ID: 945623622

View in Genome Browser
Species Human (GRCh38)
Location 2:212172564-212172586
Sequence GTATATGTGTATATACACCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 863
Summary {0: 1, 1: 2, 2: 17, 3: 170, 4: 673}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945623620_945623622 28 Left 945623620 2:212172513-212172535 CCACATTTCCATCAATTGCAGAT 0: 1
1: 0
2: 5
3: 21
4: 279
Right 945623622 2:212172564-212172586 GTATATGTGTATATACACCATGG 0: 1
1: 2
2: 17
3: 170
4: 673
945623619_945623622 29 Left 945623619 2:212172512-212172534 CCCACATTTCCATCAATTGCAGA 0: 1
1: 0
2: 5
3: 72
4: 1220
Right 945623622 2:212172564-212172586 GTATATGTGTATATACACCATGG 0: 1
1: 2
2: 17
3: 170
4: 673
945623621_945623622 20 Left 945623621 2:212172521-212172543 CCATCAATTGCAGATTAGATAAA 0: 1
1: 10
2: 107
3: 765
4: 3791
Right 945623622 2:212172564-212172586 GTATATGTGTATATACACCATGG 0: 1
1: 2
2: 17
3: 170
4: 673

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945623622 Original CRISPR GTATATGTGTATATACACCA TGG Intronic
900229645 1:1550200-1550222 ATATATATGTATATAAATCATGG + Intronic
900678445 1:3902869-3902891 GTGTGTGTGTGTGTACACCAGGG - Intergenic
906246785 1:44281763-44281785 GAATATGTGCATATACATGAAGG + Intronic
906281614 1:44558302-44558324 GTATATGCGTATGCACACCAAGG + Intronic
906990061 1:50728054-50728076 GGATATATGTATATACGCAAGGG - Intronic
907879352 1:58530894-58530916 GTATATAAGTAGATAAACCAAGG - Intronic
907957577 1:59245204-59245226 GTGTATGTGTGTATACACATAGG - Intergenic
908026698 1:59959679-59959701 ATGTATATGTATACACACCATGG + Intergenic
908268454 1:62400557-62400579 GTATATCTGTGTATGTACCATGG - Intergenic
908341286 1:63182318-63182340 ATATATGTGTATATACATACTGG - Intergenic
908891290 1:68850959-68850981 ATATATATATATATGCACCATGG - Intergenic
909170643 1:72289571-72289593 GTGTATGTGTATATATATAATGG - Intergenic
909371489 1:74887862-74887884 GTATATATATATATACACCATGG + Intergenic
909520124 1:76558372-76558394 GAAAATGTACATATACACCATGG + Intronic
909737742 1:78985974-78985996 GTATATGTGGATATAAAGAAGGG + Intronic
909855126 1:80520102-80520124 GTACAAGTGTATATAACCCAGGG + Intergenic
910148230 1:84108106-84108128 GAAAATGTACATATACACCATGG + Intronic
910949184 1:92627370-92627392 GTATATATGTATATATATGATGG - Intronic
911040360 1:93586411-93586433 GGAAATGTGTATATACACAGTGG - Intronic
911272005 1:95813185-95813207 GTAAATGTGTACATACATCTCGG - Intergenic
911317565 1:96373854-96373876 GTACATGTGTATATAACCTATGG + Intergenic
911703990 1:100989526-100989548 GTATTAGTGTATATAAACAAAGG - Intergenic
912075372 1:105868249-105868271 GAAAATGTGTATATACACGCAGG + Intergenic
914055896 1:144167131-144167153 GTATATATATATACACCCCAAGG + Intergenic
914691529 1:150032908-150032930 GTATATGTGTGAAGACACTAGGG - Intergenic
914697942 1:150102653-150102675 GAAAATGTACATATACACCATGG + Intronic
915078592 1:153334476-153334498 ATTTATATATATATACACCAAGG + Intronic
915773550 1:158456270-158456292 AAAAATGTATATATACACCATGG + Intergenic
915811240 1:158914006-158914028 ATATATATGTATATACAAAATGG + Intergenic
915925323 1:160013697-160013719 GAAAATGTATATATACACAATGG + Intergenic
916423435 1:164658570-164658592 ATATAAGTGTATACACAGCATGG + Intronic
916656477 1:166880635-166880657 GTGTGTGTGTGTATACACAATGG - Intergenic
916897402 1:169179588-169179610 GAAAATGTACATATACACCATGG + Intronic
917410840 1:174758648-174758670 ATATATTAATATATACACCATGG - Intronic
917604045 1:176607567-176607589 GAACATGTATATATACACGATGG - Intronic
918288027 1:183077769-183077791 ATATATATATATATACACAATGG - Intronic
918827421 1:189342603-189342625 ATATATGTGTATATATATTAAGG - Intergenic
919083831 1:192896824-192896846 ATACATATGTATATACACAATGG + Intergenic
919244001 1:194953621-194953643 ATATATATATATATATACCATGG + Intergenic
919629749 1:199948732-199948754 AAATGTGTATATATACACCATGG + Intergenic
920296193 1:204958608-204958630 GTCTATGTTGATGTACACCATGG + Intronic
920700247 1:208212603-208212625 GGATAGGTGTATTTATACCATGG + Intronic
921408044 1:214802812-214802834 GGAAATATTTATATACACCAAGG - Intergenic
921586048 1:216947567-216947589 GTACGTGAGTATTTACACCAAGG + Intronic
921788280 1:219259423-219259445 ATATATATGTATATATACCATGG + Intergenic
922094310 1:222429575-222429597 ATATATATATATATATACCATGG + Intergenic
922130986 1:222777993-222778015 GTATTTGTGTATATAAACATAGG - Intergenic
922137675 1:222847470-222847492 GTGTATGTGCATATACACACAGG + Intergenic
922138198 1:222853521-222853543 GAAAATGTATATATACACCACGG + Intergenic
922658462 1:227407206-227407228 GTATATATATATATATACAATGG + Intergenic
922910892 1:229216256-229216278 TTATAGCTGTATATACACCATGG + Intergenic
923085369 1:230699158-230699180 GAAAATGTAGATATACACCATGG - Intergenic
924269375 1:242316972-242316994 GAAAATGTGCATATACACCATGG - Intronic
924848565 1:247799512-247799534 GAATATGTATATATACATCATGG - Intergenic
924879693 1:248146648-248146670 ATATATATATATATACACCATGG - Intergenic
1063334768 10:5200961-5200983 GTATATATATATATACATCATGG - Intronic
1063518980 10:6723810-6723832 ATATATATATATACACACCATGG + Intergenic
1063748637 10:8916633-8916655 GAAAATGTAAATATACACCATGG + Intergenic
1063950538 10:11218421-11218443 GTGAATGTGTATATACACAGAGG - Intronic
1064798291 10:19039119-19039141 GAAAATGTACATATACACCATGG + Intergenic
1065364313 10:24920315-24920337 GTGTATATATATATATACCATGG + Intronic
1065640073 10:27772619-27772641 GAAAATGTATATATACACCATGG - Intergenic
1065675597 10:28170162-28170184 ATATATATGTATATACATAAAGG - Intronic
1065874737 10:29987292-29987314 ATATATGTATATATATACCATGG - Intergenic
1065928205 10:30455156-30455178 GTTTATATTTATAAACACCAAGG - Intronic
1065943996 10:30590588-30590610 GAAAATGTATATATAAACCATGG + Intergenic
1066173647 10:32879912-32879934 GAAAATGTACATATACACCATGG - Intronic
1066600409 10:37099844-37099866 GTATATATACATATACTCCATGG - Intergenic
1066651502 10:37660674-37660696 GTATATATGTATATGTACCATGG + Intergenic
1067035273 10:42911103-42911125 GTATATATGTATATATACCATGG + Intergenic
1067929813 10:50549324-50549346 GAAAATGTACATATACACCATGG + Intronic
1068168823 10:53366715-53366737 GTTTGTGTGTATATACAGAAGGG - Intergenic
1068386729 10:56338667-56338689 TGATATGTATATATACACCATGG - Intergenic
1068611187 10:59062119-59062141 GTGTGTGTGTGTGTACACCATGG - Intergenic
1068835659 10:61549852-61549874 GCATCTGTGTATATCTACCAAGG + Intergenic
1069661999 10:70129472-70129494 GTATATGTGTATACATACCGAGG - Intronic
1069998295 10:72356878-72356900 ATATATATATATATGCACCAAGG + Intergenic
1070060166 10:72974456-72974478 ATATATATATATATACACAATGG - Intergenic
1070220878 10:74442794-74442816 GTATATGTATATATAAACAGTGG + Intronic
1070531214 10:77339042-77339064 GTATCTGTGTTTATACATAAAGG - Intronic
1071022650 10:81076787-81076809 GGAAATGTACATATACACCACGG - Intergenic
1071210251 10:83333551-83333573 GTATCTGTCTGTCTACACCATGG - Intergenic
1071332963 10:84579078-84579100 ATATATGTGTATATATATGAGGG + Intergenic
1071667356 10:87572629-87572651 GAAAATGTATATATACACAAAGG + Intergenic
1071856703 10:89633128-89633150 ATATATATATATATACACCGTGG - Intronic
1071932045 10:90483479-90483501 ATATATATAAATATACACCATGG - Intergenic
1072644123 10:97238957-97238979 GTATTTGTGTATCTAAACAAAGG - Intronic
1073737626 10:106367957-106367979 GTGTGTGTGTATACACACCAAGG + Intergenic
1073877218 10:107938760-107938782 ATATATATATATATACACAATGG - Intergenic
1073877220 10:107938851-107938873 GTGTATATATATATACACCATGG - Intergenic
1073916478 10:108410272-108410294 GTATATATATATACATACCATGG - Intergenic
1074701210 10:116094318-116094340 ATATATATGTATATACACTCAGG - Intronic
1075500503 10:122969439-122969461 GAAAATGTACATATACACCATGG + Intronic
1075525361 10:123180410-123180432 GAAAATGTGTATACACACAATGG + Intergenic
1075935427 10:126337058-126337080 GAATATGTGTATATAAAACAGGG + Intronic
