ID: 945620335

View in Genome Browser
Species Human (GRCh38)
Location 2:212127848-212127870
Sequence CCTTGCCACTCTCTAGCTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 627
Summary {0: 2, 1: 1, 2: 22, 3: 142, 4: 460}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945620335_945620339 4 Left 945620335 2:212127848-212127870 CCAGAAGCTAGAGAGTGGCAAGG 0: 2
1: 1
2: 22
3: 142
4: 460
Right 945620339 2:212127875-212127897 ATTCTACCTGGAGTTTCAGAGGG 0: 1
1: 2
2: 10
3: 21
4: 240
945620335_945620337 -8 Left 945620335 2:212127848-212127870 CCAGAAGCTAGAGAGTGGCAAGG 0: 2
1: 1
2: 22
3: 142
4: 460
Right 945620337 2:212127863-212127885 TGGCAAGGAAGAATTCTACCTGG 0: 1
1: 0
2: 1
3: 19
4: 157
945620335_945620338 3 Left 945620335 2:212127848-212127870 CCAGAAGCTAGAGAGTGGCAAGG 0: 2
1: 1
2: 22
3: 142
4: 460
Right 945620338 2:212127874-212127896 AATTCTACCTGGAGTTTCAGAGG 0: 1
1: 0
2: 5
3: 23
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945620335 Original CRISPR CCTTGCCACTCTCTAGCTTC TGG (reversed) Intronic
900410462 1:2510313-2510335 CCTTGCCACTCTGTGGCCCCTGG + Intronic
901429520 1:9204557-9204579 CCAGGCCTCTCTCCAGCTTCTGG + Intergenic
902489854 1:16773343-16773365 CCTTGCCGCTTTCTGGCTTCTGG + Intronic
903473657 1:23604956-23604978 CCTTGCCCCTTCCTAGCTTCTGG - Intronic
904162175 1:28530257-28530279 CTCTGCCACTTTCTAGCTGCTGG + Intronic
904727580 1:32561437-32561459 CCTTGCCTCTTCCTAGCTTCTGG + Intronic
904842734 1:33383873-33383895 CCTCGCCTCTTCCTAGCTTCTGG - Intronic
904892079 1:33787154-33787176 CCCTGCTTCTCCCTAGCTTCTGG - Intronic
907249104 1:53126188-53126210 CCTAGAAACTCTCTGGCTTCAGG + Intronic
907492421 1:54816603-54816625 CCTTGCCTCTTTGTAGCTTCTGG + Intronic
907557766 1:55359481-55359503 CTTTGCCCCTTCCTAGCTTCTGG - Intergenic
907571775 1:55490619-55490641 TCTTGCCATTCTCTGTCTTCTGG + Intergenic
908382920 1:63613441-63613463 CCTTGCCTCTTCCTAGCTTCTGG + Intronic
909248244 1:73317967-73317989 CCTTGCCTCTTGTTAGCTTCTGG + Intergenic
909248395 1:73320405-73320427 CCTTGCCTCTTCCTAGCTTCTGG - Intergenic
909453327 1:75823081-75823103 CTTTGCCCCTTTCTAGCTTTTGG + Intronic
909461256 1:75917072-75917094 CCTTACCTCATTCTAGCTTCTGG - Intergenic
910063835 1:83127456-83127478 CCTTACTACTCTCTTGCTTTAGG - Intergenic
910959615 1:92747841-92747863 CCTTGCCTCTTCCTAGCTTTGGG + Intronic
911295350 1:96107915-96107937 CTTTGCCATTCTCTAACTACAGG + Intergenic
911319313 1:96393396-96393418 TCTTGCCTCTTCCTAGCTTCTGG - Intergenic
912259509 1:108096421-108096443 CCTTGCTTCTTCCTAGCTTCTGG - Intergenic
912748350 1:112264809-112264831 TGTTTCCTCTCTCTAGCTTCTGG - Intergenic
913113109 1:115673472-115673494 CCTTGCCTCTTCCTAGTTTCTGG + Intronic
913176240 1:116275681-116275703 CCTTGCCTCTCACTAGCTTCTGG + Intergenic
913416902 1:118618893-118618915 CTTTTCCAGTCCCTAGCTTCTGG - Intergenic
913441959 1:118907696-118907718 TCTTGCTCCTCTTTAGCTTCAGG + Intronic
913664091 1:121031607-121031629 CCTTGCCTCTTCCTAGTTTCTGG - Intergenic
913715187 1:121526607-121526629 CCTTGCCTCTGCCTAGCATCTGG - Intergenic
914015484 1:143814886-143814908 CCTTGCCTCTTCCTAGTTTCTGG - Intergenic
914162300 1:145146122-145146144 CCTTGCCTCTTCCTAGTTTCTGG + Intergenic
914654101 1:149723427-149723449 CCTTGCCTCTTCCTAGTTTCTGG - Intergenic
915007737 1:152655686-152655708 TCTTGCCAATATCTGGCTTCTGG + Intergenic
915650133 1:157303645-157303667 CCTTGCCCCTTCTTAGCTTCTGG - Intergenic
915661385 1:157408528-157408550 CCTTGCCCCTTCTTAGCTTCTGG + Intergenic
917589909 1:176465791-176465813 TCCTGCCACTCTCCACCTTCCGG + Intronic
918014241 1:180617590-180617612 CCTTGCCTCTTCCTAGCATCTGG + Intergenic
918573125 1:186022357-186022379 CCTTGAAACTCTCTACTTTCTGG - Intronic
918954576 1:191189073-191189095 TCATGCCTCTCTCTAGTTTCTGG + Intergenic
919727414 1:200893416-200893438 CCTTGCCCATCTCCAGCTCCAGG - Intronic
920003763 1:202817641-202817663 CCTCCCCACTCTCCAGCCTCAGG - Intergenic
920558633 1:206922854-206922876 GCTTGGCACTTTCTAGCTTTGGG + Intronic
920839607 1:209543257-209543279 CCTTGCCTCTTTCTAGCTTCTGG - Intergenic
920901182 1:210111950-210111972 CCTTACCACCCTCAACCTTCAGG - Intronic
920944006 1:210511547-210511569 CCCTGCCTGTCCCTAGCTTCCGG - Intronic
921868055 1:220107795-220107817 ACTTGCCTCTTTCTAGCTTTTGG + Intronic
922352221 1:224743713-224743735 CCTTTCCCCTCTCCATCTTCAGG + Intergenic
922356593 1:224782408-224782430 ACTTGCCACACTCAGGCTTCAGG - Intergenic
922851027 1:228734442-228734464 CATTGCCACTTACTAGCTTGTGG + Intergenic
922918100 1:229275334-229275356 CCTTGCCTCTCTCTAGCTTCTGG - Intronic
923530586 1:234809185-234809207 CCTTGCCGCTTTCTGGCTTCTGG - Intergenic
924744846 1:246822367-246822389 CCTTGCCTCTCCCTAGCTTCTGG + Intergenic
1063003657 10:1947737-1947759 CCTTGCCTCTCCCAAGCTTCTGG + Intergenic
1063834947 10:10002046-10002068 CCCTGCCTCTTCCTAGCTTCTGG + Intergenic
1064320035 10:14296413-14296435 CCTTGCCTCTCTCAAGCCTCTGG + Intronic
1064703663 10:18048129-18048151 CCTTGCCTCTTCCTAGCTTCTGG - Intergenic
1066222652 10:33350842-33350864 CCTGGCCACACTCTTGCTTTAGG + Intergenic
1066665955 10:37782774-37782796 TCTTGCCTCTTCCTAGCTTCTGG - Intronic
1067179752 10:43975799-43975821 CCTTGCCTCTTCCTGGCTTCTGG - Intergenic
1067396623 10:45925805-45925827 CCTGGCCTCTTCCTAGCTTCTGG + Intergenic
1067974477 10:51008477-51008499 CCTTGCCTCTTTCTAGCTTCTGG + Intronic
1068514434 10:58008550-58008572 CCTTACCCCTTCCTAGCTTCTGG - Intergenic
1068529876 10:58173718-58173740 CTTTGCCTCTTCCTAGCTTCTGG - Intergenic
1068807305 10:61212095-61212117 CTTTGCCTCTTCCTAGCTTCTGG - Intergenic
1069296358 10:66849682-66849704 CCTTGACCCTCCCTAGCTTCTGG - Intronic
1070703695 10:78621903-78621925 CCCTGCCCCTCTCTACCTCCAGG - Intergenic
