ID: 945619702

View in Genome Browser
Species Human (GRCh38)
Location 2:212119656-212119678
Sequence CTACCAAGGAACCACATTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 163}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945619702_945619704 2 Left 945619702 2:212119656-212119678 CCAGCAATGTGGTTCCTTGGTAG 0: 1
1: 0
2: 2
3: 9
4: 163
Right 945619704 2:212119681-212119703 GAATGTTAAACATAGTAAACTGG 0: 1
1: 0
2: 0
3: 14
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945619702 Original CRISPR CTACCAAGGAACCACATTGC TGG (reversed) Intronic
901310605 1:8266547-8266569 CTAACAAAGAACCACAAGGCCGG - Intergenic
903729853 1:25484804-25484826 CTACCACGGGCACACATTGCTGG - Intronic
904571726 1:31471081-31471103 CCACCAAGGAAATACTTTGCTGG + Intergenic
908917122 1:69141825-69141847 CTACCCAGGAATCCCATTACTGG + Intergenic
910621707 1:89262516-89262538 CTTCCAGGTAACCACAATGCAGG + Intronic
913987635 1:143579889-143579911 CTACCAAGCAAAAACATTCCAGG - Intergenic
918539984 1:185621469-185621491 ATACCAAGGAGCAAGATTGCTGG - Intergenic
923932103 1:238712886-238712908 CTACCAAGTTACTACAATGCAGG - Intergenic
1063361721 10:5464825-5464847 ATACCAAGGAGCAAGATTGCTGG - Intergenic
1069121879 10:64577408-64577430 CAACCAATTCACCACATTGCAGG + Intergenic
1070636980 10:78136923-78136945 GCACCAGGGAACCACATTTCAGG + Intergenic
1071796404 10:89011155-89011177 ATTCCCAGGAAACACATTGCAGG + Intronic
1074922279 10:118027616-118027638 CTACCAAGGAGCCAATTAGCGGG - Intronic
1076514217 10:131033995-131034017 CTACCCAGGCCCCACAGTGCAGG - Intergenic
1076783083 10:132735201-132735223 CTCCCAAGGAGCCAGACTGCAGG - Intronic
1076985306 11:231794-231816 CTGGCAAGGAAACACATTCCTGG + Intronic
1079576930 11:22015842-22015864 CAACCCAGGAATCACATTACTGG - Intergenic
1080266637 11:30408237-30408259 CTGTCAAAGAGCCACATTGCAGG + Intronic
1080492430 11:32780870-32780892 CAACCCTGGAACCAGATTGCTGG - Intronic
1080608696 11:33885758-33885780 CTACCAAGGGACCCCCTTGCTGG - Intronic
1083522306 11:63326063-63326085 ATACCAAGTAATGACATTGCTGG - Intronic
1084673424 11:70620854-70620876 CTCACCAGGAACCAAATTGCTGG + Intronic
1088049942 11:105499903-105499925 ATACCAAGGAACATGATTGCTGG + Intergenic
1089558448 11:119329665-119329687 ATACCAAGGAACACAATTGCTGG - Intergenic
1089588476 11:119524749-119524771 CTACCCAAGAACCACACTCCAGG - Intergenic
1090108776 11:123882225-123882247 ATACCAAGGAACATGATTGCTGG - Intergenic
1090680793 11:129055413-129055435 ATACCAAGGAATATCATTGCTGG - Intronic
1092883949 12:12909587-12909609 CTACAAAGGCTCCACATTTCTGG - Intronic
1093020174 12:14196120-14196142 ATACCAAGGAACACAATTGCTGG - Intergenic
1093167132 12:15817131-15817153 CGACCCAGGAATCCCATTGCTGG + Intronic
1093262385 12:16954829-16954851 ATACCAAGGAGCACCATTGCTGG - Intergenic
1099701422 12:86087186-86087208 CTACCCAGGAATCCCATTGCTGG - Intronic
1102826233 12:115949987-115950009 CTCCCAAGGCAACACAGTGCGGG - Intergenic
1106175192 13:27324230-27324252 ATACCAAGGAACATAATTGCTGG - Intergenic
1109432484 13:62253288-62253310 CTACCTAGGAATCCCATTACTGG - Intergenic
1110458757 13:75719852-75719874 ATACCAAGGAACATGATTGCTGG + Intronic
1111264325 13:85787613-85787635 ATACCAAGGAACGTGATTGCTGG - Intergenic
