ID: 945626561

View in Genome Browser
Species Human (GRCh38)
Location 2:212214610-212214632
Sequence CCAGTTCTTGCTCTATGTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 189}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945626561_945626563 -1 Left 945626561 2:212214610-212214632 CCAGAACATAGAGCAAGAACTGG 0: 1
1: 0
2: 1
3: 13
4: 189
Right 945626563 2:212214632-212214654 GAATTTCCATACATTGCTGATGG 0: 1
1: 2
2: 24
3: 183
4: 1018
945626561_945626565 26 Left 945626561 2:212214610-212214632 CCAGAACATAGAGCAAGAACTGG 0: 1
1: 0
2: 1
3: 13
4: 189
Right 945626565 2:212214659-212214681 GTAAATTTGTACAATCTTTTTGG 0: 1
1: 1
2: 36
3: 364
4: 2507

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945626561 Original CRISPR CCAGTTCTTGCTCTATGTTC TGG (reversed) Intronic
900526382 1:3130868-3130890 CCAGCCCTTGCTCTATGCTCAGG + Intronic
901849218 1:12004833-12004855 CCAGTCCTTCCTCTATGTGGCGG - Exonic
907250425 1:53134429-53134451 CCAGTTCTTACTGTGTTTTCAGG - Exonic
907990946 1:59582222-59582244 CAAGTTCTTGCTCTGTTCTCAGG - Intronic
910433645 1:87182862-87182884 CCAGTTCTTGCCCTGTTCTCTGG - Intergenic
910961196 1:92765425-92765447 ACAGTACTTGCTATATGTTTTGG - Intronic
911881378 1:103242984-103243006 CCAGTCATTGTTCTAGGTTCTGG - Intergenic
918566313 1:185937546-185937568 CCAGTTCTTGCCTTATGTTATGG - Intronic
921327133 1:213997474-213997496 CCATTTCCTGCTCTCTGATCAGG - Exonic
921625449 1:217373619-217373641 TGAGTTCTTGTCCTATGTTCAGG - Intergenic
1063985929 10:11501831-11501853 TCAGTTCTTGCTATTTCTTCAGG + Intronic
1067165430 10:43863261-43863283 CCATGTCTTGCTCTATGATTTGG - Intergenic
1069593015 10:69653479-69653501 TCAGTTCTTGCCCTGTGTCCAGG - Intergenic
1072056228 10:91759546-91759568 CTAGTTCTTGATCTAGGTGCTGG - Intergenic
1072251781 10:93587390-93587412 CCAGGTCTTGCTTGAAGTTCTGG - Exonic
1075919305 10:126197343-126197365 CCCGAGCTTGTTCTATGTTCTGG - Intronic
1079560152 11:21811611-21811633 GCTGTTCATGCTCTATTTTCTGG - Intergenic
1081581373 11:44354608-44354630 TCACTTCCTCCTCTATGTTCGGG + Intergenic
1082259444 11:50066754-50066776 TCAGTTCTTCCTTTAAGTTCTGG - Intergenic
1084605832 11:70171111-70171133 CCAGCTCTGGCTCTAGCTTCTGG - Intronic
1086255127 11:84866637-84866659 CCATTTCTTGCTCTATTTACAGG + Intronic
1087534346 11:99424831-99424853 TGAGTTCTTGTTCTATGTCCAGG + Intronic
1088071706 11:105794373-105794395 CCAGTTCCTGTTCTATTTGCTGG - Intronic
1088445989 11:109929262-109929284 AAATTTCTTGATCTATGTTCTGG + Intergenic
1091124928 11:133085478-133085500 ATAGTTTTTGCTCTATGTGCTGG - Intronic
1091199005 11:133757391-133757413 CCAGTTCTTGCACCATCTACAGG - Intergenic
1092773051 12:11915997-11916019 AAAGATGTTGCTCTATGTTCTGG + Intergenic
1092978794 12:13772664-13772686 CCTCTTCTTGCTCTTAGTTCAGG - Intronic
1093385366 12:18547268-18547290 CAATTTCTTGCTGTATATTCTGG - Intronic
1093716833 12:22392220-22392242 CCAGCTGTTGCCCTATGTTCCGG + Intronic
1095157955 12:38881425-38881447 AAAGTTCTTGCTGTATATTCAGG - Intronic