1071969699 10:90891216-90891238 CCTTGCCTCTTTTTAGCTTTTGG + Intronic
1072294452 10:93995444-93995466 CCTTTCTGCTCTCTACCTTCTGG + Intronic
1072601701 10:96937251-96937273 CCTTGCCTCTTCCTAGTTTCTGG - Intronic
1073620078 10:105037478-105037500 CCTTGCCTTTTTCTAGCTTCTGG + Intronic
1074408432 10:113201498-113201520 CCATGCCAGGTTCTAGCTTCTGG + Intergenic
1074726875 10:116319907-116319929 CCTTGCCTCTCCCCAGCTTCTGG - Intergenic
1075148927 10:119908627-119908649 CCTTCCCTCTTCCTAGCTTCTGG - Intronic
1076508345 10:130993764-130993786 CCTTGCCTCCCCCCAGCTTCTGG + Intergenic
1076784079 10:132740654-132740676 CGTAGCCACTCTCTAGCAGCAGG - Intronic
1078478699 11:11657327-11657349 CTTTGCCTCTTCCTAGCTTCTGG - Intergenic
1078522687 11:12075967-12075989 CCTTGCCTCTTCCTAGCTTCTGG + Intergenic
1078537194 11:12184774-12184796 CAATGCCCCTGTCTAGCTTCAGG + Intronic
1078862059 11:15257768-15257790 CCAGGCCTCTCTCTAGCTTCTGG - Intergenic
1079032368 11:16995184-16995206 CCCTGCCACTGACTAGCTTGTGG - Intronic
1079328422 11:19513902-19513924 CCTTGCATCTTCCTAGCTTCTGG - Intronic
1079353540 11:19712962-19712984 CCTTGCCTCTATCTAGCTCACGG + Intronic
1079669481 11:23149423-23149445 CTTTGCCTCTTCCTAGCTTCTGG + Intergenic
1080368955 11:31611741-31611763 CCTTGCCATTGTGTAGCTTACGG + Intronic
1081452145 11:43181549-43181571 CCTTGCCTTTTTCTAGCTACTGG - Intergenic
1081501327 11:43669615-43669637 CCTTGCCTCTTCCTAACTTCTGG + Intronic
1081562504 11:44230675-44230697 CCTTGCCTCTTCCTAGCTTCTGG - Intronic
1081635424 11:44718377-44718399 CCTTGCCTCTTGCTGGCTTCTGG + Intergenic
1081638303 11:44735456-44735478 CTTTGCCTCTTCCTAGCTTCTGG + Intronic
1082930955 11:58604370-58604392 CCTTGCCTCTTCCTAGCTTTTGG - Intronic
1083072704 11:60003039-60003061 CCCATCCACTCTCCAGCTTCTGG - Intergenic
1083407204 11:62465822-62465844 CTTTGCCTCTTTCTAGCTGCTGG - Intronic
1083768266 11:64852633-64852655 CCTTGCCACTCTGTCCCTGCTGG + Exonic
1083847674 11:65345467-65345489 CCGTGGGGCTCTCTAGCTTCTGG - Intronic
1084450249 11:69232591-69232613 CCAGGCCTCTCTCCAGCTTCTGG - Intergenic
1085341169 11:75732509-75732531 GTTTGCCACTCTCCAGCATCTGG + Intronic
1085404461 11:76253770-76253792 CCTTGTATCTTTCTAGCTTCTGG + Intergenic
1085449670 11:76624238-76624260 CCCTGCCACTCACTTGCTTTGGG + Intergenic
1085676102 11:78520259-78520281 CCTTGCCTCTTCCTAGTTTCTGG + Intronic
1085880024 11:80455567-80455589 CCTTGTCTCTTTCTAGTTTCTGG + Intergenic
1086172539 11:83852051-83852073 CCTTGCCTCTTCCTAGCTTCTGG - Intronic
1086903986 11:92398083-92398105 CCTTGTCTCTTGCTAGCTTCTGG + Intronic
1087191279 11:95257208-95257230 CCTTGCCTCTTCCTGGCTTCTGG - Intergenic
1087377698 11:97365859-97365881 CCTTGAGACTTTCTGGCTTCCGG + Intergenic
1087614745 11:100474953-100474975 CCTTGCCTCTTCCTAGCTTCTGG - Intergenic
1087986495 11:104688181-104688203 CTTTGCCTCTTCCTAGCTTCTGG + Intergenic
1088121102 11:106370677-106370699 CTTTGCCACTTTCTAGCTGGAGG - Intergenic
1088424311 11:109685448-109685470 TCTTGCTTCTCCCTAGCTTCTGG - Intergenic
1088428118 11:109727743-109727765 CCATCCCACCCTCTAACTTCTGG + Intergenic
1088444457 11:109909649-109909671 CCTCCCCACTTTCTAGCCTCTGG + Intergenic
1088770243 11:113028030-113028052 CCTTTCCCCTCTCCAGCCTCTGG - Intronic
1089335768 11:117722741-117722763 CCTTGCCACCCTGTGGATTCAGG + Intronic
1090821899 11:130350096-130350118 TGTTGCCACTCTCTTGCTTCAGG + Intergenic
1091150194 11:133321211-133321233 CCTAGTTACTCTCCAGCTTCTGG + Intronic
1091276655 11:134357403-134357425 CCTTGCCCCTTTCCAGCTTGAGG - Intronic
1091769862 12:3144504-3144526 CCTGGCCTCTTTCTAGCTTCTGG - Intronic
1092973858 12:13725156-13725178 CGTTGTCACTATCTAGCCTCAGG + Intronic
1093033186 12:14308072-14308094 CCTTTCCTCTTTCTAGTTTCTGG - Intergenic
1093626662 12:21357384-21357406 CCATGCCTCTTTCTAGCTTCTGG - Intronic
1093743298 12:22712415-22712437 TCTTGGCACTCGCTAGCTTTGGG + Intergenic
1093772055 12:23029716-23029738 CCTTGCCTCTCCCTGGCATCTGG + Intergenic
1093827593 12:23713232-23713254 GCATGCCTCTCCCTAGCTTCTGG - Intronic
1094642770 12:32292188-32292210 CCTTGCCCCTTCCTGGCTTCTGG + Intronic
1095267201 12:40174365-40174387 CATTGCCTCTTCCTAGCTTCTGG + Intergenic
1095345681 12:41146642-41146664 CCTTGCCTCTTCCTAGCTTCTGG - Intergenic
1095793139 12:46189071-46189093 CCTTGCCTTTCTCTTGCTCCAGG - Intronic
1096863200 12:54545109-54545131 CCTTCCCCATCTCTAGCTCCTGG + Exonic
1097560415 12:61198252-61198274 CCTTGCCTCTTGATAGCTTCTGG - Intergenic
1098204907 12:68098453-68098475 CCTTGCCTCTTCCTGGCTTCCGG + Intergenic
1098370734 12:69758493-69758515 ACTTATCACTCTCTACCTTCCGG + Intronic
1098608492 12:72424183-72424205 CCTTGCCTCTCCCTGGCTTCTGG + Intronic
1098766756 12:74500019-74500041 CCTTGCCTCTTCCTAACTTCTGG + Intergenic
1100418900 12:94409758-94409780 CCTTGCCTCTTTCTAGCTTCTGG + Intronic
1100825843 12:98473427-98473449 CCTTGCCTCTTCCTAGTTTCTGG - Intergenic
1101344592 12:103874757-103874779 CCTTGCCTCTCTCCAGCTTCTGG + Intergenic
1101364707 12:104061046-104061068 CCATGCCTCTTTCTAGCTTCTGG - Intronic
1101425610 12:104585820-104585842 CCTTGCCTCTTCCTGGCTTCTGG + Intronic
1101492613 12:105223294-105223316 CCTTGCCACTTTCCAGACTCTGG - Intronic
1102009688 12:109610646-109610668 CCTTGCCTCTTCCTAGCTTCTGG + Intergenic
1102933762 12:116880890-116880912 ACTTGCCACTCTCCCGCTCCCGG + Intronic
1103448181 12:121008566-121008588 CTTTGTGACTCTCTGGCTTCAGG - Intronic
1103456691 12:121072882-121072904 CTTTGCTTCTTTCTAGCTTCAGG + Intergenic
1103558504 12:121779885-121779907 CCTGGCCTCTCTCCAGCTCCGGG + Exonic
1104750978 12:131238429-131238451 CTTTGCCACTTGCTAGCTGCAGG - Intergenic
1106358251 13:29005315-29005337 TCTTGCCCCTCTCCAGCTGCTGG - Intronic