1077770380 11:5211737-5211759 GAACATGTACATATACACCATGG - Intergenic
1078113271 11:8418448-8418470 GAAAATGTACATATACACCATGG - Intronic
1078556833 11:12334813-12334835 GAAAATGTACATATACACCATGG - Intronic
1078872262 11:15358949-15358971 ATATGTGTGAATATACATCACGG + Intergenic
1078948754 11:16103657-16103679 GTATATATATATATACACCATGG + Intronic
1079437325 11:20470593-20470615 GTACATATACATATACACCATGG - Intronic
1079812833 11:25016511-25016533 ATATATATGTATATATACCATGG - Intronic
1079854077 11:25578345-25578367 GTTTATGTGTATAAACATTAGGG + Intergenic
1082627126 11:55499709-55499731 GGAAATGTATATATACAACATGG - Intergenic
1082772401 11:57218410-57218432 ATATATATATATACACACCATGG + Intergenic
1083022951 11:59525862-59525884 ATATATGTGTATAAACAATATGG + Intergenic
1083132646 11:60640165-60640187 AGATATGTATATATACACCATGG + Intergenic
1083377284 11:62234859-62234881 GTATATATATATATACACAATGG + Intergenic
1083538467 11:63493039-63493061 GGATATTTGTATATACTCCTAGG - Intergenic
1084079161 11:66808092-66808114 GTGTGTGTGCATATGCACCATGG - Intronic
1084796527 11:71509685-71509707 GAAAATGTGTATATACACAATGG + Intronic
1085849871 11:80107892-80107914 ATAAAAGTGTATATACAACAAGG - Intergenic
1085889977 11:80567055-80567077 GTATATATACATATACTCCATGG + Intergenic
1086170940 11:83835915-83835937 GTGTATGTGTATATACCATAGGG - Intronic
1086232434 11:84586224-84586246 GTTTCTGTTTATATACACTAAGG + Intronic
1086929679 11:92679158-92679180 GAAAATGTATATATACACAATGG - Intronic
1087105959 11:94407089-94407111 GTATATATATATATATACAATGG - Intergenic
1087206534 11:95401773-95401795 ATATATGTATACACACACCATGG - Intergenic
1087382042 11:97417671-97417693 GTATATATGTATATATAGTACGG + Intergenic
1087450551 11:98316350-98316372 ATATATATATATATGCACCAGGG + Intergenic
1087606061 11:100379682-100379704 GAAAATGTGTATAAACACAATGG + Intergenic
1088388601 11:109288774-109288796 GGATATATGTATATATACAAAGG - Intergenic
1088497999 11:110451716-110451738 GAAAATGTACATATACACCATGG + Intronic
1088540832 11:110911819-110911841 GTATATTTTTAGATCCACCAGGG + Intergenic
1088556601 11:111067673-111067695 GTATATGTATATATACACAATGG + Intergenic
1088880927 11:113972695-113972717 GTGTTTGTGTATATCCACGAGGG - Intergenic
1090184637 11:124728910-124728932 GTATATATGTATATATACATTGG + Intergenic
1090284005 11:125483115-125483137 AAGTATGTATATATACACCAGGG + Intronic
1090630468 11:128643060-128643082 GAAAATGTATATATACACCATGG + Intergenic
1091025058 11:132134700-132134722 ATATATATATATATATACCATGG - Intronic
1092029285 12:5270507-5270529 GTATATGTGTATATGAACAGAGG + Intergenic
1092311640 12:7362070-7362092 ATGTATGTGTATATATACAATGG - Intronic
1092316594 12:7422773-7422795 GTATATATATATATACACACAGG + Intronic
1093001566 12:14002359-14002381 ATATATGTGTATATATATGATGG - Intergenic
1093030305 12:14282426-14282448 AAATGTGTATATATACACCATGG + Intergenic
1093097765 12:14991542-14991564 GAAAATGTACATATACACCATGG + Intergenic
1093157514 12:15704943-15704965 GTGTGTGTGTATATACACACAGG - Intronic
1093408744 12:18839522-18839544 ATATATATATATATACACAATGG - Intergenic
1093440877 12:19194306-19194328 GTAAATGTGCATATACACAGTGG - Intronic
1093476319 12:19558682-19558704 GTGTATATATATATACACAATGG - Intronic
1093488051 12:19674108-19674130 GTCTGTGTGTATATATACCAAGG + Intronic
1093619510 12:21271676-21271698 ATATATGTTTATATACACATAGG - Intronic
1093850521 12:24031201-24031223 ATATATATATATATACACAAAGG + Intergenic
1094488593 12:30944656-30944678 GAATGTGTATATATACACAATGG + Intronic
1094778868 12:33766233-33766255 ATACATGTATATATACACCCAGG - Intergenic
1095145067 12:38717445-38717467 ATATATATATATATACACCATGG + Intronic
1095258978 12:40076515-40076537 GAAAATGTACATATACACCATGG - Intronic
1095365731 12:41402464-41402486 GTATATATATATATACACACAGG + Intronic
1095391048 12:41707061-41707083 GAAAATGTACATATACACCATGG - Intergenic
1095502187 12:42852180-42852202 GTATGTATATATATACACAATGG + Intergenic
1095536065 12:43249234-43249256 ATATATGTATATATACACCATGG + Intergenic
1097072196 12:56363224-56363246 ATATATATATATATACACCCAGG + Intergenic
1097296525 12:57970729-57970751 GTATATATGTATATATATAATGG - Intergenic
1097367847 12:58739845-58739867 GAAAATGTACATATACACCATGG - Intronic
1097375335 12:58836407-58836429 GAAAATGTACATATACACCATGG - Intergenic
1097431918 12:59519602-59519624 ATATATATGTATATAAAACAGGG + Intergenic
1098250381 12:68563075-68563097 GTATCTGTGTAAAAACACCAAGG + Intergenic
1098396686 12:70026675-70026697 GTATATGTATATATATACAATGG + Intergenic
1098423359 12:70329074-70329096 GTACATGTGTATATACAAAGAGG - Intronic
1098439263 12:70500756-70500778 GTACATATACATATACACCATGG + Intergenic
1098481737 12:70969681-70969703 GAAAATGTATATATACACCAAGG - Intergenic
1098683319 12:73385862-73385884 GTATAAGAGTATATACCCAAAGG + Intergenic
1098938915 12:76512332-76512354 GAAAATGTACATATACACCATGG - Intronic
1098952840 12:76659567-76659589 GTATATATATATATACACCATGG + Intergenic
1099391958 12:82092344-82092366 ACATATATATATATACACCATGG - Intergenic
1100033629 12:90223823-90223845 GTATATATGTATATAAACAATGG + Intergenic
1100083737 12:90882181-90882203 AGATATGTGTATATACACAAGGG + Intergenic
1100204291 12:92331270-92331292 GGATATATGTATATACAAAAGGG - Intergenic
1100242948 12:92728000-92728022 ATATATTTATATATACACCATGG - Intronic
1100242951 12:92728037-92728059 ATATATTTATATATACACCATGG - Intronic
1100242954 12:92728074-92728096 ATATATTTATATATACACCATGG - Intronic
1100242957 12:92728111-92728133 ATATATTTATATATACACCATGG - Intronic
1100242960 12:92728148-92728170 ATATATTTATATATACACCATGG - Intronic
1100242963 12:92728185-92728207 ATATATTTATATATACACCATGG - Intronic
1100242966 12:92728222-92728244 ATATATTTATATATACACCATGG - Intronic
1100242969 12:92728259-92728281 ATATATTTATATATACACCATGG - Intronic
1100242972 12:92728296-92728318 ATATATTTATATATACACCATGG - Intronic
1100242975 12:92728333-92728355 ATATATTTATATATACACCATGG - Intronic
1100242978 12:92728370-92728392 ATATATTTATATATACACCATGG - Intronic
1100242981 12:92728407-92728429 ATATATTTATATATACACCATGG - Intronic
1100242993 12:92728524-92728546 ATATATTTATATATACACCATGG - Intronic
1100454531 12:94739588-94739610 GAAAATGTGCATATACACCATGG - Intergenic
1100736556 12:97541005-97541027 ATATATATATATATACACCTGGG - Intergenic
1100788295 12:98102207-98102229 ATATATATATATATACACAATGG + Intergenic
1100869796 12:98897844-98897866 GAAAATGTAAATATACACCATGG + Intronic
1100970932 12:100069490-100069512 GTATGTGTGTATATATATGATGG + Intronic
1102237304 12:111301859-111301881 GTTTATGTGTTTAGACATCAAGG - Intronic
1103147286 12:118606106-118606128 GTATATATGTATATACATGTGGG - Intergenic
1103247907 12:119473813-119473835 ATACATATATATATACACCATGG - Intronic
1103477329 12:121228455-121228477 GTATATATATATATATAACATGG + Intronic
1103866877 12:124059661-124059683 GAAAATGTACATATACACCATGG - Intronic
1104242296 12:127001803-127001825 GTGTATATATATATACACTATGG + Intergenic
1105735553 13:23266325-23266347 GTGTGTGGATATATACACCATGG + Intronic
1105814608 13:24023288-24023310 GTGTATTTGCATACACACCATGG - Intronic
1106048465 13:26167828-26167850 GAAAATGTACATATACACCATGG + Intronic
1106105650 13:26730823-26730845 GTATATATACATATACACAATGG - Intergenic
1106146175 13:27051969-27051991 ATATATGTGTATATATATGATGG + Intergenic
1106572712 13:30941862-30941884 GTGTATATATATATACACCATGG - Intronic
1106862478 13:33924727-33924749 GTATATATATATATATATCAGGG + Intronic
1106899728 13:34342540-34342562 GGATATATGTATATACAAAAGGG + Intergenic
1106921354 13:34567424-34567446 ATATATATGTATATATTCCATGG - Intergenic
1107563092 13:41575044-41575066 GAAAATGTATATATACACCATGG + Intronic
1108650018 13:52468738-52468760 GAAAATGTACATATACACCATGG - Intronic
1109167582 13:59055297-59055319 GAAAATGTACATATACACCATGG + Intergenic
