTTAGTCAACAGTTGGTACAGGG + Intergenic
1044023158 8:87132185-87132207 TTTTTTTAACATATGAAGCAAGG - Intronic
1044848123 8:96401624-96401646 TATTTTTAAAAGATGATGCAGGG + Intergenic
1045052076 8:98336534-98336556 TTTATTTGAGAGGTGATCCAAGG + Intergenic
1045822047 8:106350347-106350369 TTTATTTAAAAGTTGCTGTAAGG + Intronic
1046773995 8:118144597-118144619 TTAATTTAAAAATTGGTGCAAGG + Intergenic
1048158586 8:131989843-131989865 TTTATTGAACTATTGATGCCTGG + Intronic
1050037790 9:1455646-1455668 TTTATGAAACAAATGATGCAAGG + Intergenic
1052155551 9:25184377-25184399 TTTATTTACCTGTCGATGAATGG + Intergenic
1053935134 9:43142729-43142751 TTTAATTAACAGTAGATGGTGGG - Intergenic
1054713497 9:68534794-68534816 TTTTTTTAACATTTCATGTAAGG - Intergenic
1056424272 9:86461036-86461058 TTTATTAAAGAATTAATGCATGG - Intergenic
1057843534 9:98504727-98504749 TTGATTAAACAGTTCATTCAAGG + Intronic
1059140996 9:111853050-111853072 TTTTTTTAAGAGTTGCTGTACGG + Intergenic
1059598501 9:115749194-115749216 TTTATTTTACACTTGGTACAAGG - Intergenic
1059833051 9:118119926-118119948 TTAATTTTGCATTTGATGCATGG - Intergenic
1060578142 9:124717335-124717357 TTTATTTACCTGTTGATACCTGG - Intronic
1060785023 9:126444811-126444833 ATTATTTAACAAGTGATGCTGGG - Intronic
1061583050 9:131549242-131549264 TTTATCTCACAGTGGAGGCAAGG - Intergenic
1185858448 X:3556679-3556701 TTTGTTTCACAGTGGAGGCAAGG + Intergenic
1186718589 X:12279058-12279080 TTTATTTAACAGATCAAACAGGG - Intronic
1186804699 X:13128478-13128500 TTTCTTTAACAGTTAATGAGTGG - Intergenic
1188977711 X:36695278-36695300 TTTATTTAACAAATGATGCTGGG - Intergenic
1189047691 X:37610914-37610936 TTTATTTGACAGGTGATCCCAGG + Intronic
1189676218 X:43463394-43463416 TTTATTTGGCAGTTAATGCCAGG + Intergenic
1192411283 X:70935017-70935039 TTTAATTAAAAGTTGAGGCCAGG + Intergenic
1193388952 X:80904722-80904744 TTTATTTCTCAGTAGATACAGGG - Intergenic
1194986582 X:100496280-100496302 TTTATTTACAATTTGATGCATGG + Intergenic
1195846835 X:109238003-109238025 TTTAGCTGACAGTTGCTGCAGGG + Intergenic
1196289423 X:113921836-113921858 GTTATTTAACAGTTGAAGAAAGG + Intergenic
1197380605 X:125733883-125733905 TTTATATAACATTTCATCCAAGG - Intergenic
1197541037 X:127761249-127761271 TTTATGTAACACTTGAAGAAAGG + Intergenic
1198323324 X:135541499-135541521 GTTATTTAACACTTGATGTGTGG - Intronic
1199528083 X:148814725-148814747 TTTAGTTAACAGTTTTAGCATGG + Intronic
1199817657 X:151413010-151413032 GTTATATAACAGTTGTTACATGG + Intergenic
1200924423 Y:8641766-8641788 TTTATTGGACAGTTGCTGGATGG + Intergenic
1202337086 Y:23823970-23823992 TTTATTTGACATTTTCTGCAGGG + Intergenic
1202533679 Y:25846101-25846123 TTTATTTGACATTTTCTGCAGGG - Intergenic