1106895947 13:34302535-34302557 CCTTTCCAGTCTCTATCTCCTGG + Intergenic
1106955680 13:34936024-34936046 CCTTGCCTCTTCCTCGCTTCTGG + Intergenic
1107246916 13:38307743-38307765 CTTTGCCAATCTAAAGCTTCTGG + Intergenic
1107340163 13:39396912-39396934 CCTTGCCTCTTCCTAGCTTCTGG - Intronic
1107451880 13:40517179-40517201 TCTTGCCTGTCCCTAGCTTCTGG - Intergenic
1107711330 13:43153187-43153209 CCTTGACTCTTCCTAGCTTCTGG + Intergenic
1107793966 13:44031137-44031159 CCTTGCCTCTTCCTAGATTCTGG + Intergenic
1108041108 13:46339998-46340020 CCCTGCCTCTCTCCGGCTTCTGG + Intergenic
1108364691 13:49698154-49698176 CCTTGCCTCTTCCTAGCTTCTGG - Intergenic
1108611335 13:52086917-52086939 CCTTGCCTCTTCCTAGCTTCTGG - Intronic
1109411133 13:61971005-61971027 CTTTGCCTCTCCTTAGCTTCTGG + Intergenic
1110347955 13:74470383-74470405 CCTTGCTTCTTTCTAGCTTCTGG + Intergenic
1111038730 13:82715259-82715281 CCATGCCTCTTCCTAGCTTCTGG + Intergenic
1111291896 13:86182428-86182450 CCATTCCAGGCTCTAGCTTCTGG + Intergenic
1111551143 13:89814437-89814459 CCTTACCTCTTTCTAGGTTCTGG - Intergenic
1111967807 13:94878530-94878552 CCTTGCTTCTTTCTAGCTTCTGG - Intergenic
1112094765 13:96120188-96120210 CCTTGCCTCTTCCTAGCTTCTGG - Intronic
1112726479 13:102310590-102310612 CCTTGCCTCCCTCTATCTCCTGG - Intronic
1112759203 13:102674014-102674036 CCTTTCAACTCTGTTGCTTCTGG + Intronic
1113017217 13:105841115-105841137 CCTTGCCACTGCCCAGCTTCTGG + Intergenic
1113150524 13:107258427-107258449 CATTACCTCTCTCTAGCTGCAGG - Intronic
1113360151 13:109623059-109623081 CCTTGCCTCTTGCTAGCTCCTGG - Intergenic
1113367852 13:109693411-109693433 CCCTGCCTCTCTCCAGCTTCTGG - Intergenic
1113542399 13:111119077-111119099 CCAGGCCACTCTCAGGCTTCTGG + Intronic
1113714405 13:112492994-112493016 CCTTGAGACTCTCTAGCTATGGG + Intronic
1114602472 14:23967771-23967793 CCCTGCCTCTCTCTACCTTCTGG + Intronic
1114606841 14:24004897-24004919 CCCTGCCTCTCTCTACCTTCTGG + Intronic
1114612141 14:24049845-24049867 CCCTGCCTCTCTCTACCTTCTGG + Intergenic
1115004214 14:28461690-28461712 TCTTGCCTCTTCCTAGCTTCTGG - Intergenic
1115039262 14:28901857-28901879 CCTTGCCTCTTTCTAGCCTCTGG - Intergenic
1115301979 14:31894753-31894775 CCCTTCTACTCTCTGGCTTCTGG + Intergenic
1115324663 14:32126336-32126358 CCTTGCCTCTTTCTTGCTTCTGG + Intronic
1115962377 14:38850077-38850099 CCTTGCCTTTTCCTAGCTTCTGG - Intergenic
1116627764 14:47287956-47287978 CCTTGCCTCTTCCCAGCTTCTGG - Intronic
1116965223 14:51007548-51007570 CCTTGCCACTCACTAGCTGTGGG + Intronic
1117299836 14:54413975-54413997 CCATGCCTCTTCCTAGCTTCTGG + Intronic
1117352430 14:54894368-54894390 CCTTGCCTCTTCCCAGCTTCTGG - Intronic
1117433838 14:55697745-55697767 CCCTGACATTCTCTAGCTTCTGG + Intronic
1117580881 14:57150625-57150647 CCTTGCCCCTCCCTAGCTTCTGG + Intergenic
1117599616 14:57361963-57361985 CCTTGCCACTCTCTAGCTTCCGG - Intergenic
1117744246 14:58851931-58851953 CCTTGCCTCTTACTAGTTTCTGG + Intergenic
1118737133 14:68709723-68709745 CCAGGCCAGTCTCGAGCTTCTGG + Intronic
1118869243 14:69727474-69727496 CCTGGCCTCTTTCTAGCTTTTGG + Intronic
1118916616 14:70112774-70112796 CCTTGCTTCTTCCTAGCTTCTGG + Intronic
1119334219 14:73819026-73819048 CCTTGCCTCTTCCTAGCTGCTGG + Intergenic
1120009716 14:79399874-79399896 CCTTGCCTTTTCCTAGCTTCTGG + Intronic
1120030492 14:79635582-79635604 CCTTGCCTCTTCATAGCTTCTGG + Intronic
1120245633 14:82002940-82002962 CCTCACCACACTCTACCTTCTGG - Intergenic
1120396580 14:83974538-83974560 CCTTACCTCTTCCTAGCTTCTGG - Intergenic
1120462838 14:84819165-84819187 CCTTGCCTCTTCTTAGCTTCTGG - Intergenic
1120800156 14:88678980-88679002 CCTTGTTTCTCTCTAGCTTCTGG + Intronic
1121222420 14:92296530-92296552 CCTTGCCTCTTCCAAGCTTCTGG - Intergenic
1121463273 14:94098272-94098294 CCATGCCACTCCCTAGTTTCTGG + Intronic
1121731246 14:96188687-96188709 CCAGGCCTCTCTGTAGCTTCTGG - Intergenic
1122083869 14:99286014-99286036 CCTTGCCTCTTCCTAGCTTCTGG - Intergenic
1122202188 14:100129368-100129390 CCTTGTCCCTCTCTCGATTCTGG + Intronic
1124111685 15:26795893-26795915 CCTTGCCTCTCCCTGGCTTCTGG + Intronic
1124219506 15:27837286-27837308 CGATGCCACTGTCTTGCTTCTGG + Intronic
1124462446 15:29904950-29904972 CCTTGCCTCTTCCTAGTTTCTGG - Intronic
1126176424 15:45739984-45740006 CCTTTCCACTTTCTAATTTCTGG - Intergenic
1126268844 15:46788850-46788872 CCTTGCCACTTCCTAGCTCTTGG + Intergenic
1126487697 15:49200610-49200632 CCCTGCCTCTTTCTACCTTCTGG - Intronic
1126568965 15:50129386-50129408 CCATGCCTCTCTTCAGCTTCTGG + Intronic
1127287311 15:57543138-57543160 CCTTGCCTCCTCCTAGCTTCTGG + Intronic
1127764593 15:62172757-62172779 TCTCGCCTCTTTCTAGCTTCTGG + Intergenic
1128504876 15:68261065-68261087 CCAGGCCACTCTCCAACTTCAGG + Intergenic
1129958842 15:79664845-79664867 CCTTGCCTCTTCCTAGCTTCTGG + Intergenic
1130200321 15:81819961-81819983 CCTGGCCTCTTCCTAGCTTCTGG + Intergenic
1130981643 15:88815978-88816000 CCTTGCCCCTTCCTGGCTTCTGG + Intronic
1132276381 15:100568525-100568547 CCCTGCCCCTTTCTGGCTTCTGG - Exonic
1132286905 15:100670004-100670026 CCAGGCCTCTCTCTAGCTTCGGG + Intergenic
1134077496 16:11302201-11302223 CCATGCCTCTCCCTAGCTTCTGG + Intronic
1135396353 16:22134626-22134648 CCTTGCCCCTCCCTGGCTTCTGG + Intronic
1135503992 16:23020522-23020544 CTTTGCCACTCTCTGTGTTCAGG - Intergenic
1135820763 16:25683486-25683508 CTTTGCCTCTTCCTAGCTTCTGG - Intergenic
1138304861 16:55965303-55965325 CCTTGCCTCTTTCAAGCTTCTGG + Intergenic
1138909049 16:61374521-61374543 TCTTGCCTCTTTCTATCTTCTGG + Intergenic
1139517944 16:67462850-67462872 CCATGCCCATGTCTAGCTTCTGG + Intronic
1140175761 16:72658101-72658123 CCTACCCTCTCCCTAGCTTCTGG + Intergenic