1109969910 13:69754398-69754420 GGATATTTGTATATACAAAAAGG - Intronic
1110154391 13:72296101-72296123 ATATATATGCATATTCACCATGG - Intergenic
1110193539 13:72759010-72759032 ATATCAGTGTATATACACGAGGG - Exonic
1110442698 13:75542964-75542986 GAAAATGTACATATACACCATGG + Intronic
1110477787 13:75937976-75937998 GTATATATATATACACACCATGG - Intergenic
1110538011 13:76674807-76674829 ATATATGTGTATATATATGATGG + Intergenic
1110556558 13:76866246-76866268 GAAAATGTGTATATACACAATGG - Intergenic
1111045669 13:82810834-82810856 GGAAATGTATATATACACCATGG + Intergenic
1111232809 13:85365188-85365210 CTATATATATATATACACCATGG - Intergenic
1111525049 13:89457414-89457436 ATATATATGCATATACAACATGG - Intergenic
1111682310 13:91458842-91458864 GTATATGCATGTATATACCATGG + Intronic
1111867132 13:93783178-93783200 AAAAATGTGTGTATACACCATGG - Intronic
1112827314 13:103406582-103406604 ATATATGTGTGTATACACATGGG - Intergenic
1113344213 13:109458248-109458270 GAAAATGTATATATACACTATGG - Intergenic
1113866613 13:113530444-113530466 ATATATATGTATATATAACAAGG + Intronic
1114279913 14:21183631-21183653 ATATGTGTGTATATACTCCATGG + Intergenic
1114768806 14:25405633-25405655 AAAAATGTGTATATATACCATGG + Intergenic
1114961178 14:27891915-27891937 GTATATATATATATACACAATGG + Intergenic
1115074481 14:29370328-29370350 GTATGTGTGTATCTACACATAGG + Intergenic
1115221014 14:31058429-31058451 GAATGTGTGTATATACATCAAGG - Intronic
1115655557 14:35440233-35440255 CTATATATGTATATACAACATGG - Intergenic
1115975868 14:38996306-38996328 GTATATATGTATATATGACAGGG + Intergenic
1116063511 14:39953821-39953843 GTGTATATGTATATAGTCCATGG - Intergenic
1116089589 14:40287958-40287980 GAAAATGTATGTATACACCATGG - Intergenic
1116205771 14:41864033-41864055 GCAAATGTGGATATATACCATGG - Intronic
1116378597 14:44234692-44234714 GTATGTGTGTATACGCACAATGG + Intergenic
1117221520 14:53611269-53611291 ACATATGTGTATATACATCTTGG + Intergenic
1117398096 14:55331783-55331805 ATATATTTATATATACACCATGG - Intronic
1117398109 14:55331890-55331912 ATATTTTTATATATACACCATGG - Intronic
1117398112 14:55331925-55331947 ATATTTTTATATATACACCACGG - Intronic
1117398115 14:55331960-55331982 ATATTTTTATATATACACCACGG - Intronic
1117398118 14:55331995-55332017 ATATTTTTATATATACACCACGG - Intronic
1117686007 14:58253929-58253951 GAAAATGTATATATACACAATGG - Intronic
1117845666 14:59908807-59908829 ATATATGTGTATATATATGATGG - Intergenic
1118146937 14:63147899-63147921 GTAAATGTACATATACACCATGG - Intergenic
1118197107 14:63637586-63637608 ATATATGTGTATATATATAATGG + Intronic
1118214461 14:63795506-63795528 GTATATATGTATATATATAAAGG - Intergenic
1118649981 14:67881108-67881130 GTATTTGTGTATCTAAACAAAGG + Intronic
1119098937 14:71861769-71861791 ATATATATATATATACACGATGG + Intergenic
1119582223 14:75795783-75795805 GTGTGTATATATATACACCATGG - Intronic
1119815262 14:77560641-77560663 ATATATGTACATATACACCATGG + Intronic
1119929862 14:78534955-78534977 GCATATGTGTATGTACACAAAGG + Intronic
1120336065 14:83156693-83156715 GTATATATATATATACCCAAAGG + Intergenic
1122190945 14:100043315-100043337 GTATATGTATAGATATACAAGGG + Intronic
1122191044 14:100043914-100043936 GTATATGTATAGATATACAAGGG + Intronic
1124472002 15:29995906-29995928 ATATTTGTCTATATACACAATGG + Intergenic
1124657498 15:31520910-31520932 GAAAATGTATATATATACCATGG + Intronic
1125121137 15:36159911-36159933 ATATATATGTATACACACCATGG + Intergenic
1125320582 15:38483697-38483719 ATATATATATATATACACTAAGG + Intronic
1125377488 15:39046384-39046406 ATATATATATATATACACAATGG + Intergenic
1125810615 15:42537669-42537691 GGAAATGTGTATATACACAGTGG + Intronic
1126139029 15:45421606-45421628 GTGTATGTGTATATGTACAAGGG - Intergenic
1126292288 15:47095409-47095431 GTATATATGTATATACACAATGG + Intergenic
1126489456 15:49220444-49220466 GAAAATGTATATATACACAATGG - Intronic
1126624540 15:50673629-50673651 GTATATATATATATATACGAGGG - Intronic
1126718462 15:51549315-51549337 GTATATATATATACACACCATGG - Intronic
1127000337 15:54496599-54496621 ATATATATATATGTACACCATGG + Intronic
1127065710 15:55235794-55235816 GTATATATATACACACACCACGG + Intronic
1127154876 15:56113282-56113304 GAAAATGTACATATACACCATGG + Intronic
1127155273 15:56117831-56117853 GAAAATGTATATATACACAATGG - Intronic
1127589184 15:60406526-60406548 AAATATGGGTATATACACTAAGG + Intergenic
1128291019 15:66478400-66478422 GTATATATATATATACACACAGG + Intronic
1128883340 15:71263326-71263348 GTATATATATATATATACCATGG - Intronic
1129889208 15:79059728-79059750 GTGTGTGTTTATATACAGCAAGG - Intronic
1130184554 15:81667656-81667678 GTATATATGTATATACTGGAAGG - Intergenic
1130768490 15:86899168-86899190 GAAAATGTACATATACACCATGG + Intronic
1131414436 15:92241353-92241375 GAAAATGTATATATACACAATGG - Intergenic
1131854258 15:96576201-96576223 ATATATGTGGATATACAACTGGG + Intergenic
1131974588 15:97931881-97931903 TTATATGTGTATATCCAAAAAGG + Intergenic
1133655895 16:7863384-7863406 ATATATATATATATACACCATGG - Intergenic
1134611653 16:15613944-15613966 GTATGTGTGTATACACAGGAAGG + Intronic
1134805655 16:17121955-17121977 ATATATATATATATACCCCATGG - Intronic
1134841774 16:17407325-17407347 ATATATGTGTATATATATAAGGG + Intronic
1134869594 16:17639649-17639671 ATATATGTACATATACACCATGG - Intergenic
1135506855 16:23045622-23045644 ATATATATATATATACACCATGG + Intergenic
1135778617 16:25279135-25279157 GTTATGGTGTATATACACCATGG + Intergenic
1135837947 16:25844831-25844853 GAAAATGTACATATACACCAGGG + Intronic
1135854994 16:26001332-26001354 GTCTATGTGAATATACATAAAGG + Intronic
1135867109 16:26113954-26113976 GTATATATGTATGTATTCCAGGG + Intronic
1136672164 16:31868208-31868230 AAAGATGTGTATATACACAATGG + Intergenic
1137739595 16:50754840-50754862 GTATATATATACATACACCATGG - Intronic
1137824382 16:51478169-51478191 GAAAATGTATATATACACAATGG - Intergenic
1137951685 16:52789821-52789843 GAAAATGTGCATATACCCCATGG - Intergenic
1138233538 16:55359476-55359498 GAAAATGTATGTATACACCATGG + Intergenic
1138974662 16:62189257-62189279 GTAAATGTGTATATGCAAAAAGG + Intergenic
1138985793 16:62327275-62327297 GTATATGTGTATATTCTCTAGGG + Intergenic
1139841009 16:69880512-69880534 GTTCATCTGTATATACACCGGGG + Intronic
1139918576 16:70443865-70443887 GTATAGGTATAGATACAACAAGG + Intergenic
1139945779 16:70640940-70640962 GTATATAGGTATATACTCCTAGG + Intronic
1140238785 16:73182669-73182691 GAAAATGTGTGTATATACCATGG + Intergenic
1140655796 16:77138001-77138023 GAAAATGTACATATACACCATGG - Intergenic
1141075299 16:81000977-81000999 AAATATGTACATATACACCATGG + Intronic
1141406259 16:83795963-83795985 GTATATATGTGTATACAAGATGG - Intronic
1142299109 16:89246465-89246487 TTACATGTACATATACACCATGG + Intergenic
1143601688 17:7950740-7950762 GAAAATGTACATATACACCATGG + Intergenic
1143849347 17:9798185-9798207 GAATATGTGTATATAAAGCATGG - Intronic
1144153825 17:12478337-12478359 GTATATGTGTATATACACGATGG - Intergenic
1144549735 17:16229317-16229339 ATGTATGTATATATACACAATGG - Intronic
1144883979 17:18446566-18446588 GTATATGTGTATGGATAGCATGG + Intergenic
1146750867 17:35378511-35378533 ATATATGTATATATACACCACGG - Intergenic
1149069362 17:52521319-52521341 GTGTGTGTGTACACACACCAAGG - Intergenic
1149211634 17:54309583-54309605 GTATAAGGGTATATACCCAAAGG + Intergenic
1150056848 17:62024893-62024915 GAAAATGTGCATGTACACCATGG - Intronic
1150895929 17:69210784-69210806 ATATATGTATATATATACAATGG + Intronic
1151060522 17:71087588-71087610 GAAAATGTGTATATACATAATGG - Intergenic
1151111654 17:71685225-71685247 ATATATATATATATATACCATGG + Intergenic
1151824535 17:76516671-76516693 CTACAGGTGTACATACACCACGG - Intergenic
1153168452 18:2288286-2288308 GTATATATGTATATATACTACGG + Intergenic
1153196626 18:2605320-2605342 GTGTGTGTGTATGTACACAATGG + Intronic