1112462003 13:99610989-99611011 CTTCCAAGGAACCACAAGACAGG + Intronic
1117928733 14:60814253-60814275 CTACCTAGGAAGCTAATTGCTGG - Intronic
1118452223 14:65913367-65913389 CTTCCAAGGAACCCCATGGCTGG - Intergenic
1120550731 14:85869244-85869266 ATACCAAGGAACATGATTGCTGG - Intergenic
1122215108 14:100198266-100198288 CTACGCAGGAACCACATTGCAGG + Intergenic
1122952144 14:105050928-105050950 GTGCACAGGAACCACATTGCTGG + Exonic
1126229634 15:46309861-46309883 CTAACAACTAACCACATTGTTGG + Intergenic
1128624825 15:69189537-69189559 CTACCAAGGAGCATGATTGCTGG + Intronic
1131108449 15:89750068-89750090 CTGCCAAGGAACCACTTCGAAGG + Exonic
1132002294 15:98192514-98192536 CAAACAAGGAACCACTTGGCAGG + Intergenic
1134044323 16:11090131-11090153 CTTCCAGGGAACCAGAATGCAGG - Intronic
1143082863 17:4394458-4394480 CCTCCAAGGAACCAGATTACAGG - Intergenic
1143983578 17:10891943-10891965 CTACCATGGAGCCACAGTGATGG - Intergenic
1149025395 17:52021324-52021346 CAACCAAGCAATCCCATTGCTGG - Intronic
1150337939 17:64343745-64343767 CTACCAGGGCACCACACTGCTGG + Intronic
1151426736 17:74035574-74035596 ATCCCAAGGAACCACAGTGAAGG - Intergenic
1153800003 18:8660267-8660289 CTCCCAAGGTATCCCATTGCTGG + Intergenic
1160144567 18:76353065-76353087 CCACCAAGGAAACACCTTCCTGG - Intergenic
1165439453 19:35816319-35816341 CTACCCAGTAATCACATTTCTGG - Intergenic
1168453924 19:56489957-56489979 CTACCAAGGAACCAAGCTGAAGG - Intergenic
926235789 2:11042590-11042612 ATACCTAGGAATCAAATTGCTGG - Intergenic
929095381 2:38258732-38258754 ATACCAAGGAACATGATTGCTGG + Intergenic
929637723 2:43542680-43542702 CAGACAATGAACCACATTGCTGG + Intronic
930407259 2:50974641-50974663 CTACCCAGGAATTACATTGAGGG - Intronic
931884646 2:66603929-66603951 CTAAAAATGAACAACATTGCTGG - Intergenic
934152516 2:89160970-89160992 CTAGCAATGAAGCACATTACTGG + Intergenic
934214729 2:90020945-90020967 CTAGCAATGAAGCACATTACTGG - Intergenic
935154193 2:100468036-100468058 CTCACCAGGAACCACCTTGCTGG - Intergenic
937819705 2:126295800-126295822 ATACCTAGGAACCTGATTGCTGG - Intergenic
939637360 2:144598702-144598724 CTAAAAAGGAACCACATTGCTGG - Intergenic
941382078 2:164805842-164805864 CTACTAAGGAACATGATTGCTGG + Intronic
942654168 2:178197115-178197137 ATACCAAGGAATAAAATTGCTGG + Intronic
942721438 2:178957548-178957570 ATACCAAGGAACACAATTGCTGG - Intronic
943502452 2:188708909-188708931 CTACCAAGTAATCCCATTACTGG - Intergenic
945477699 2:210304876-210304898 CTACCATGAAAACCCATTGCTGG - Intronic
945619702 2:212119656-212119678 CTACCAAGGAACCACATTGCTGG - Intronic
947241648 2:228000898-228000920 ATACCAAGGAACAGGATTGCTGG + Intronic
1169149971 20:3281882-3281904 ACACCAAGGGACCAGATTGCGGG - Intronic
1170957461 20:20994372-20994394 CTACCTAGGAACAAAATTGCTGG - Intergenic
1171383506 20:24751540-24751562 CTCCCAAGTAACTAGATTGCAGG - Intergenic
1172606518 20:36217754-36217776 GTACCAAGGAACCAGGCTGCTGG + Intronic
1174846329 20:53947086-53947108 TTACCAAGGAATCAGATTGCTGG + Intronic
1175433756 20:58927862-58927884 CTACCCAGAAACCCCACTGCTGG - Intergenic
1178270268 21:31183085-31183107 TTTCCAAGGAACCAAAATGCAGG + Intronic
1184351355 22:43946069-43946091 CTACGGTGGACCCACATTGCCGG - Intronic
952015454 3:28951288-28951310 ATACCAAGGTACCACATTTTGGG + Intergenic