1140891946 16:79292366-79292388 CCTTGCCTCTAACTAGCTTCTGG - Intergenic
1141025651 16:80544776-80544798 CCTTACCTCTTCCTAGCTTCTGG + Intronic
1141055666 16:80811429-80811451 CCTTGCCCCTTGCTAGCTTCTGG - Intergenic
1143760040 17:9095239-9095261 CCTTGCCTCTGTTTTGCTTCTGG + Intronic
1150596803 17:66613583-66613605 CCTTGCCTCTTCCTGGCTTCTGG + Intronic
1150885619 17:69082400-69082422 CCTTTCCACTCTCTATTTTAAGG + Intronic
1151350607 17:73529750-73529772 CCATGCCTGTCTCTAGCTTTTGG - Intronic
1152818054 17:82420432-82420454 CCTTGCTTCTCTCTAGCTTCTGG - Intronic
1155072248 18:22326842-22326864 CCTCGCCTCTCCCTAGGTTCTGG - Intergenic
1156128431 18:33937216-33937238 CCTTGCCACTGGCTTGCTTCAGG + Intronic
1156163982 18:34395641-34395663 CCTTGCCTCTTCCTATCTTCTGG - Intergenic
1156455819 18:37293310-37293332 CCTTGCCCCTTCCTAGCTTCTGG + Intronic
1156741762 18:40339385-40339407 CCTTGCCTATTTCTAGCTTATGG + Intergenic
1156917082 18:42474339-42474361 TCTTGCCTCTTTCTAGCTTCTGG + Intergenic
1157739452 18:50079651-50079673 ACCTGCCACTCTCCAGCTCCTGG + Intronic
1158048677 18:53188776-53188798 CCTTGCCTCTTCCTAGCTTCTGG + Intronic
1158077961 18:53553191-53553213 CCTTGCCTCTTCCTAGCTTCTGG - Intergenic
1158868498 18:61661227-61661249 CCTTGCCTCTTCCTACCTTCTGG - Intergenic
1158915999 18:62130085-62130107 CCTTGCCTCTACCTAGCTTCTGG - Intronic
1158973322 18:62688335-62688357 CCTTGCCTCTTCCTGGCTTCTGG + Intergenic
1159041308 18:63325469-63325491 TCTTGCCTCTCCCTAGCTTCTGG + Intergenic
1159128091 18:64248200-64248222 TCTTGCCTCTTTCTAGCATCTGG + Intergenic
1160415392 18:78706384-78706406 CCTGGGCTCTCTCTGGCTTCCGG - Intergenic
1160764534 19:801579-801601 CTTGGCCACTCTCCAGCTTGGGG + Intronic
1161981996 19:7634782-7634804 CCTTGCCCCTCCCTGGCTTTTGG + Intronic
1162005998 19:7779706-7779728 CCCTGCCTCTCCCTAGATTCTGG + Intergenic
1162148443 19:8628258-8628280 CCTTGCTTCTCCCTGGCTTCTGG + Intergenic
1162740497 19:12771056-12771078 CCCTGCCACTCTCCAGCCTGGGG + Exonic
1162882769 19:13672373-13672395 CTTTGCCACTTCCTGGCTTCTGG - Intergenic
1163055471 19:14714441-14714463 CCTTGCCCCTCCCTGGCTTCTGG - Intronic
1163638409 19:18448542-18448564 CCTTGCCTCTCACTTCCTTCTGG - Intronic
1163739720 19:19003966-19003988 CCTTGCTACCCTGTGGCTTCTGG - Intronic
1165741331 19:38206876-38206898 CCTTGCCTCTCTCTATCCTCAGG - Exonic
1166987200 19:46668076-46668098 CCTTGCCTCTTCCCAGCTTCTGG + Intergenic
1168082222 19:54018489-54018511 CATTGCCACTATCTAGTGTCAGG - Intergenic
925529707 2:4845723-4845745 CCTTGCCCCTTGCTAGCTTCTGG - Intergenic
926028253 2:9563567-9563589 CCTTGCCTCTTCCTGGCTTCTGG - Intergenic
926705618 2:15835397-15835419 CCTTGCCTCTCCCCAGCTTCTGG + Intergenic
926722196 2:15969086-15969108 CCCTGCCTCTTTCTAGCTTTGGG + Intergenic
926772974 2:16394315-16394337 CCTTGCCCCTCTCTGGGTTCTGG + Intergenic
927098851 2:19771318-19771340 CCATGCCTCTCCCCAGCTTCTGG + Intergenic
927399670 2:22696484-22696506 CCTTGCCTCTTCCTAGATTCTGG - Intergenic
928204313 2:29273170-29273192 TCTTGCCATTCTGGAGCTTCTGG - Intronic
928224835 2:29439801-29439823 CCTTACCACTTCCTAGCTTCTGG - Intronic
928252092 2:29689919-29689941 CCATGCCCCACTCCAGCTTCTGG - Intronic
928653245 2:33423596-33423618 CCTTGCCTCTTTCTAACTTATGG + Intergenic
929875255 2:45791429-45791451 CCTTGCCCCCTTCTAGTTTCAGG + Intronic
930067545 2:47339340-47339362 CCTTGCCTCTTTCTTACTTCTGG - Intergenic
930274042 2:49290786-49290808 CCTTGCCTCTTACTAGCATCTGG - Intergenic
930633902 2:53784571-53784593 CCTTGCCTCTTCCTAGCTTGTGG + Intronic
931902670 2:66806862-66806884 CCTTGCCTCTTCCTAGCTTCTGG - Intergenic
934926829 2:98388129-98388151 CCTTGCCACGCCCTCTCTTCAGG + Intronic
935300158 2:101686807-101686829 CCTTGCCTCTTCCTGGCTTCTGG - Intergenic
935655591 2:105420219-105420241 CCATGCCTCTCCCTAGCTGCTGG + Intronic
935671675 2:105561657-105561679 CCTTCCTACTCTCCAGCATCAGG - Intergenic
935673314 2:105573554-105573576 CGTTGCCCCTCTCTAGCTCCTGG - Intergenic
935714267 2:105926225-105926247 CCTTGCCGCATTCTAGTTTCAGG - Intergenic
936385690 2:112026694-112026716 CTTTGCCAGCCTCCAGCTTCCGG + Intronic
936519718 2:113204101-113204123 GCTTGCATCTTTCTAGCTTCTGG + Intronic
937515374 2:122649212-122649234 TCTTGCCACTCCCTGGCTGCTGG + Intergenic
938418855 2:131127265-131127287 TCTTGCCTCTTCCTAGCTTCTGG + Intronic
939283858 2:140102389-140102411 CCTGGCCTCTTTCTATCTTCTGG - Intergenic
939475541 2:142681633-142681655 TCTTTCCTCTTTCTAGCTTCTGG - Intergenic
940074975 2:149731621-149731643 CCTTGCTTCTTCCTAGCTTCTGG + Intergenic
940179343 2:150914547-150914569 CCTTGCCTCTCTCTGGCTTCTGG + Intergenic
940443762 2:153752557-153752579 TCATGCCACTCTCTCTCTTCTGG + Intergenic
940779141 2:157914800-157914822 CCTTGCCTCTTCTTAGCTTCTGG + Intronic
940791868 2:158037567-158037589 CCATGCCTCTCTTTAGCTTCTGG + Intronic
940793883 2:158056577-158056599 CCTTTTCACTTCCTAGCTTCTGG + Intronic
941002187 2:160213764-160213786 CCCTCCCCCTCCCTAGCTTCCGG + Intronic
941043053 2:160644856-160644878 CCTTGCCTCTTCCTAGCTTCTGG - Intergenic
941688110 2:168468430-168468452 CCCTGCCACTTGCTAGCTACTGG + Intronic
942385484 2:175438545-175438567 CCTTGCCTCTTCCTAGCTTCTGG + Intergenic
944930128 2:204508806-204508828 CTCTGCCACTCTGTAACTTCGGG + Intergenic
945459049 2:210083159-210083181 CTTTGCCTCTTCCTAGCTTCTGG - Intronic
945620335 2:212127848-212127870 CCTTGCCACTCTCTAGCTTCTGG - Intronic
946184306 2:217970139-217970161 CCTTGCCTCTTTCCAGCTTCTGG - Intronic
946493322 2:220171063-220171085 CCTTGCCTCTTCCTAGCCTCTGG - Intergenic
947518725 2:230828430-230828452 CCTGGCCACGCCCTAGCTCCGGG - Intergenic
947803254 2:232945591-232945613 CCCCGCCTCTCTCTGGCTTCTGG - Intronic
947953623 2:234169329-234169351 CCTGGCCTCTTTCCAGCTTCTGG + Intergenic