1154179788 18:12124744-12124766 GTATTTGTATATCTACCCCATGG + Intronic
1154510005 18:15088502-15088524 ATATATATATATATACACAATGG - Intergenic
1155633223 18:27920239-27920261 ATATATGTATATATATATCAGGG + Intergenic
1155633225 18:27920267-27920289 ATATATGTATATATATATCAGGG + Intergenic
1155633227 18:27920295-27920317 ATATATGTATATATATATCAGGG + Intergenic
1155633229 18:27920323-27920345 ATATATGTATATATATATCAGGG + Intergenic
1155662375 18:28264773-28264795 GAAAATGTACATATACACCATGG - Intergenic
1155755134 18:29484136-29484158 ATATATATGTATATGCACAATGG + Intergenic
1156021070 18:32599695-32599717 GTATGTGTATAAATACACCATGG + Intergenic
1156075344 18:33270245-33270267 GTATATTGGTATATACTTCATGG - Intronic
1156317070 18:35979818-35979840 GTAAATGTGTATATACACAATGG + Intergenic
1156542519 18:37929067-37929089 GTGTATATATATATATACCATGG - Intergenic
1156722987 18:40093090-40093112 GTATTTGTGTATCTAAAACATGG + Intergenic
1157101809 18:44737391-44737413 GCCTATGAGTCTATACACCAGGG - Intronic
1158297677 18:56016458-56016480 ATATATATATATATGCACCATGG - Intergenic
1158312668 18:56175054-56175076 GTATGTGTGTTTATTCACAAAGG - Intergenic
1158710844 18:59836680-59836702 GTATATATGTATACACACACAGG - Intergenic
1158775939 18:60579751-60579773 GTATATGTGTATATATAGAGAGG + Intergenic
1158842564 18:61403864-61403886 GAAAATGTACATATACACCATGG + Intronic
1159082199 18:63747751-63747773 ATATATGTGAATATACACATAGG - Intergenic
1159481256 18:68993720-68993742 GTATATATGTACATCCATCAAGG - Intronic
1160233130 18:77063871-77063893 GTATAGGTATATATACAGCATGG - Intronic
1163056293 19:14721377-14721399 GTATATGTCTATACCCACCACGG + Exonic
1163188313 19:15656277-15656299 ATATATATATATATACACAATGG - Intronic
1163321936 19:16579836-16579858 GTATACGCCTATATACACAAGGG - Intronic
1164879796 19:31722554-31722576 GAAAATGTGTATATACACTGTGG + Intergenic
1165648460 19:37466070-37466092 GTATACGTATGTATACACAAAGG + Intronic
1167559774 19:50219077-50219099 GTGTGAGTGTATACACACCATGG - Intronic
1167559778 19:50219122-50219144 GTGTGTGTGTATACACACCATGG + Intronic
1167794063 19:51697733-51697755 ATATATGTATATATAAACCATGG + Intergenic
1168553502 19:57319165-57319187 GTATATATATATACACTCCATGG - Intergenic
925706524 2:6689610-6689632 ATATATATATATATACACCATGG + Intergenic
925966617 2:9072524-9072546 GTATATGTATATATACCATATGG - Intergenic
926448708 2:12975780-12975802 AGATATGTGTGTATACACAAGGG + Intergenic
926481686 2:13405723-13405745 ATATATATGTATATACACAATGG + Intergenic
926524847 2:13966949-13966971 GTGTGTGTGTGTATACACAATGG - Intergenic
926705571 2:15835000-15835022 GTATTTGTGTTTATTAACCAAGG - Intergenic
927009205 2:18884595-18884617 GTCTGTGTATATATACACAATGG + Intergenic
927012621 2:18921650-18921672 ATATATGTGTATATATATCATGG + Intergenic
927080473 2:19624726-19624748 GTATATATATATATGCACAATGG - Intergenic
927567929 2:24130171-24130193 GAAAATGTACATATACACCATGG - Intronic
928777416 2:34782220-34782242 GAAAATGTATATATACACAATGG + Intergenic
928825704 2:35418845-35418867 ATATATATATATATACACCATGG + Intergenic
929083151 2:38140699-38140721 GTATAAGTGTGTTGACACCAAGG - Intergenic
929351666 2:40963762-40963784 CTGTGTGTGTATATACACAATGG - Intergenic
929615498 2:43304062-43304084 GTATTTGTTTTTGTACACCATGG + Intronic
930159563 2:48140436-48140458 ATATATATATATATACACCATGG - Intergenic
930248946 2:49013942-49013964 CTCTCTGTGTATATGCACCAAGG + Intronic
930571379 2:53090759-53090781 GTATATATGTATATGCATAAAGG + Intergenic
930638870 2:53835114-53835136 GAAAATGTGTATATACACAATGG + Intergenic
931316254 2:61135343-61135365 GTATATGTAGTTATATACCAAGG + Intronic
931417573 2:62095860-62095882 GTATGTGTATATATACACACAGG - Intronic
931417575 2:62095900-62095922 ATATATGTATATATACACACAGG - Intronic
931581798 2:63783554-63783576 GTATAAGTATATATACACAATGG + Intronic
932072062 2:68630430-68630452 GTATATATATATATATATCAGGG - Intronic
932121884 2:69108825-69108847 GAAAATGTATATATACACCGTGG - Intronic
932187753 2:69713474-69713496 GTAGAAGTGTTTTTACACCATGG - Intronic
932562571 2:72886526-72886548 GGACATATGTATATACACAATGG + Intergenic
932659890 2:73642691-73642713 GTATATGTGTACAAGGACCAGGG - Intergenic
932666456 2:73702351-73702373 GTATATGTGTACAGGGACCAAGG - Intergenic
933048952 2:77577356-77577378 ATATATATATATATGCACCATGG + Intronic
933633831 2:84685181-84685203 GTATATGTGTATATCCACTGGGG + Intronic
933641419 2:84764787-84764809 GGAAATGTATATATACACCATGG - Intronic
933687765 2:85157054-85157076 ATATGTGTATATGTACACCAGGG - Intronic
933904881 2:86882084-86882106 GAAAATGTATATATACACCATGG + Intergenic
934276544 2:91576860-91576882 GTATATATATATACACCCCAAGG + Intergenic
934547445 2:95230015-95230037 GTATATATATATATATACCATGG + Intronic
935442563 2:103118702-103118724 ATATATGTGTATATATACATGGG - Intergenic
935504862 2:103888098-103888120 GCATATATGCATATACACAATGG + Intergenic
935591809 2:104852099-104852121 GTATATGTATATATAAAAGATGG - Intergenic
935851797 2:107229721-107229743 GAAAATGTATATATACACCATGG - Intergenic
936097575 2:109543862-109543884 GAATATCTGCATATACACAACGG + Exonic
936141357 2:109944805-109944827 ATATATATACATATACACCATGG + Intergenic
936178046 2:110242753-110242775 ATATATATACATATACACCATGG + Intergenic
936203336 2:110426678-110426700 ATATATATACATATACACCATGG - Intronic
936367347 2:111870078-111870100 GAAAATGTATATATACACCATGG - Intronic
936858300 2:116986536-116986558 ATATATATGTATATACACCATGG + Intergenic
937549879 2:123074698-123074720 GTATATGTATATAAACATCTTGG - Intergenic
937632409 2:124118225-124118247 GTATATGTGTGTGTATAACATGG - Intronic
937792513 2:125977676-125977698 GTGTCTGTGTATATACACCTAGG + Intergenic
937793503 2:125988328-125988350 ATATATATACATATACACCATGG - Intergenic
937964871 2:127497195-127497217 TTATATGTGTATATATAACAGGG - Intronic
938505026 2:131870590-131870612 ATATATATATATATACACAATGG - Intergenic
939062865 2:137445384-137445406 GAAAATATGTATATACACAATGG + Intronic
940207740 2:151222738-151222760 ATATATATATGTATACACCATGG - Intergenic
940608621 2:155961637-155961659 TTCTGTGTGTATATACACAATGG + Intergenic
940630757 2:156235508-156235530 GTATATATATATATATACCATGG + Intergenic
940675152 2:156718255-156718277 GAAAATGTACATATACACCATGG + Intergenic
940711478 2:157167404-157167426 GTATATATGTATATATAAAAGGG + Intergenic
940779060 2:157914147-157914169 GAAAAGGTATATATACACCATGG + Intronic
940796377 2:158083785-158083807 ATGTATATATATATACACCATGG - Intronic
941680102 2:168388734-168388756 GTATATATATATATACACCACGG - Intergenic
942100220 2:172573468-172573490 GTATATGTGTATATATATATAGG + Intronic
942405824 2:175653784-175653806 GTGTATATATATATATACCATGG + Intergenic
942457645 2:176149097-176149119 GAAAATGTGTATATTCACCCCGG + Intergenic
942809982 2:179987414-179987436 GTAGATGTGTATATAAAATATGG - Intronic
942996310 2:182264889-182264911 ATATGTATATATATACACCATGG + Intronic
943200874 2:184822192-184822214 GAAAATGTACATATACACCATGG + Intronic
943871349 2:193005007-193005029 CAATATATGTATATTCACCACGG + Intergenic
943955222 2:194180279-194180301 GTATATATATATATACACACAGG + Intergenic
943992942 2:194720801-194720823 GTATATATATATATATACCTCGG + Intergenic
944852087 2:203730101-203730123 GTATATATGTATAAACACCTAGG + Intronic
945621052 2:212137535-212137557 GAAAATGTACATATACACCATGG - Intronic
945623622 2:212172564-212172586 GTATATGTGTATATACACCATGG + Intronic
945760458 2:213907651-213907673 GAAAATGTATATATACACAATGG + Intronic
946544441 2:220722231-220722253 ATATATATATATATACACCATGG - Intergenic
946729589 2:222696123-222696145 ATATATGTATATAAACATCATGG - Intronic
947332988 2:229049906-229049928 GTATATATGTATATATATCTTGG - Intronic
947443713 2:230146312-230146334 GTGTATATATATATACACAATGG + Intergenic
947443714 2:230146334-230146356 GAATATTTATATATACACAATGG + Intergenic