952868106 3:37871467-37871489 ATACCAAGGAACATGATTGCTGG + Intronic
954607765 3:51927237-51927259 ATACCAAGAAGCCAGATTGCTGG - Intergenic
956771360 3:72528717-72528739 GTACCAAGGAGCCCAATTGCTGG - Intergenic
958092623 3:88895545-88895567 CTACTAAGGTACCACTTTTCTGG - Intergenic
959183998 3:103020844-103020866 ATACCAAGGAACAAAATTGCTGG - Intergenic
959680328 3:109088688-109088710 CAACCCAGGAACCCCATTACTGG + Intronic
959933777 3:112009505-112009527 CTCCCATGGCACCCCATTGCAGG - Intronic
961985510 3:131128666-131128688 ATACCAAGGAACATGATTGCTGG + Intronic
963401007 3:144798814-144798836 CAACCCAGCAACCACATTACTGG - Intergenic
965256944 3:166425384-166425406 ATAAAAATGAACCACATTGCAGG - Intergenic
966399425 3:179533476-179533498 ATACCAAGGAACATGATTGCTGG + Intergenic
966608027 3:181841644-181841666 ATACCAAGGAGCAAGATTGCTGG - Intergenic
967449669 3:189609895-189609917 CTACCCAGGAATCCCATTACTGG - Intergenic
970342055 4:15117805-15117827 CAACCCTGGAACCACAATGCGGG - Intergenic
971955876 4:33417682-33417704 ATACCAAGGAGCCACATTTTGGG - Intergenic
973257041 4:48124057-48124079 CTAACTAGGAACCACAGGGCAGG - Intronic
974259144 4:59502431-59502453 ATACCAAGGAATTAGATTGCTGG + Intergenic
975129406 4:70817742-70817764 ATACCAAGGAACCAGGTTGCTGG - Exonic
975726620 4:77298100-77298122 CTACCAACCAACCAAATTCCAGG - Intronic
977516426 4:98025963-98025985 CTACACAGGAAGCACATTGTGGG + Intronic
977582347 4:98739288-98739310 ATACCCAGGAACGAAATTGCTGG - Intergenic
978421961 4:108542596-108542618 CTACCCAGGAAACACATAGAAGG - Intergenic
979383810 4:120040425-120040447 CTACCCAGAAATCACATTCCTGG - Intergenic
980190269 4:129516372-129516394 CTAAGAAAGAACCATATTGCTGG - Intergenic
980592612 4:134910956-134910978 CTAACAAGTAGTCACATTGCTGG - Intergenic
981882037 4:149625821-149625843 ATACCAAGGCACCACATTTTTGG + Intergenic
983187942 4:164722144-164722166 CTCCCAAGGAATCACATACCAGG - Intergenic
984613637 4:181870339-181870361 ATACCAAGGAATAAAATTGCTGG + Intergenic
986193135 5:5515238-5515260 CTACCAAGCAATCTCATTACTGG + Intergenic
987839389 5:23203340-23203362 ATACCAAGGAACACAATTGCTGG - Intergenic
987940326 5:24526722-24526744 ATAGCAATGAAGCACATTGCTGG - Intronic
988698261 5:33646032-33646054 GTTCCAAGGAACCACTGTGCAGG + Intronic
994260504 5:97653083-97653105 TGACCCAGGAATCACATTGCTGG - Intergenic
996431415 5:123382554-123382576 CTGCCAAGGTGCCACATTTCAGG + Intronic
998939053 5:147260924-147260946 CCACCAAGGAAGCACTTTACCGG + Intronic
998968945 5:147570430-147570452 CAACCAAGCAACCACACTCCTGG - Intergenic
1000053888 5:157586692-157586714 ATACCAAGGAGCCTGATTGCTGG + Intergenic
1000423759 5:161066700-161066722 ATACCAAGGAAACCTATTGCTGG - Intergenic
1002067426 5:176658949-176658971 GGGCCAAGGAGCCACATTGCTGG - Exonic
1002158450 5:177301084-177301106 CTACCATTAAACCACATTGTAGG + Intergenic
1003462455 6:6342564-6342586 TTAACAAAGAACCACATTACAGG - Intergenic
1012925990 6:105268381-105268403 ATACCAAGGAACACAATTGCTGG - Intergenic
1013031823 6:106341221-106341243 ATACCAAGGAGCCCAATTGCAGG - Intergenic
1013115626 6:107101812-107101834 CTCTCAAGGAAACACACTGCAGG + Intronic
1013675963 6:112463119-112463141 ATACCAAGGAAATACTTTGCCGG - Intergenic
1020680706 7:11233313-11233335 ATGCCAAGGTACCACATTGTGGG - Intergenic