948182191 2:235990744-235990766 CCTTGCCACTCTCTATCCAGAGG - Intronic
948390206 2:237606461-237606483 CCTGGCCTCTCTCTGGCCTCTGG - Intergenic
1169396368 20:5234001-5234023 CCTCCCCTCTCTCTAGCTTCTGG - Intergenic
1169490851 20:6070395-6070417 CCTTGCCTCTTCCTGGCTTCTGG + Intergenic
1169792986 20:9431148-9431170 CCTTGCCTCTTTCTGGCTTCTGG + Intronic
1170091797 20:12597251-12597273 CATTGCCACTTCCTAGCATCTGG + Intergenic
1171097236 20:22343683-22343705 CCATGCCAGTCCCTAGGTTCCGG - Intergenic
1171195436 20:23194042-23194064 ACTTGTCATTCACTAGCTTCTGG + Intergenic
1171534819 20:25877891-25877913 CGATGACACTCTCTTGCTTCTGG + Intergenic
1172307054 20:33888311-33888333 CCTTGCCTCTGCCTAGCTCCTGG + Intergenic
1174435773 20:50505755-50505777 CCTTTGCATTCTCCAGCTTCTGG - Intergenic
1174455952 20:50648998-50649020 CCTTGCCTCTTCCTAGCTTCTGG + Intronic
1174701534 20:52614293-52614315 CCTTGCCACCCTCAACTTTCTGG - Intergenic
1175194518 20:57233635-57233657 CCTTGCCTCTCCCTAACATCTGG + Intronic
1175349968 20:58310275-58310297 CCTTGCCTCTCTATTGCATCTGG + Intronic
1175501683 20:59455338-59455360 ACGTGCCACTGTCTAGCTTGGGG + Intergenic
1175564501 20:59962392-59962414 CCTGGCCTCTCCCCAGCTTCTGG + Intronic
1176130223 20:63493690-63493712 CCTCGCCCCACCCTAGCTTCTGG + Intronic
1176231933 20:64037241-64037263 CCTTCCTCCTCTATAGCTTCTGG + Intronic
1176430180 21:6570748-6570770 CCTTTCCACCCTCCAGCTTAGGG + Intergenic
1177208909 21:18045505-18045527 CCTTGCCTCTTCCTAGCTTCTGG - Intronic
1177543961 21:22532875-22532897 CCCTGCCTTTTTCTAGCTTCTGG - Intergenic
1177821308 21:26033659-26033681 CCTTGCCACTCTTCTGCTTCAGG - Intronic
1178114363 21:29402065-29402087 CCTTGCCTCTTCCTAACTTCTGG - Intronic
1178211286 21:30535841-30535863 CCTTGCCTCTTTCTAGCTTCTGG - Intergenic
1178352233 21:31880444-31880466 CCTTGCCTCTTACTAGCTTCCGG + Intronic
1178446159 21:32645555-32645577 GTTTTCCAATCTCTAGCTTCTGG - Intronic
1178562535 21:33652393-33652415 CCTTGCCAGTTTGTAGCCTCAGG + Intronic
1178750593 21:35299078-35299100 CCTTGCCTCTTCCTAGCTCCTGG - Intronic
1178818194 21:35950782-35950804 CCATGCCTCTTTCTAGCTTCTGG + Intronic
1179455134 21:41494185-41494207 CCTTTCCACTCTCTTCCTGCTGG - Intronic
1179487383 21:41719168-41719190 CTGTGCCCCTCTCCAGCTTCTGG + Intergenic
1179705574 21:43178210-43178232 CCTTTCCACCCTCCAGCTTAGGG + Intergenic
1180861556 22:19085604-19085626 CCTTCCCACTCACTCCCTTCTGG - Intronic
1182151291 22:28028934-28028956 CCTTGCCACTCACAAGCTGTAGG - Intronic
1182471333 22:30550125-30550147 CCTTGCCTCTTCCTAGCTTCTGG + Intergenic
1182508697 22:30803397-30803419 CCTTGTGACTGTCTGGCTTCTGG - Intronic
1183667442 22:39253866-39253888 CCTTTCCTCTCTCCAGCTGCAGG - Intergenic
1184471936 22:44701270-44701292 CCTTCCCAGTCCCCAGCTTCTGG - Intronic
1184589705 22:45473743-45473765 CCTCCCCACTCCCCAGCTTCCGG + Intergenic
1185075915 22:48682213-48682235 CCCTGCCACTCTCCAGCCTCAGG + Intronic
1185094288 22:48797847-48797869 CCAGGCCTCTCTCCAGCTTCTGG + Intronic
1185206591 22:49542190-49542212 GCTGGCCTCTCTCTAGCTTTAGG + Intronic
1185383311 22:50520333-50520355 CCTTGACTCTCTCTAGGCTCAGG + Intronic
949369980 3:3324403-3324425 CCTTGCCTCTCCCTAGCTTCTGG - Intergenic
949389318 3:3541757-3541779 CCTTGTCTCTTCCTAGCTTCTGG + Intergenic
949558025 3:5175723-5175745 CCTTGCCTCTCTCTAGCTTGTGG + Intronic
949767351 3:7541928-7541950 CCTTGCCTCTTCCTAGCTTTTGG + Intronic
949996715 3:9623081-9623103 TCTTGCCTCTCCCTGGCTTCAGG - Intergenic
950736128 3:15009843-15009865 CCTTGCCTCTTCCTACCTTCTGG + Intronic
951220696 3:20066105-20066127 CCTTGCCTCTTCCTAGCATCTGG + Intronic
951661353 3:25070065-25070087 CCTTGGCTCTTCCTAGCTTCTGG + Intergenic
951825470 3:26863632-26863654 TCTTCCCATTCTCTAGTTTCTGG + Intergenic
953051168 3:39345294-39345316 CCTTGACTCTTCCTAGCTTCTGG - Intergenic
953457218 3:43052886-43052908 ACTTCCCACTCACTTGCTTCCGG - Intronic
954600107 3:51860901-51860923 CCATATCACTCTCTAGCGTCTGG - Intergenic
955064954 3:55526164-55526186 CCTTGCCTCTTCCGAGCTTCTGG - Intronic
955499478 3:59569958-59569980 CCTTGCCTCTTCCTGGCTTCTGG + Intergenic
955692412 3:61603711-61603733 CCTTGCCACTTTGTAGCTTCTGG + Intronic
956116315 3:65922526-65922548 CCTTGTCTCTTTCTAGCTTCTGG - Intronic
956319845 3:67984627-67984649 CCTTTCCTCTTCCTAGCTTCTGG + Intergenic
956964591 3:74444003-74444025 CCTTGCCTTTTTCTAGCTTCTGG + Intronic
957429618 3:80085146-80085168 CCAAGCCTCTTTCTAGCTTCTGG - Intergenic
958024728 3:88037505-88037527 CCTTGCCTCTTCCTAGCTTCTGG - Intergenic
958043750 3:88257780-88257802 CCTTGCCCCTTTCTGGCTTCTGG + Intergenic
959096901 3:101966055-101966077 CACAGCCACTCACTAGCTTCAGG - Intergenic
959150097 3:102597867-102597889 GCTTGCCTCTTCCTAGCTTCTGG + Intergenic
959379780 3:105628186-105628208 CCTTGCCTCTTCCTAGCTTCTGG + Intergenic
959620985 3:108398305-108398327 CCTTGCCCCTTCCTAGTTTCTGG - Intronic
959873459 3:111354592-111354614 CTTTGCCTCTTTCTAGCTTCTGG - Intronic
959968929 3:112386302-112386324 CCTTGCCTCTTCCTAGCTTCTGG - Intergenic
959991828 3:112639209-112639231 ACTTGCCCTTCTCCAGCTTCAGG + Exonic
961081101 3:124029066-124029088 CTTTACCTCTTTCTAGCTTCTGG + Intergenic
961821017 3:129575671-129575693 CCCTGCCTCTCTCTACCTTCTGG - Intronic
962360140 3:134733709-134733731 CCTTACCTCCTTCTAGCTTCTGG - Intronic
962686833 3:137856056-137856078 CCTTGCCTCTTTCTGGCTTCTGG + Intergenic
963372525 3:144419432-144419454 CCATTCCCCTTTCTAGCTTCTGG + Intergenic
963485887 3:145934043-145934065 CCTTGCCTTTTCCTAGCTTCTGG + Intergenic
964221009 3:154344735-154344757 TCTTGCCTCTCCCTAGCTTCTGG - Intronic
965002887 3:162980512-162980534 CCTTGCCTCTCCCTAGCTTCTGG + Intergenic
965509025 3:169547848-169547870 CCTTGGCATTCTCTGGCTTGTGG - Intronic