947475116 2:230438632-230438654 GTGTGTATATATATACACCATGG - Intronic
947789328 2:232854510-232854532 GTATATATATATAAACACTAAGG + Intronic
948418975 2:237841200-237841222 ATAAGTGTATATATACACCATGG + Intronic
1168776753 20:454334-454356 CTAAATGTGTATACACACAAAGG + Intronic
1169295740 20:4396330-4396352 GCAAATGTATATATACACAATGG - Intergenic
1169860950 20:10151627-10151649 GTATGTATGTATATATACCATGG - Intergenic
1169969741 20:11256582-11256604 ATATATATATATATACACCATGG - Intergenic
1170050361 20:12136625-12136647 ATAAATGTATATATACACAATGG - Intergenic
1170107986 20:12772565-12772587 GTATACATATATATACACTATGG - Intergenic
1170288604 20:14741764-14741786 GTATATGAGTATAGTCACAAGGG + Intronic
1170384347 20:15799650-15799672 AAATATGTTTATATACACAATGG - Intronic
1170751867 20:19155741-19155763 GTATATGTGTATCTAAACATAGG + Intergenic
1171276415 20:23859761-23859783 ATATATATATATACACACCATGG - Intergenic
1171357382 20:24559123-24559145 GTATATATATATATACACAATGG + Intronic
1172402486 20:34661577-34661599 GAAAATGTACATATACACCATGG - Intronic
1172531652 20:35635161-35635183 ATATATGTATATATAAAACAGGG - Intronic
1172757298 20:37295015-37295037 GTAGAGGTTTTTATACACCAGGG - Intronic
1173642261 20:44611980-44612002 GAAAATGTATATATACACAAAGG - Intronic
1174948849 20:55020945-55020967 ACATATGTGTATATACATAAGGG - Intergenic
1175078158 20:56393180-56393202 GTGTGTGTGTATGTACACCCGGG + Intronic
1175587651 20:60157617-60157639 GAAAATGTACATATACACCATGG + Intergenic
1177060277 21:16364637-16364659 GTATATATATATATACACAGAGG + Intergenic
1177128138 21:17221958-17221980 ATATATATATATATACACCATGG + Intergenic
1177399696 21:20586914-20586936 GTGTGTGTGTATATATACCTGGG + Intergenic
1177399765 21:20587610-20587632 ATATATGTAGATATACACCCTGG + Intergenic
1177399816 21:20588090-20588112 ATATATATATATATACACCCGGG + Intergenic
1177523517 21:22263178-22263200 GGTGATGTATATATACACCATGG + Intergenic
1177607654 21:23402173-23402195 ATATATGTATATATATCCCAAGG + Intergenic
1177876478 21:26638116-26638138 ATATATATATATATATACCATGG - Intergenic
1177951259 21:27540872-27540894 GTATGTATGTATATGCACCAAGG + Intergenic
1178062545 21:28868001-28868023 GTATAAGTGATTATACACAAAGG - Intergenic
1178508346 21:33181240-33181262 GTGTGTGTGTGTATACACCATGG - Intergenic
1178679690 21:34663168-34663190 GTATATATATATACACACAATGG + Intergenic
1179196604 21:39169806-39169828 GTATATCTATATAGATACCAGGG - Intergenic
1179605172 21:42511370-42511392 GTATAGCTGTATCTACACAATGG + Intronic
1179948355 21:44695671-44695693 GGATATGAATATTTACACCACGG + Intronic
1181408867 22:22704211-22704233 GTAAATTTGCATAAACACCAAGG + Intergenic
1181978533 22:26749949-26749971 ATATAGATATATATACACCATGG - Intergenic
1182498686 22:30729675-30729697 GTATATATGTATACACAACAGGG + Intronic
1182758784 22:32704425-32704447 GAAAATGTACATATACACCATGG - Intronic
1182971682 22:34585038-34585060 GTATATTTTTATATTCCCCAAGG - Intergenic
1184625445 22:45724039-45724061 ATATATATATATATACACAATGG - Intronic
1185121174 22:48972351-48972373 TGGTATGTGTATATACACCATGG - Intergenic
949385181 3:3493908-3493930 GTATATATATATACACACAACGG + Intergenic
949386861 3:3512524-3512546 GAAAATGTACATATACACCATGG + Intergenic
949481612 3:4499476-4499498 TTATATATGTATATATATCAGGG - Intronic
949698447 3:6727338-6727360 GAAAATGTATATATACACAATGG - Intergenic
950898228 3:16473111-16473133 GTGTACGTGTGTGTACACCATGG - Intronic
951306494 3:21069207-21069229 ATATATGTATACACACACCAGGG + Intergenic
951517941 3:23582357-23582379 ATGTATGTGTATGTTCACCATGG - Intronic
951948009 3:28164429-28164451 GTATATATATATATACACAATGG + Intergenic
951988865 3:28653034-28653056 ATATATATATATATACACAATGG - Intergenic
952094335 3:29930481-29930503 ATATATGTATATATGGACCAGGG + Intronic
953577590 3:44125729-44125751 GTGTGTGTGTATATGCACCTGGG - Intergenic
953695636 3:45156221-45156243 GTGTATGTGTATCTACACAATGG - Intergenic
954944359 3:54406408-54406430 ATGTGTGTGTATATACACAATGG - Intronic
955439324 3:58938976-58938998 ACATATATGTATATACATCAGGG - Intronic
956336371 3:68168406-68168428 GCATATGTGTAAATATACAAGGG - Intronic
956519879 3:70092301-70092323 GTATATGAGAATATACATGATGG + Intergenic
959175238 3:102900962-102900984 GTATCTATTTATACACACCATGG - Intergenic
959245330 3:103861136-103861158 GAAAATGTATATATACACCATGG - Intergenic
959665993 3:108922132-108922154 ATGTGTGTGTGTATACACCATGG - Intronic
959678784 3:109068565-109068587 GTATATATATATACACACAATGG - Intronic
959899576 3:111645145-111645167 ATATATATATATATACACCACGG - Intronic
959948910 3:112156362-112156384 GTATGTGTGTATATACACAATGG - Intronic
960242955 3:115366857-115366879 GAAAATGTATATATACACCATGG + Intergenic
961694357 3:128694032-128694054 GTATATATGTATATACACATTGG - Intergenic
961910236 3:130307393-130307415 GTATATATATATACATACCATGG + Intergenic
961997136 3:131257949-131257971 GTATATATATATATACACCATGG + Intronic
962774062 3:138642066-138642088 ATATATATATATATACACCTAGG + Intergenic
963475331 3:145796568-145796590 GTTACTGTGTATATACACAAAGG + Intergenic
964076160 3:152694889-152694911 AGATATATATATATACACCATGG + Intergenic
964190428 3:153994182-153994204 ATATATGTATATATATACGATGG + Intergenic
964208981 3:154207876-154207898 GAAAATGTACATATACACCATGG + Intronic
964577448 3:158189074-158189096 ATATATGTTTATATATCCCATGG - Intronic
964597862 3:158456941-158456963 GTACATGTGTGTATGCAGCAAGG + Intronic
965242729 3:166224693-166224715 ATATATATATATATACACAAAGG + Intergenic
965465509 3:169025220-169025242 TTATATGTGCATATATACAATGG + Intergenic
966172173 3:177094601-177094623 TGGTATGTGTATATACACCATGG + Intronic
966221859 3:177559147-177559169 GTATGTGTGTGTGTACACCATGG - Intergenic
966485968 3:180469775-180469797 GTATAAGTGTAAAGACACAAGGG + Intergenic
966517763 3:180837974-180837996 GAAAATGTACATATACACCATGG + Intronic
967132556 3:186485882-186485904 GTATATATATATACACACTATGG + Intergenic
967866002 3:194190362-194190384 GAAAATGTACATATACACCATGG - Intergenic
969383213 4:6821581-6821603 GTGTGTATATATATACACCATGG - Intronic
970130746 4:12867720-12867742 GTATATATATATATACACGTAGG - Intergenic
970548839 4:17158197-17158219 GTATATGTATATATATATGACGG - Intergenic
971530890 4:27687361-27687383 GTATATATGTGTATATACCATGG - Intergenic
971656409 4:29351732-29351754 GAAAATATGTATGTACACCATGG - Intergenic
971729350 4:30357198-30357220 GAAAATGTACATATACACCATGG - Intergenic
971822941 4:31582545-31582567 GAATATTTGTATATACACAAAGG - Intergenic
972013873 4:34219657-34219679 GTATATATGTATATATATAATGG - Intergenic
972060345 4:34862191-34862213 ATAAATGTGTATATAAACAATGG + Intergenic
972294158 4:37720533-37720555 GAAAATGTATATATACATCATGG + Intergenic
972297097 4:37750197-37750219 ATATGTGTGTATATACACACAGG - Intergenic
972535263 4:39994769-39994791 GTCTGATTGTATATACACCATGG + Intergenic
972707834 4:41562779-41562801 GTATTTGGGTATCTGCACCAAGG + Intronic
973068166 4:45822992-45823014 ATATATATATATATACACCATGG + Intergenic
973170565 4:47137866-47137888 ATATATGTATATATAAACAAAGG + Intronic
973255002 4:48101666-48101688 GTGTATGTGTATATAAAGCATGG - Intronic
973903468 4:55501934-55501956 GTATATTTGTATAAACTACAAGG + Intronic
974292593 4:59952096-59952118 ATATATGTATATATACACATGGG + Intergenic
974311322 4:60213914-60213936 GAATATATATATATATACCATGG + Intergenic
974450570 4:62051073-62051095 GTGTATATATATATACACAAAGG + Intronic
974557705 4:63472879-63472901 ATATATGTGTAAATACATCATGG + Intergenic
974574144 4:63695436-63695458 ATATTTGTTTATATACATCAAGG + Intergenic
974801388 4:66823327-66823349 GTGTGTGTGTGTATACACCATGG - Intergenic
974841212 4:67301308-67301330 ATATATATGTATATATATCAGGG + Intergenic
974895856 4:67937747-67937769 ATATATATCTATATATACCATGG - Intronic
974911454 4:68126200-68126222 TGATATGTGTATATACACACAGG + Intronic
975006549 4:69295939-69295961 ATATATATATATATATACCATGG - Intronic