1020732670 7:11903262-11903284 GTGCCAAGGATCCACATTGAGGG + Intergenic
1022267359 7:28770415-28770437 CTACCAAGGAACATCTTTGTTGG + Intronic
1024593518 7:50912212-50912234 ATACCAAGGAACACAATTGCTGG - Intergenic
1024908414 7:54416371-54416393 ATACCCAGAAACCAAATTGCTGG - Intergenic
1026167515 7:67923365-67923387 ATACCAAGGAGCCCAATTGCTGG - Intergenic
1026487916 7:70837052-70837074 CCACCAAGGAAATACTTTGCCGG - Intergenic
1028793422 7:94878460-94878482 CTACCAAGGAAGTACTTTACTGG - Intergenic
1029801313 7:102950489-102950511 ATACCAAGGAACATGATTGCTGG - Intronic
1030538119 7:110794129-110794151 ATACCAAGGAGCACCATTGCTGG - Intronic
1031041040 7:116838729-116838751 CTTCCAAGTAACCACCTTACTGG + Intronic
1031145914 7:117996397-117996419 CTAACAAAGAAACACATTCCAGG + Intergenic
1033882482 7:145902572-145902594 ATACCCAGGTACTACATTGCGGG - Intergenic
1034119690 7:148616250-148616272 CTAGCAAGGTACCACAGAGCGGG + Intergenic
1038854824 8:31319903-31319925 CTCCCAAGGAACCAAATAGGAGG + Intergenic
1039279024 8:35962176-35962198 ATACCCAGGAACGAGATTGCTGG + Intergenic
1039670889 8:39596685-39596707 ATACCAAGGAACACAATTGCTGG + Intronic
1041180574 8:55243580-55243602 ATACCAAGGAACTCAATTGCTGG + Intronic
1042905755 8:73770108-73770130 GAACCCAGGAACCCCATTGCTGG - Intronic
1043290841 8:78598360-78598382 CTACCAAATATCCACATAGCAGG - Exonic
1043945287 8:86244106-86244128 ATACCAAGGAACACAATTGCTGG - Intronic
1046444404 8:114298135-114298157 CAACCCAGCAACCCCATTGCTGG + Intergenic
1052166530 9:25337215-25337237 ATACCAAGGAATGCCATTGCTGG - Intergenic
1053112404 9:35473123-35473145 ATACCTAGGAATCAAATTGCTGG - Intergenic
1053573596 9:39335106-39335128 ATACCAAGAAACAAGATTGCTGG + Intergenic
1053624808 9:39858367-39858389 ATACCAAGAAACAAGATTGCGGG + Intergenic
1053838217 9:42163665-42163687 ATACCAAGAAACAAGATTGCTGG + Intergenic
1053880061 9:42584861-42584883 ATACCAAGAAACAAGATTGCGGG - Intergenic
1054116631 9:61169715-61169737 ATACCAAGAAACAAGATTGCTGG + Intergenic
1054123548 9:61283903-61283925 ATACCAAGAAACAAGATTGCTGG - Intergenic
1054231626 9:62516838-62516860 ATACCAAGAAACAAGATTGCGGG + Intergenic
1054591126 9:67012846-67012868 ATACCAAGAAACAAGATTGCTGG - Intergenic
1055594132 9:77848440-77848462 TTAACAAGCAACCCCATTGCTGG + Intronic
1056711499 9:88995447-88995469 CTTCCAAGGAGAAACATTGCTGG - Exonic
1057005570 9:91555400-91555422 ATACCAAGGAACACGATTGCTGG - Intergenic
1057026482 9:91737606-91737628 ATACCAAGTAACAAAATTGCTGG - Intronic
1057286817 9:93763339-93763361 ATACCAAGGAACAAAATTGCTGG - Intergenic
1059835330 9:118145851-118145873 CTACCAAGGAACAAAATACCTGG - Intergenic
1186046923 X:5546422-5546444 CGACCCAGGAACCCCATTTCTGG - Intergenic
1188711396 X:33404897-33404919 CTACCCAGGAATAAAATTGCTGG + Intergenic
1189993759 X:46619382-46619404 CTACCCAGGAGTAACATTGCTGG - Intronic
1192311075 X:70014227-70014249 ATACAGAGGAACCACATGGCTGG + Intronic
1196002327 X:110798922-110798944 CAACCCAGGAACTACATTGTTGG - Intergenic
1196564480 X:117188980-117189002 ATACCAAGGTACTACATTGAGGG + Intergenic
1197139102 X:123096677-123096699 ATACCCAGGAACTACATTGAGGG + Intergenic
1201401830 Y:13611714-13611736 CTACTAAGGAACCCCACTGAGGG - Intergenic
1202189351 Y:22224553-22224575 CTACCAAGGAGCCTGATTTCAGG + Intergenic