966137253 3:176712887-176712909 CCTGACCACTCTGCAGCTTCAGG - Intergenic
966216622 3:177509688-177509710 CCTTTCCACCCTTTGGCTTCTGG - Intergenic
967637194 3:191816586-191816608 CTTTTCCCCTTTCTAGCTTCTGG - Intergenic
967660922 3:192108901-192108923 CCTTGCTTCTTCCTAGCTTCTGG + Intergenic
967726027 3:192863187-192863209 CCTTGCCTCTTCCTAGCCTCTGG - Intronic
967835545 3:193959507-193959529 CCTTGCCTCTTCCTAGCTTCTGG - Intergenic
968844321 4:3031504-3031526 CCCGGCCTCTCTCTAGCTGCTGG - Intronic
969213740 4:5707618-5707640 CACTGCCACTCCCTGGCTTCAGG - Intronic
969297135 4:6276835-6276857 CCTCGCCTCTGTCCAGCTTCTGG + Intronic
969359165 4:6650744-6650766 CCTTGCTTCTCCCTGGCTTCTGG + Intergenic
969437624 4:7197841-7197863 CCCTGCCACTCTCTGGCTCTGGG + Intronic
970239121 4:13989665-13989687 CCTTGCCTCTTTCTAGCTTCCGG + Intergenic
970314780 4:14818816-14818838 CCTTGTCTCTTTCTAGCTTCTGG - Intergenic
970638879 4:18041284-18041306 CCTTGCCTCTTCCTAGCTTCTGG + Intergenic
970789174 4:19836237-19836259 CCTTACCCCTATCCAGCTTCAGG - Intergenic
970892488 4:21063121-21063143 CCCTGCCTCTCCCTAGCATCTGG - Intronic
971259921 4:25046782-25046804 CCATGCCTCTCCCTAGCTTCTGG + Intergenic
971267183 4:25105989-25106011 CCATGCCCCTCCCTAGCTCCTGG - Intergenic
971364431 4:25966252-25966274 CCTTGCCTCTTCCTACCTTCTGG + Intergenic
971451683 4:26806881-26806903 CCTTGCCTCTTCCTAGCTTCTGG - Intergenic
972147524 4:36046396-36046418 CCTGGCCAGTCTCAAGCTCCTGG + Intronic
972369283 4:38407176-38407198 CCTTGCCTCTTGCTAGCTTCTGG - Intergenic
972649556 4:41003638-41003660 CCTTGCCTCTTCCAAGCTTCTGG - Intronic
974539191 4:63211472-63211494 CCCTGCCTCTTCCTAGCTTCTGG + Intergenic
975261951 4:72313336-72313358 CCTGGACACTCTCTTGTTTCTGG + Intronic
976046673 4:80956557-80956579 CATTTCCCCTCTCTAGCCTCTGG + Intronic
976517966 4:85993534-85993556 CAAGGCCACTCTTTAGCTTCCGG - Intronic
977110849 4:92952947-92952969 CTTTGCCACTTCCTAGCTTCTGG + Intronic
977379065 4:96247244-96247266 CCTTGCCTCTTCCTAACTTCTGG + Intergenic
977551697 4:98449688-98449710 CATTGCCATGCTCTAGCTCCCGG - Intergenic
978326173 4:107559299-107559321 CCATGCCTCTTCCTAGCTTCTGG - Intergenic
979031302 4:115651635-115651657 TCTTGCCTCTTTCTAGCTTCTGG + Intergenic
979312418 4:119219309-119219331 CCTTGCCCCTTCCTAACTTCTGG + Intronic
980738070 4:136917107-136917129 CAATTCCTCTCTCTAGCTTCTGG + Intergenic
981102853 4:140849603-140849625 CCGTGCCTCTCCCTAGCTTCTGG + Intergenic
981956103 4:150476440-150476462 CCCAGGCACTCTCTAGGTTCTGG + Intronic
982372939 4:154654368-154654390 CCTTGCCCCTTCCCAGCTTCTGG - Intronic
982521417 4:156421176-156421198 ACTACCCACTCTTTAGCTTCAGG - Intergenic
982522844 4:156440975-156440997 GCTTCTCACTCTCTGGCTTCAGG - Intergenic
982659279 4:158187683-158187705 CCTTGCCTTTCCCTAGCTTCTGG - Intergenic
983078472 4:163355172-163355194 CCTTGCCCCTTTCTGGCTTCTGG + Intergenic
985790420 5:1923942-1923964 CCGTGCCTCACTCTGGCTTCCGG - Intergenic
986548310 5:8924119-8924141 CCTTTCCAGGCTCTAGCTTCTGG + Intergenic
986620101 5:9663939-9663961 CCATGCCTCTGCCTAGCTTCTGG - Intronic
986849413 5:11793620-11793642 CCAGGCCTCTCTCCAGCTTCTGG - Intronic
987549576 5:19361198-19361220 CCCTGCCTCTCCCCAGCTTCTGG + Intergenic
988011892 5:25499212-25499234 CATTGCTACTCTCTTTCTTCAGG - Intergenic
988355829 5:30172897-30172919 CCTTGCCTGTTCCTAGCTTCGGG + Intergenic
988594122 5:32575359-32575381 CCTTGCCTCTGCCTAGTTTCTGG + Intronic
989268438 5:39504244-39504266 CCATGTCTCTCTCTAGCTTCTGG + Intergenic
989962557 5:50433861-50433883 CCTTGCCTCTGCCTAGCATCTGG + Intronic
990342214 5:54834693-54834715 CATTGCCAACCTCTGGCTTCTGG + Intergenic
992263316 5:74992324-74992346 CCCTGCCTCTTCCTAGCTTCTGG + Intergenic
992475309 5:77096334-77096356 CCTTACCATTCCCTAGCTTCTGG + Intergenic
992887055 5:81169429-81169451 CCTTGCCTCCTCCTAGCTTCTGG + Intronic
993106468 5:83606125-83606147 CGTTGCCTCTTCCTAGCTTCTGG - Intergenic
993567164 5:89490051-89490073 CCTTGGCTCTTTCTAGCTTCTGG - Intergenic
994376362 5:99019390-99019412 CCTTGCCTCTTCCTAGCTTCTGG + Intergenic
995178063 5:109201432-109201454 CCTTCCCCATCTCTAGCTCCTGG - Intergenic
995269014 5:110199763-110199785 TCTTGCCTCTTCCTAGCTTCTGG - Intergenic
995746248 5:115407042-115407064 CCTTGACACCCTCCTGCTTCTGG + Intergenic
996272817 5:121628906-121628928 TCTTGCCTCTTTCTAGCTTCTGG + Intergenic
996399016 5:123039710-123039732 CCTTGCCTCTTCCTAGCTTCTGG - Intergenic
996405204 5:123097439-123097461 CTCTGCCACTTTCTAGCTTCTGG + Intronic
996424232 5:123295160-123295182 CCTTCCTACTCTCTACCTTCTGG - Intergenic
996506589 5:124275109-124275131 CCTTCCCTCTTTGTAGCTTCTGG + Intergenic
997190742 5:131932573-131932595 CTTTTCCACTCTCTGGCTTTGGG - Intronic
998748633 5:145291446-145291468 CCTTGCCTCTTTCTAGCTCCTGG - Intergenic
998909041 5:146938039-146938061 CCTTTCCACCCACAAGCTTCTGG - Intronic
998911256 5:146962792-146962814 CTCTGCCACTATCTAGCTTTGGG - Intronic
999378277 5:151101892-151101914 TCTGGCCACTCTCTTGCGTCAGG + Intronic
999632278 5:153583411-153583433 CCTTGACTCTTCCTAGCTTCTGG + Intronic
999893919 5:156008252-156008274 ACTTTCCTCTTTCTAGCTTCTGG + Intronic
999977848 5:156929615-156929637 CCTTGCCTCTTCCTAGCTTCTGG - Intronic
1000209441 5:159096749-159096771 GCTTGCCTCTCTCTAGCTCTGGG + Intronic
1000955968 5:167543732-167543754 CCTTGCCCCTTTCTAGCTTACGG + Intronic
1000991296 5:167914730-167914752 CCTTGTCTCTCCCTAGCTTCTGG + Intronic
1002282285 5:178138314-178138336 CCCTGTCACTCAGTAGCTTCGGG - Intronic
1003667186 6:8122228-8122250 CCTTTCCTTCCTCTAGCTTCTGG + Intergenic
1004523170 6:16381374-16381396 CCAGGTCACTCCCTAGCTTCTGG - Intronic
1004603605 6:17173957-17173979 CTTTGCCTCTTCCTAGCTTCTGG - Intergenic