975266107 4:72369869-72369891 GTTTATATGCATATACCCCAAGG - Intronic
975420001 4:74152569-74152591 ATATAGGTATACATACACCATGG + Intronic
975631640 4:76410060-76410082 GTATAAGTGCACATCCACCAGGG - Intronic
975681170 4:76877689-76877711 ATATATATATATATACACAATGG - Intergenic
975734783 4:77370669-77370691 ACATATGTGTATATTCATCATGG + Intronic
975905375 4:79204916-79204938 GTGTGTGTGTATACACACCATGG - Intergenic
977269761 4:94901896-94901918 GTATATGTGTGTGTACAAAATGG + Intronic
977513467 4:97991261-97991283 GTGTGTGTATATATACACCATGG - Intronic
977636608 4:99305554-99305576 ATATATATATATATACACTATGG - Exonic
977974566 4:103249358-103249380 ACATATATGTATATACATCATGG + Intergenic
978418965 4:108509526-108509548 GTATATATGTATATACACCATGG + Intergenic
978607416 4:110496198-110496220 GTATGTATGTATATATGCCATGG + Intronic
978616742 4:110604866-110604888 TTATATGTGTATATATATAAAGG + Intergenic
978685369 4:111435887-111435909 GCAAATATGTTTATACACCATGG - Intergenic
978718030 4:111869346-111869368 GAGTATGTGTATATACAAAAGGG + Intergenic
979026221 4:115580157-115580179 GTATGTGTGTATACACACTTTGG + Intergenic
979039410 4:115767471-115767493 ATATATGTATATATACAAAAGGG - Intergenic
979194946 4:117909673-117909695 GTATAGGTATATATACACCAAGG - Intergenic
979506543 4:121503477-121503499 GAAAATGTATATATACACCATGG - Intergenic
979968975 4:127111465-127111487 GTATTAATATATATACACCATGG + Intergenic
980010028 4:127584734-127584756 GTATATGTATATATGCACATAGG - Intergenic
980541830 4:134205675-134205697 ATATATGTATATATACACAATGG + Intergenic
980569709 4:134598484-134598506 ATATATATATATATACACAAAGG + Intergenic
980580663 4:134746069-134746091 ATATATGTATACATACACCATGG + Intergenic
980712352 4:136585968-136585990 GTATATGTATATATATACCTGGG - Intergenic
980756365 4:137169192-137169214 GTATATGTATATATACATGTAGG + Intergenic
981442802 4:144802053-144802075 ATATATATATATATACACCATGG - Intergenic
981680763 4:147395208-147395230 ATATATATATATACACACCATGG + Intergenic
981881551 4:149619118-149619140 ATATATATATATATACACCATGG + Intergenic
982195204 4:152904755-152904777 GAAAATGTACATATACACCATGG - Intronic
982290550 4:153777816-153777838 GGAGATGTGTACATGCACCAGGG - Intergenic
982295815 4:153827862-153827884 GTATATACGTATATACCCAAAGG + Intergenic
982367148 4:154591668-154591690 GTATATATATATATACACAATGG + Intergenic
982632735 4:157852773-157852795 GAAAATGTACATATACACCATGG - Intergenic
982795935 4:159643852-159643874 AAATATGTTTATATACACAATGG - Intergenic
982812310 4:159841255-159841277 ATATATATATATATATACCATGG - Intergenic
982825437 4:159998537-159998559 ATATATATATATATATACCATGG - Intergenic
983234013 4:165158352-165158374 GTATACATATATACACACCATGG + Intronic
983308498 4:166024775-166024797 ATATATGTATATAAACATCATGG - Intronic
983546554 4:168970829-168970851 GTATATATATATATATATCATGG - Intronic
983653816 4:170059681-170059703 GGAGATGTTTATATACACAAGGG + Intergenic
983996331 4:174187282-174187304 GTATATATATGTATACACCATGG + Intergenic
984586996 4:181576306-181576328 GAATGTGTATATATACACAATGG - Intergenic
984593483 4:181641749-181641771 ATATATATATATACACACCATGG - Intergenic
985355143 4:189110536-189110558 GTATATACGTATATACACATAGG - Intergenic
986296280 5:6441338-6441360 GAAAATGTACATATACACCAAGG - Intergenic
986362342 5:6992333-6992355 GTATATATATATATACGCAAGGG - Intergenic
986418973 5:7557863-7557885 GTATCTGGGTATATACTCAAAGG - Intronic
986504522 5:8435214-8435236 AAATGTGTATATATACACCATGG + Intergenic
987248275 5:16072538-16072560 GTGTGTGTGTACATACACCAAGG + Intronic
987490515 5:18575280-18575302 GAAAATGTACATATACACCATGG + Intergenic
987765324 5:22220654-22220676 ATATATGTTTATATATACAAAGG + Intronic
987997568 5:25305848-25305870 ATATATGTCCATATGCACCAAGG + Intergenic
988154117 5:27427195-27427217 CTATATATGTATATACACCATGG + Intergenic
988714622 5:33812873-33812895 GTATATATGGATATATACCCAGG - Intronic
988929167 5:36019132-36019154 ATATATATATATACACACCATGG - Intergenic
989244637 5:39240950-39240972 GAAAATGTACATATACACCATGG + Intronic
989693932 5:44177015-44177037 GAAAATGTATATATACACCATGG - Intergenic
989969677 5:50507853-50507875 AAATATGTACATATACACCATGG + Intergenic
990161065 5:52941138-52941160 AAATATGTACATATACACCATGG - Intronic
990745232 5:58952211-58952233 GAATATATATATATACACAATGG + Intergenic
992239389 5:74750767-74750789 ATATATGTGTATATATATAAAGG + Intronic
992364031 5:76073531-76073553 ATATATATATATATACACCATGG + Intergenic
992900956 5:81294886-81294908 AAATATGTACATATACACCATGG + Intergenic
993083017 5:83325668-83325690 AAATATGTACATATACACCATGG - Intronic
993191557 5:84689341-84689363 ATATATATATATACACACCATGG + Intergenic
993219176 5:85068571-85068593 ATATATGTATATATACAGCCAGG + Intergenic
993221390 5:85101931-85101953 GAAAATGTACATATACACCATGG + Intergenic
993425381 5:87757247-87757269 GAAAATGTGTATACACACGATGG - Intergenic
993484324 5:88463686-88463708 GAAAATGTATATATACACCATGG - Intergenic
994014871 5:94953788-94953810 ATATATGTATATATATGCCATGG - Intronic
994116667 5:96068860-96068882 ATATATGTATATATACACACAGG - Intergenic
994351184 5:98748407-98748429 GAAAATGTACATATACACCATGG + Intergenic
994552428 5:101254480-101254502 GTACATGTGTATGTGTACCAAGG - Intergenic
995117517 5:108498641-108498663 AAAAATGTATATATACACCATGG - Intergenic
995439601 5:112175736-112175758 GTATATGTATATATATATGAAGG + Intronic
995784957 5:115817738-115817760 GTATACATGTATATACACGAGGG - Intergenic
996165392 5:120216038-120216060 GGATATATGTATATATAACAGGG + Intergenic
996495654 5:124152244-124152266 GTATATATGTATATATAACATGG + Intergenic
996870530 5:128187249-128187271 GTATATGTGAATATAGAGCTAGG + Exonic
997764989 5:136494058-136494080 GTATATATATATGTACACCACGG + Intergenic
997785993 5:136714512-136714534 GAAAATGTACATATACACCATGG - Intergenic
998198758 5:140100364-140100386 ATATATATATATATACACAATGG - Intergenic
998345681 5:141460905-141460927 ACATATATATATATACACCATGG - Intronic
1000616035 5:163427921-163427943 ATATATATGTATTTACACAATGG + Intergenic
1000649426 5:163797793-163797815 ATATATATATATACACACCATGG - Intergenic
1000710768 5:164574239-164574261 ATATATATGTATATATACAATGG - Intergenic
1000780226 5:165471244-165471266 ATATATGTATATACACACAATGG + Intergenic
1000979469 5:167801148-167801170 ATATATGTATATATTCCCCAGGG + Intronic
1002848938 6:974167-974189 GTGTATATATATATATACCATGG + Intergenic
1002974698 6:2062550-2062572 GTTTATGTATATATACATTATGG - Intronic
1003059240 6:2849859-2849881 ATATATATGTATATGCACCTGGG + Intergenic
1004209449 6:13623858-13623880 GTATATGTGTCTATAGATAATGG + Intronic
1004780358 6:18901780-18901802 ATATATGTATATGTACACTAAGG + Intergenic
1007915123 6:45554287-45554309 GTATATGTGTATGCACACACAGG + Intronic
1008039308 6:46779688-46779710 GTATATATGTATATATCCCATGG + Intergenic
1008113373 6:47518094-47518116 TTATATGTGTATATATACTGGGG + Intronic
1008190734 6:48453827-48453849 ATATATATATATATGCACCATGG + Intergenic
1008237572 6:49068915-49068937 GTATATGTGCATATACATATGGG + Intergenic
1008250761 6:49237061-49237083 ATTTATATATATATACACCATGG - Intergenic
1008256587 6:49309112-49309134 GAAAATATGCATATACACCATGG + Intergenic
1008596980 6:53052260-53052282 GAAAATGTACATATACACCATGG - Intronic
1008676699 6:53826769-53826791 GTATATCTGTATATATACTGTGG + Intronic
1009499018 6:64387602-64387624 GTTTATTTTTTTATACACCAAGG - Intronic
1009775554 6:68201409-68201431 ATATATATGTATATACCCCAAGG + Intergenic
1009783178 6:68296652-68296674 ATATGTGTACATATACACCATGG + Intergenic
1010477331 6:76304095-76304117 GAAAATGTACATATACACCATGG - Intergenic
1010485509 6:76407768-76407790 GTATCTGTTTATAGACACCTAGG + Intergenic
1012196313 6:96345305-96345327 GTATATATATATATACACAGTGG - Intergenic
1012573121 6:100756605-100756627 TTATACATGTATATACACTAAGG + Intronic
1013438029 6:110132914-110132936 ATATATATACATATACACCATGG + Intronic
1013438032 6:110132953-110132975 GTGTGTGTGTGTATACACCATGG - Intronic
1013553774 6:111236019-111236041 GTATATATATACATACACCATGG + Intergenic
1013721160 6:113029811-113029833 ATATATGTGTATATATATGATGG - Intergenic
1013721161 6:113029837-113029859 ATATATGTGTATATATATGACGG - Intergenic
1014453278 6:121606521-121606543 ATATATATATATATATACCATGG - Intergenic
1014630345 6:123781877-123781899 ATATATGTGTATAGATAGCAGGG - Intergenic
1014821586 6:125994735-125994757 GAAAATGTACATATACACCATGG + Intronic
1014869048 6:126568677-126568699 AAATGTGTGTATATACACAATGG + Intergenic
1015802975 6:137079137-137079159 ATGTATATATATATACACCATGG - Intergenic
1015903558 6:138092691-138092713 ATATATGTATATATACACACAGG + Intronic
1016169100 6:140986738-140986760 ATATATTTGTATATACACACAGG + Intergenic
1016249949 6:142028758-142028780 GAAAATGTATATATACACCATGG - Intergenic
1016607550 6:145949360-145949382 GCAGGTGTGTATACACACCATGG + Intronic
1018157514 6:161000681-161000703 ATATGTGTGTATATATATCAGGG - Intronic
1018380062 6:163250893-163250915 ATATATATATATATACACTATGG + Intronic
1018484019 6:164221918-164221940 GTGTGTGTGTATAAGCACCATGG + Intergenic
1020716907 7:11685997-11686019 GAAAATGTACATATACACCATGG + Intronic
1020731311 7:11884501-11884523 ATATATATATATATATACCATGG + Intergenic
1020742316 7:12037434-12037456 GTATATGTATATATACATATAGG - Intergenic
1020808738 7:12825079-12825101 GAAAATGTACATATACACCATGG + Intergenic
1020838018 7:13178921-13178943 ATATATGTGTATATAAAATATGG - Intergenic
1022281306 7:28912857-28912879 ATATATATATATATACACCATGG + Intergenic
1022354144 7:29596081-29596103 GTGTGTGTGTGTGTACACCATGG + Intergenic
1022689187 7:32629290-32629312 GTATGTGTGTGTACACACAATGG + Intergenic
1022759599 7:33333413-33333435 GAAAATGTGTATACACACCATGG - Intronic
1022783959 7:33617072-33617094 GTATATTTATATATACACTATGG - Intergenic
1022869917 7:34466107-34466129 GTATATCTATATTTACACAATGG - Intergenic
1023214236 7:37844719-37844741 GTATATAAACATATACACCATGG - Intronic
1023222718 7:37936026-37936048 ATATATATATATATACACAAGGG + Intronic
1023322560 7:39013739-39013761 GCATTTGTCTATAAACACCAAGG + Intronic
1023600973 7:41881477-41881499 GTATAATTGTATACACAGCATGG + Intergenic
1023747679 7:43336906-43336928 GAAAATGTATATATACACCATGG - Intronic
1024111288 7:46149205-46149227 GTGTGTGTGTATATACACAATGG - Intergenic
1024602529 7:50996421-50996443 ATGTATATATATATACACCATGG - Intergenic
1025623812 7:63199821-63199843 AGGTATGTTTATATACACCATGG + Intergenic
1025784256 7:64630084-64630106 GAAAATGTACATATACACCATGG + Intergenic
1026486655 7:70827780-70827802 GTGTGTGTGTATATACACACAGG - Intergenic
1026632986 7:72053996-72054018 GTATATATCTATATATACGATGG - Intronic
1027433672 7:78141090-78141112 GTAAATGGGTATATAATCCAAGG + Intronic
1027562732 7:79752388-79752410 ATATATCTATATACACACCATGG - Intergenic
1027981102 7:85223548-85223570 GTGTGTGTGTGTATACACCATGG + Intergenic
1028094267 7:86740987-86741009 ATATATGTGTACATAGACCTTGG + Intronic
1028527609 7:91802624-91802646 ATATATGTGTATATATTCAATGG - Intronic
1028529200 7:91819350-91819372 ATATATCTATATATATACCATGG - Intronic
1028924396 7:96341825-96341847 GTATATTTATATATACACCTAGG + Intergenic
1030269323 7:107653532-107653554 ATATGTGTGTATATCAACCAAGG - Intergenic
1030401511 7:109057439-109057461 GAAAATGTATATATACACCATGG - Intergenic
1030533761 7:110741115-110741137 GAAAATGTTTATATATACCATGG + Intronic
1030883709 7:114913590-114913612 GAATATTTGCATATACATCATGG + Intergenic
1031043346 7:116861905-116861927 AAATGTGGGTATATACACCATGG - Intronic
1031234929 7:119162863-119162885 TGATATGTATATATACACAATGG - Intergenic
1031258239 7:119483586-119483608 GAAAATGTATATATACACCATGG - Intergenic
1031304665 7:120111248-120111270 ATATATGTATATACACACAATGG - Intergenic
1031334384 7:120509371-120509393 GTATATATGTATATACGCTCTGG + Intronic
1031443005 7:121816144-121816166 ATATATATATATATATACCATGG + Intergenic
1031660459 7:124417641-124417663 GTATATGTGTGTATATGCTAGGG + Intergenic
1031663272 7:124453959-124453981 GTCTGTGTGTATATACAGTACGG - Intergenic
1031954141 7:127924772-127924794 ATATATTTGTATACACAGCAAGG + Intronic
1033057198 7:138068310-138068332 GTACATATGTATTTGCACCAAGG - Intronic
1033630885 7:143156503-143156525 GTGTGTATATATATACACCATGG + Intergenic
1033985869 7:147224771-147224793 GTATATGTGTATATATAGAGAGG - Intronic
1034711901 7:153200224-153200246 ATATATATATATATATACCATGG + Intergenic
1034946429 7:155265300-155265322 CTATATGTGTATATACATGTGGG - Intergenic
1036455709 8:8905338-8905360 GTATCTGTGTAAATTCACAATGG + Intergenic
1036476482 8:9097903-9097925 TGGTATATGTATATACACCATGG + Intronic
1037560481 8:20069573-20069595 GTATATATATATATACACGATGG + Intergenic
1037579789 8:20237790-20237812 GTATATGTGTGTATACATGGGGG - Intergenic
1037828078 8:22171609-22171631 GTATATATGTATTTACAGTAGGG + Intronic
1038477895 8:27881333-27881355 GTACATATACATATACACCATGG + Intronic
1039367349 8:36944244-36944266 GAAAATGTATATATGCACCATGG + Intergenic
1039625847 8:39051539-39051561 ATATTTGTGTATATACACATGGG + Intronic
1039806344 8:41003059-41003081 GAAAACGTATATATACACCACGG - Intergenic
1040361327 8:46667338-46667360 GAAAATGTATGTATACACCATGG + Intergenic
1040449891 8:47534411-47534433 GAAAATGTACATATACACCATGG + Intronic
1040671379 8:49695189-49695211 ATATGTGTGCATATACACAATGG - Intergenic
1040753496 8:50740772-50740794 ATAGTGGTGTATATACACCATGG + Intronic
1040912742 8:52537603-52537625 GAAAATGTGTATATACACAACGG + Intronic
1041028906 8:53716468-53716490 GAATATGTGTATCTTCACCCTGG + Intronic
1041307395 8:56476355-56476377 GAATATCTGTGTATACACAATGG + Intergenic
1041625501 8:60021140-60021162 AAAAATGTATATATACACCATGG - Intergenic
1041897576 8:62943808-62943830 AAATATATATATATACACCATGG + Intronic
1041964913 8:63665377-63665399 ATATATATATATACACACCATGG + Intergenic
1042050036 8:64693740-64693762 GTGTATGTGTATATATTGCATGG - Intronic
1042330514 8:67575512-67575534 GAAAATGTATATATACACAATGG + Intronic
1042923433 8:73942296-73942318 ATATTTGTTTAAATACACCATGG + Intronic
1042995996 8:74699422-74699444 ATATATATATATATACACCATGG + Intronic
1043573850 8:81633988-81634010 ATATAATTATATATACACCATGG + Intergenic
1043721902 8:83555138-83555160 ATATATATATATATACACCATGG - Intergenic
1044508078 8:93043819-93043841 ATATATATATATATACACCATGG - Intergenic
1044568803 8:93695441-93695463 GAAAATGTGTATATATACCATGG - Intergenic
1044744612 8:95360174-95360196 GTATATATGTATATACATATGGG - Intergenic
1044894829 8:96880561-96880583 ATATATATATATATATACCATGG + Intronic
1045327012 8:101124655-101124677 GTGTATGTGTATATATACGTGGG - Intergenic
1045403895 8:101846036-101846058 GAAAATGTATATATACACAATGG - Intronic
1045838845 8:106555934-106555956 ATATATATATATATACACAATGG + Intronic
1045959405 8:107949364-107949386 GAAAATGTGGATATACACCATGG - Intronic
1046180373 8:110637884-110637906 GTAGGTGTGTATATATACAAAGG - Intergenic
1046202457 8:110945170-110945192 GAAAATGTATATATACACCATGG - Intergenic
1046324071 8:112617434-112617456 GATTATGTGTAAATACACCTAGG + Intronic
1046437651 8:114214020-114214042 ATATTTGTATATATACAACAAGG - Intergenic
1046478092 8:114775839-114775861 ATATATGTGTATATATACACTGG - Intergenic
1046545340 8:115642241-115642263 GTATATATATATATACACACAGG - Intronic
1046838709 8:118832257-118832279 GAAAATGTACATATACACCATGG + Intergenic
1046886157 8:119369510-119369532 GAAAATGTACATATACACCATGG + Intergenic
1047906096 8:129474789-129474811 GTATATGTATATATACACATAGG - Intergenic
1048417721 8:134245011-134245033 GAAAATGTACATATACACCATGG - Intergenic
1048761410 8:137799475-137799497 GAAAATGTACATATACACCACGG - Intergenic
1050477057 9:6051137-6051159 ATATATGTATATATATACCATGG + Intergenic