1005617123 6:27584371-27584393 CCTTGCCTCTTCCTAGCTTCTGG + Intergenic
1005810746 6:29513954-29513976 CCTTGCCTCTTCCTAACTTCTGG - Intergenic
1006307887 6:33235621-33235643 CCATGACACTCTGTACCTTCTGG - Intergenic
1006339153 6:33436938-33436960 CCTTGCCTCTTCCTAGCTTCCGG + Intronic
1006721915 6:36160490-36160512 CCTTGCCCTTTCCTAGCTTCTGG + Intergenic
1007466893 6:42058834-42058856 CCTTGCCTCTTCCTAGCTTCTGG + Intronic
1007650209 6:43414714-43414736 CGTTCCCTCTCTCTAGCTCCTGG - Intergenic
1007922859 6:45626474-45626496 CCTGCCCACTCTCTGCCTTCTGG - Intronic
1008028198 6:46662963-46662985 CCTTGCTACTCTCTTTCTGCAGG - Intronic
1008111092 6:47495373-47495395 CCATGCCCCTATCTGGCTTCTGG - Intronic
1008731062 6:54483137-54483159 CCCTGCCTCTTTCTAGCATCTGG - Intergenic
1008960789 6:57263380-57263402 CCTTGCCCCTTCCCAGCTTCTGG + Intergenic
1009824155 6:68845363-68845385 CCATGCCTCTCTCCAGGTTCTGG - Intronic
1010025640 6:71212966-71212988 CCAGGCCTCTCCCTAGCTTCTGG - Intergenic
1010154909 6:72781224-72781246 CCTTGGCATTCTCTGGCTTGTGG - Intronic
1010154921 6:72781261-72781283 CCTAGCCCCTTCCTAGCTTCTGG - Intronic
1010977207 6:82329376-82329398 CCTTGCCTCTTCCTAGCTTCTGG - Intergenic
1011078267 6:83461410-83461432 CCTTGCCTCTTCCTTGCTTCTGG - Intergenic
1011684109 6:89810569-89810591 CCTTGCCTCTTCCTAGCTTCTGG + Intronic
1011990582 6:93510657-93510679 GCATGCCACCCTCTAGCATCTGG + Intergenic
1012149244 6:95725450-95725472 CCTTGCCGCTACCTAGTTTCTGG + Intergenic
1013185994 6:107758720-107758742 TCTTGCCTCTTCCTAGCTTCTGG - Intronic
1014754758 6:125290707-125290729 CCTTGCCTCTTTCTAGCTTTTGG - Intronic
1015157960 6:130118516-130118538 CCTTTCCACTCTCTAGCTAAAGG + Intronic
1015286620 6:131492564-131492586 TCTTGCCTCTCTATAGCTTCTGG - Intergenic
1015337182 6:132053235-132053257 CCTCGCCTCTTCCTAGCTTCTGG - Intergenic
1015639556 6:135316430-135316452 CCTTGCCACTCTATTGATACCGG + Intronic
1015859195 6:137657498-137657520 CCTGGTCACTCTCTAGCTTCTGG + Intergenic
1016580903 6:145628640-145628662 ACTTGGCATTCTCTAGCTACAGG + Intronic
1016822652 6:148361124-148361146 CCTCGCCACTTCCTAGCTGCTGG - Intronic
1017584729 6:155908378-155908400 ATTTGCAACTCTCTAGCCTCTGG - Intergenic
1018155337 6:160980357-160980379 CCTTCCTAGTCTCTAGCATCTGG + Intergenic
1018297813 6:162368001-162368023 CCTTCCCTCTCTCCTGCTTCTGG - Intronic
1019307095 7:340822-340844 CCTTGCCACTCCTTGTCTTCTGG + Intergenic
1019657240 7:2202396-2202418 ACTCGCCACTCTCCAGCTCCAGG + Intronic
1019838316 7:3413297-3413319 CCCTGCCCCTCTTTAGCTTCAGG - Intronic
1019938824 7:4273460-4273482 CCTTGCCTCTCTCTGTCTTAGGG + Intergenic
1020008853 7:4797489-4797511 CCTTGCCACTGTCTTTCCTCTGG + Intronic
1020596713 7:10215332-10215354 CCTTGCCTTTTTTTAGCTTCTGG + Intergenic
1020847702 7:13307806-13307828 CCCTGCCTCTTCCTAGCTTCAGG - Intergenic
1022407025 7:30099999-30100021 CCTTACCTCTTCCTAGCTTCCGG + Intronic
1022447819 7:30484254-30484276 CCTTACCATTCTCAATCTTCAGG + Intergenic
1022621175 7:31986201-31986223 CCTTGCCTCCTCCTAGCTTCTGG + Intronic
1022778809 7:33557075-33557097 CCTTTCCTCTCCCTGGCTTCAGG + Intronic
1022898424 7:34776858-34776880 CCTTTCCAAGCTCTAGCTCCTGG - Intronic
1023639163 7:42240504-42240526 CCTTGCCTCTTACTGGCTTCTGG + Intergenic
1025912063 7:65837251-65837273 CCAGGCCAATCTCTAGCTCCCGG + Intergenic
1025939297 7:66062405-66062427 CTCTGCCTTTCTCTAGCTTCTGG - Intergenic
1026365882 7:69647834-69647856 CTTTGCCTCTTCCTAGCTTCTGG + Intronic
1028555143 7:92115491-92115513 CCTTGCATCTTCCTAGCTTCTGG - Intronic
1029602035 7:101571974-101571996 CCTTGCTTCTTCCTAGCTTCTGG - Intergenic
1030412856 7:109203592-109203614 CCTTGCCTCTTCCTAGCTTCTGG - Intergenic
1030438090 7:109551643-109551665 CCTTGCCTCCATCTAGCTCCGGG - Intergenic
1031023171 7:116650389-116650411 CCTTGCCTTTTCCTAGCTTCTGG + Intergenic
1031096840 7:117430288-117430310 CCTTGCCTCTTCCCAGCTTCTGG + Intergenic
1031311101 7:120197919-120197941 CCTTTCCTCTTTTTAGCTTCTGG - Intergenic
1031452313 7:121937284-121937306 CCTTGCCTCTCCCTTGATTCTGG - Intronic
1031553433 7:123143022-123143044 CCTTTCCAGGCTCTAGCTTTAGG - Intronic
1032614260 7:133449244-133449266 CCTTGCCTTTTCCTAGCTTCTGG - Intronic
1032787897 7:135215428-135215450 CCATGGCACTCTCTGGTTTCTGG - Intergenic
1032864929 7:135915659-135915681 CTTTGCCTCTTCCTAGCTTCTGG + Intergenic
1033310042 7:140254705-140254727 CCTTGCCCCTTCCTAGCCTCTGG - Intergenic
1033412118 7:141127567-141127589 CCATGCCTCTCTCCAGTTTCTGG - Intronic
1033837422 7:145332200-145332222 CCATGCCTCTCTCCTGCTTCTGG + Intergenic
1034295933 7:149972520-149972542 CCCTGCCCCTCTCCAGCCTCTGG + Intergenic
1034810118 7:154124382-154124404 CCCTGCCCCTCTCCAGCCTCTGG - Intronic
1035279859 7:157770989-157771011 CCCTGCCAGTTTCTGGCTTCTGG + Intronic
1036083148 8:5580277-5580299 CCTTGCCTCTCCCCAGCGTCTGG - Intergenic
1036136317 8:6164882-6164904 ACTTGCCACTGACTAGCTTTGGG + Intergenic
1036721283 8:11177727-11177749 CCATGCCCCTTCCTAGCTTCTGG - Intronic
1037381047 8:18285572-18285594 CCATGCCTCTCCCTACCTTCTGG + Intergenic
1037532764 8:19793913-19793935 ACTTGCAGCTCTCTAACTTCAGG - Intergenic
1038009087 8:23459615-23459637 CTTTGCCTCTTCCTAGCTTCTGG + Intergenic
1038368529 8:26962788-26962810 CCTTCCCACTCTCTCCCCTCAGG + Intergenic
1038869412 8:31478242-31478264 CATTGCCTCTTTCTAGTTTCTGG + Intergenic
1039381907 8:37093317-37093339 CCTTGGCTCTTCCTAGCTTCTGG + Intergenic
1039426329 8:37489389-37489411 CCTGTCCACTCTCTAGCTAAGGG + Intergenic
1039815683 8:41092602-41092624 CCTTGCCTTCCTCTAGGTTCAGG + Intergenic
1041139179 8:54796659-54796681 CCTTGCCTCTTTCTAGCTCCTGG - Intergenic
1042029254 8:64456900-64456922 CCTTGCCTCTTCCTAGCTTCTGG + Intergenic
1042115094 8:65422675-65422697 ACTTGCCTCTTTCTAGCTTTTGG - Intergenic
1042315036 8:67417221-67417243 CCTTGCCTCTTCCTAGCTTCTGG - Intergenic
1042317581 8:67440184-67440206 CCTTGCCTCTTCCTAGCTTTGGG + Intronic
1043924804 8:86024852-86024874 CCTTGCCTCTTCCTAGCTTCTGG - Intronic
1044016336 8:87051996-87052018 CCTTGACCCTATCTAGCTTGTGG - Intronic
1044589437 8:93899446-93899468 CCTTGCCTCTTCCTAGCTGCTGG - Intronic
1044610672 8:94088830-94088852 CCTTGCCTCTTCCTAGCTTCTGG + Intergenic
1044688958 8:94857619-94857641 CCTTGCGTCTTCCTAGCTTCTGG + Intronic
1044773337 8:95660913-95660935 TCTTGCCTCTTCCTAGCTTCTGG - Intergenic
1044959308 8:97515002-97515024 CCTTGCCTCTTCCTTGCTTCTGG + Intergenic
1046194319 8:110839005-110839027 CCTTGCCTCTTTCTAGCTTCTGG - Intergenic
1047047740 8:121073687-121073709 CCTTGCCTCTTCCTATCTTCTGG - Intergenic
1047284203 8:123472499-123472521 CCTTGCCTATCCCTAGTTTCTGG + Intergenic
1047388023 8:124427421-124427443 CCTTGCCTCTTCCTAGATTCTGG + Intergenic
1047643299 8:126843834-126843856 CTTAACTACTCTCTAGCTTCTGG + Intergenic
1047659640 8:127019137-127019159 CCTTGGCAGTTTCCAGCTTCTGG - Intergenic
1047669361 8:127127786-127127808 CCTTGCCTCTTTTTAGTTTCTGG - Intergenic
1047749613 8:127870318-127870340 CCTTGCCTCTTTCTGGCATCTGG - Intergenic
1047779979 8:128103122-128103144 CCTTGCCTCTTCCTAGTTTCTGG - Intergenic
1047941657 8:129832413-129832435 CCTTGCCTCTTCCTGGCTTCTGG - Intergenic
1047957047 8:129984183-129984205 CCCTGCCTCTCTCTGGCTGCAGG + Intronic
1048048353 8:130794114-130794136 CCTTGCCTCTTCCCAGCTTCTGG - Intronic
1048176466 8:132156978-132157000 TCTTGCCTCTTCCTAGCTTCAGG - Intronic
1048217920 8:132513706-132513728 CCTTGCCTCTTCCTAGCTTCTGG - Intergenic
1050291706 9:4162058-4162080 CCTTGCCCCTTCCCAGCTTCTGG + Intronic
1051686617 9:19664825-19664847 CCTTGCCTCTTCCTAGCTTCTGG - Intronic
1051745715 9:20292977-20292999 CCTTGCCTCTTCCCAGCTTCTGG + Intergenic
1052127721 9:24798437-24798459 CCTTGCCTCTTCCTAACTTCTGG + Intergenic
1052226700 9:26097566-26097588 ACTTGCCACTCTGTATATTCAGG + Intergenic
1052361677 9:27567877-27567899 CCTTGCCTCTTCCTGGCTTCTGG - Intronic
1052921338 9:33972509-33972531 CTTTGTCTCTCTCTAACTTCAGG - Intronic
1053003392 9:34589931-34589953 CCTTGGCACGCTCTCGCTCCTGG + Intronic
1054741819 9:68813810-68813832 CCTTGCTACTTTTTAGCTTCTGG - Intronic
1055380235 9:75698747-75698769 CCTTGGCTCTTCCTAGCTTCAGG + Intergenic
1055710456 9:79055228-79055250 CCTTGCCTCTTCCTAGCTTCTGG - Intergenic
1055751709 9:79513855-79513877 CCTTGCCCCTCTCTTGCTTCTGG - Intergenic
1056343573 9:85665347-85665369 CCTTGCTTCTTCCTAGCTTCTGG - Intronic
1056879702 9:90379517-90379539 CCTTGCCTCCTCCTAGCTTCTGG - Intergenic
1057256272 9:93550127-93550149 CCTGGCCACTCTGCAGCTGCAGG - Intronic
1057329557 9:94100563-94100585 CTTTGCCATTTTCTAGCTTTTGG + Intronic
1057540280 9:95961381-95961403 CCTTGCCTCTTTCTAGCTTCTGG - Intronic
1057991051 9:99770010-99770032 CCTTGCCTCTTCCTAGCGTCTGG + Intergenic
1058553372 9:106139516-106139538 CCTTGCTTCTTCCTAGCTTCTGG - Intergenic
1058766021 9:108183487-108183509 CCTTGCCCCTTTCGAGCCTCTGG + Intergenic
1059263588 9:113004187-113004209 CTTTGCTTCTCCCTAGCTTCAGG - Intergenic
1059963778 9:119593365-119593387 CCTTGCCTCTTCCTAGATTCTGG - Intergenic
1060007984 9:120017239-120017261 CCTTGCCTCTCCCTAGCTTCCGG + Intergenic
1060923276 9:127437669-127437691 CCTTGCCTCTTTCTAGTTTCCGG + Intronic
1061077312 9:128349463-128349485 TCCTGCCACACCCTAGCTTCAGG - Intronic
1061351009 9:130064879-130064901 CCTTGCCTCTTTCAAGCTCCTGG - Intronic
1062283703 9:135763567-135763589 CCATGCCTCTCTCCAGCTTCTGG + Intronic
1203655773 Un_KI270752v1:22916-22938 CCTTGCCAATAACTAGCCTCTGG - Intergenic
1186317648 X:8387991-8388013 CCTTCACTCTCTCTTGCTTCCGG + Intergenic
1186399422 X:9243003-9243025 CCATGCCTCTCTCCAGCTTCTGG + Intergenic
1186747664 X:12586099-12586121 CTTTGCCACTAACTAGCATCTGG - Intronic
1186902175 X:14068461-14068483 CCTGGTCTCTTTCTAGCTTCTGG + Intergenic
1186961713 X:14743788-14743810 CCTTGCCTTTTCCTAGCTTCTGG + Intergenic
1187117669 X:16369880-16369902 CCTTGCGTCTTCCTAGCTTCTGG + Intergenic
1187548224 X:20274392-20274414 CCTTGCCACTTCCTAGCTTCTGG - Intergenic
1187928336 X:24271028-24271050 CTTTGCTTCTTTCTAGCTTCTGG + Intergenic
1188402011 X:29756999-29757021 CCTTGCCTCTTCTTAGCTTCTGG - Intronic
1188500560 X:30821164-30821186 TCTTCCCACTCCCCAGCTTCTGG - Intergenic
1189136733 X:38558413-38558435 CCTTGCCTCCTCCTAGCTTCTGG + Intronic
1189360777 X:40349207-40349229 CCTTGCCTCTTTCTAGTTTCTGG + Intergenic
1189739132 X:44100660-44100682 CCTAGCCACTCTCTACCACCTGG - Intergenic
1191123772 X:56932832-56932854 CCTTTCCAGGCTCTAGCTTCTGG + Intergenic
1192731099 X:73803433-73803455 CCTTACCATTCTCAATCTTCAGG - Intergenic
1193686497 X:84582734-84582756 CTTTGCCCCTTTCTAGCTTCTGG + Intergenic
1194562372 X:95438437-95438459 CCTTGCCTCTGCCTAGTTTCTGG - Intergenic
1196004963 X:110826127-110826149 CCTTGCCTCTTCCTAGCCTCCGG - Intergenic
1196711536 X:118768786-118768808 CTTTGCCTCTTCCTAGCTTCTGG - Intronic
1196963842 X:121033663-121033685 CCTTGTCTCTTTCTAGCTTCTGG - Intergenic
1197256672 X:124270675-124270697 CCTCTCCACTCTCTACCCTCTGG - Intronic
1197683441 X:129411638-129411660 CTTTGCCTCTCCTTAGCTTCTGG - Intergenic
1197820746 X:130538605-130538627 CCTTGCCCGTTTCTAGCTTCTGG + Intergenic
1198659274 X:138949344-138949366 CCTTGCCTCTTCTTAGCTTCTGG + Intronic
1199118460 X:144021095-144021117 CCTTGCCTCTCCTTAGCTTGCGG + Intergenic
1199726095 X:150582717-150582739 CCTTGCCTCTCCCTAGCTTCTGG - Intronic
1199791299 X:151157650-151157672 CCTTGCCTCTCCCTAGCTACTGG + Intergenic
1199903352 X:152199454-152199476 CCTTGCCTCTCCCTAGTTTCTGG - Intronic