1050635790 9:7611053-7611075 GTATATATATATATACATGATGG - Intergenic
1050826039 9:9947638-9947660 ATATATATATATATACACCATGG + Intronic
1051073954 9:13207710-13207732 GTTTATGACTATATACTCCAAGG + Intronic
1051470684 9:17437821-17437843 GTGTGTGTGTATATATAACATGG + Intronic
1051566336 9:18503414-18503436 ATATATATATATATACACAATGG - Intronic
1051792833 9:20827522-20827544 GTATGTATGTATACACACCATGG + Intronic
1051852461 9:21525544-21525566 GAAAATGTACATATACACCATGG - Intergenic
1051929952 9:22373132-22373154 ATATATATGTATATACACCATGG + Intergenic
1052439683 9:28479889-28479911 GTGTATGTGTATATATACGTAGG + Intronic
1052628977 9:31012704-31012726 ATATATATATATATACACCATGG - Intergenic
1052628978 9:31012753-31012775 ATATATATATATATACACCATGG + Intergenic
1052636815 9:31117059-31117081 GAAAATGTACATATACACCATGG - Intergenic
1052734456 9:32325940-32325962 GTATAGCTATATTTACACCACGG - Intergenic
1052777560 9:32748022-32748044 GTATATATATATATACACGATGG - Intergenic
1053094697 9:35314792-35314814 ATATATATATATACACACCATGG - Intronic
1053127059 9:35590563-35590585 ATACATATATATATACACCATGG + Intergenic
1053188853 9:36042761-36042783 GTAAATGAGTATAACCACCATGG - Intronic
1055254183 9:74346764-74346786 ATATGTGTGTATATATACGACGG - Intergenic
1055254184 9:74346792-74346814 ATATGTGTGTATATAAACGACGG - Intergenic
1055254185 9:74346820-74346842 ATATGTGTGTATATATACGACGG - Intergenic
1055254186 9:74346848-74346870 ATATGTGTGTATATATACGACGG - Intergenic
1055254187 9:74346876-74346898 ATATGTGTGTATATATACGACGG - Intergenic
1055254188 9:74346904-74346926 ATATGTGTGTATATATACGACGG - Intergenic
1055254189 9:74346932-74346954 ATATGTGTGTATATATACGACGG - Intergenic
1055254190 9:74346960-74346982 ATATGTGTGTATATATACGACGG - Intergenic
1055254191 9:74346988-74347010 ATATGTGTGTATATATACGACGG - Intergenic
1055362914 9:75513537-75513559 ATCAATGTGTATATAAACCATGG + Intergenic
1056027116 9:82510552-82510574 ACACATATGTATATACACCATGG + Intergenic
1056107061 9:83357083-83357105 ATAGATATATATATACACCATGG - Intronic
1056588670 9:87946818-87946840 GTATATATATATATATACAATGG - Intergenic
1057088964 9:92239031-92239053 TTCTCTGTGTATATACACTAAGG - Intronic
1058348600 9:103994571-103994593 GTATATATATACATACACCATGG + Intergenic
1058516883 9:105785050-105785072 GAAAATGTACATATACACCATGG - Intergenic
1058862644 9:109131517-109131539 GTATATTTGTACATACATGATGG - Exonic
1059016883 9:110528063-110528085 ATATATATATACATACACCATGG - Intronic
1059074955 9:111183009-111183031 GTATATATATATATGCACAATGG - Intergenic
1060200184 9:121647883-121647905 GTATATATGTATATATATGATGG + Intronic
1060239663 9:121892129-121892151 GTATGTGTGTATATATATAAAGG - Intronic
1060313171 9:122482641-122482663 GAAAATGTATATATACACAATGG + Intergenic
1185775082 X:2796442-2796464 GTATATATGTATATACATTTAGG + Intronic
1185933265 X:4227238-4227260 ATATATATGTATATATACGATGG + Intergenic
1185933267 X:4227265-4227287 GTATATATGTATATATATGATGG + Intergenic
1185939579 X:4300699-4300721 GAAAATGTGCATATCCACCATGG - Intergenic
1185967752 X:4626666-4626688 GAAAATGTATGTATACACCATGG - Intergenic
1186087570 X:6007076-6007098 ATAAATGTTTATATATACCATGG + Intronic
1186111794 X:6265764-6265786 AAATGTGTGTATCTACACCATGG + Intergenic
1187081321 X:15991736-15991758 ATATATATATATATACACAAAGG - Intergenic
1187653645 X:21442782-21442804 GAAAATGTATATATACACCATGG + Intronic
1188234076 X:27705163-27705185 GAATTGGTATATATACACCATGG - Intronic
1188295897 X:28447903-28447925 GAAAATGTACATATACACCATGG + Intergenic
1188707008 X:33347121-33347143 GAAAATGTATATATACACCATGG + Intergenic
1188758755 X:33999019-33999041 ATATATATATATATATACCATGG + Intergenic
1188824854 X:34819110-34819132 GACTATGTATATATACACAATGG - Intergenic
1189132040 X:38509695-38509717 GAAAATGTACATATACACCATGG + Intronic
1189150817 X:38704808-38704830 ATATATGTATATACACACAATGG + Intergenic
1189237603 X:39499762-39499784 GAAAATGTACATATACACCATGG - Intergenic
1189573909 X:42329522-42329544 AAATGTGTATATATACACCATGG + Intergenic
1189842613 X:45096991-45097013 GAAAATGTATATATACACCATGG + Intronic
1189925428 X:45948385-45948407 GTATATGTGTATATATATGTAGG + Intergenic
1190008938 X:46766500-46766522 GTATATATGTATATATCCAAGGG + Intergenic
1190957781 X:55212502-55212524 TTATATGTGGATATCCACCAAGG + Intronic
1190967465 X:55314233-55314255 GAAAATGTATAAATACACCATGG - Intergenic
1191199139 X:57760194-57760216 CTATATATGTATATGCATCATGG - Intergenic
1192164426 X:68818378-68818400 ATATATATATACATACACCATGG + Intergenic
1192666400 X:73092104-73092126 GTATACGTATATATACACCATGG - Intergenic
1192858994 X:75045522-75045544 GTACATGTGAATATATACCATGG + Intergenic
1193054021 X:77130705-77130727 TTATATATATATATACACCATGG + Intergenic
1193231052 X:79047089-79047111 GTATATATATACACACACCATGG + Intergenic
1193400888 X:81040821-81040843 GTAACTGTGTATATACCCAAAGG + Intergenic
1193633176 X:83915122-83915144 GAATATATATATATACACTATGG - Intergenic
1193638220 X:83979426-83979448 GAAAATGTATATATACACCATGG + Intergenic
1193703878 X:84796464-84796486 AAATGTGTGCATATACACCATGG + Intergenic
1193826491 X:86232971-86232993 GAAAATGTACATATACACCATGG + Intronic
1193989683 X:88291046-88291068 GTATATATATGTATACACCATGG - Intergenic
1193989685 X:88291117-88291139 GTGTATATATATATACACCATGG - Intergenic
1194138132 X:90173910-90173932 GTGTATATATATACACACCATGG - Intergenic
1194139140 X:90187176-90187198 GTTCATGTGTATATACGGCACGG + Intergenic
1194393458 X:93349335-93349357 GTTTATTTGGATATATACCAAGG - Intergenic
1194406477 X:93502506-93502528 GAAATTGTGGATATACACCATGG + Intergenic
1194516352 X:94859877-94859899 ATATAGATATATATACACCATGG + Intergenic
1194536591 X:95112339-95112361 ATATATGTATATATACTTCACGG + Intergenic
1194557343 X:95376710-95376732 AAAAATGTATATATACACCATGG + Intergenic
1194630703 X:96279912-96279934 GTATATATACATACACACCATGG + Intergenic
1194770005 X:97891436-97891458 ATATATATGTATACACACCATGG - Intergenic
1195471668 X:105237204-105237226 GAAAATGTGGGTATACACCATGG - Intronic
1196123458 X:112075033-112075055 GTATATTTGTTTATACATCTAGG - Intronic
1197018503 X:121656985-121657007 GTGTGTGTGTGTATACACAAAGG + Intergenic
1197192257 X:123660948-123660970 GTGTATATATATATACACAATGG + Intronic
1197258731 X:124293259-124293281 ACATATGTGTATATAGAGCATGG - Intronic
1197430195 X:126353074-126353096 GTATTTGTGCATGTACACAAAGG - Intergenic
1197564891 X:128070830-128070852 GAAAATGTAGATATACACCATGG - Intergenic
1198633575 X:138670618-138670640 ATATATGTGTATATATACACAGG + Intronic
1198646878 X:138817786-138817808 GTACATGTTTATCTACAACAAGG + Intronic
1198829507 X:140734035-140734057 GTATACGTGCTTATTCACCAGGG - Intergenic
1199176441 X:144792955-144792977 GTATATTTGTACAACCACCATGG + Intergenic
1199247407 X:145622439-145622461 ATATATATATATACACACCATGG + Intergenic
1199304636 X:146252947-146252969 GAAAATGTATATATACACAATGG + Intergenic
1199394171 X:147314834-147314856 GTGTATGTATATATACACATAGG - Intergenic
1199465524 X:148131751-148131773 GTGTATATATATATACACAATGG + Intergenic
1200354013 X:155528692-155528714 GAAAATGTATATATACACCATGG - Intronic
1200484881 Y:3756145-3756167 GTTCATGTGTATATACGGCACGG + Intergenic
1201295281 Y:12457027-12457049 GTATATGTGTATATACATTTAGG - Intergenic
1201556759 Y:15271145-15271167 GTATATATATATATGCACAAAGG - Intergenic
1201619095 Y:15935302-15935324 GAAAATGTGCATATACCCCAAGG - Intergenic
1201722911 Y:17121295-17121317 GAAAATGTGCATATTCACCATGG - Intergenic
1201793799 Y:17872617-17872639 ATATCTCTGTATATCCACCAGGG + Intergenic
1201807755 Y:18033369-18033391 ATATCTCTGTATATCCACCAGGG - Intergenic
1201972401 Y:19811995-19812017 GTATATGAGAATTTACACCCTGG - Intergenic
1202355184 Y:24040433-24040455 ATATCTCTGTATATCCACCAGGG + Intergenic
1202515594 Y:25629676-25629698 ATATCTCTGTATATCCACCAGGG - Intergenic