1098430319 12:70412155-70412177 CCAGTTCTGGCTTTCTGTCCTGG + Intronic
1098601298 12:72334657-72334679 CCAGTTCTAGAGCTATGGTCAGG - Intronic
1098799859 12:74941894-74941916 CCACTTCTTGCTGAGTGTTCTGG - Intergenic
1098926171 12:76351182-76351204 CCCATTCTTGCTCTCTGCTCAGG - Intergenic
1099295459 12:80823159-80823181 CAAGTTCTTGTCCTATGTCCAGG - Intronic
1101488217 12:105187161-105187183 CCTGTTCTTTCACTATGTCCTGG - Intronic
1101945081 12:109130444-109130466 CCAGTTCTTCCGCTATATTGAGG - Intronic
1102606908 12:114074822-114074844 CCAGCTCTGGCTCCATGTGCTGG - Intergenic
1105978944 13:25499109-25499131 CCAATTGTTGCCCTATATTCTGG + Intronic
1106185950 13:27410064-27410086 CCTTTTTTTGCTCTATTTTCTGG - Intergenic
1106979036 13:35255842-35255864 CAAGTTCTTGACCCATGTTCAGG + Intronic
1111268887 13:85854150-85854172 CCAGTTCTTGTCCCATGTCCAGG - Intergenic
1112086180 13:96034448-96034470 CAAGTTCTTGTTGCATGTTCAGG - Intronic
1112163932 13:96897494-96897516 CAAGGCCTTGCTCTTTGTTCAGG - Intergenic
1113724284 13:112587154-112587176 CCATTTCTTGCTCCTTGTTTTGG - Intronic
1118532707 14:66724859-66724881 CCAGCTTTTTCTCTACGTTCAGG - Intronic
1120408600 14:84121179-84121201 CCAGTTTTTCCTCAATGATCTGG + Intergenic
1121393503 14:93596938-93596960 CCAGTACTGGCTCTGGGTTCTGG - Intronic
1121476949 14:94217525-94217547 CCTGTTGTTGCTTTATGTTTTGG - Intronic
1121537396 14:94700168-94700190 CGCGTTCTTGCTCTTTGTTTTGG - Intergenic
1125756932 15:42070777-42070799 CCAGCTCTCCCTCCATGTTCCGG - Exonic
1126082916 15:44983189-44983211 CAGGGTCTTGCTCTATGGTCAGG + Intergenic
1126156823 15:45573796-45573818 CAAGTTCTTGTCCTATGTCCAGG + Intergenic
1126171529 15:45699378-45699400 CCAAGTCTTGCTCTTGGTTCGGG - Intergenic
1127353522 15:58175706-58175728 TAAGTTCTTCCTCTATGATCAGG + Intronic
1130632157 15:85580366-85580388 CCAGTTCTTTCTCCATTTTAGGG - Exonic
1131353819 15:91725451-91725473 CCAGTTCTCACTCACTGTTCTGG - Intergenic
1134558124 16:15183922-15183944 CCAGTGCTTGAACTATGATCAGG + Intergenic
1134569941 16:15282457-15282479 CTAGTTCTTGTTCTAGGTGCTGG - Intergenic
1134732438 16:16473595-16473617 CTAGTTCTTGTTCTAGGTGCTGG + Intergenic
1134918657 16:18095524-18095546 CCAGTGCTTGAACTATGATCAGG + Intergenic
1134935001 16:18238371-18238393 CTAGTTCTTGTTCTAGGTGCTGG - Intergenic
1136483084 16:30555084-30555106 CCAGCTCTTGCCCTAGATTCTGG + Exonic
1137313728 16:47294007-47294029 TCAGTTCTTGATCCATGTTGAGG + Intronic
1138401434 16:56748068-56748090 CCTGTTCTTGGGCTATGTTCAGG + Intronic
1138733539 16:59223673-59223695 CCAGGTATTGCTCAATTTTCTGG + Intergenic
1140051341 16:71484251-71484273 CCAGTTCCTGCTCTAGATTCCGG - Intronic
1140626374 16:76799723-76799745 CCACAACTTTCTCTATGTTCTGG - Intergenic
1143505552 17:7362771-7362793 CGAAGTCTTGCTCTATCTTCAGG - Intergenic
1144091079 17:11857086-11857108 GCAGTTCTTGTTATATTTTCTGG - Intronic
1147749226 17:42718379-42718401 CCATTTCCTTCTCTTTGTTCTGG - Intronic
1149904662 17:60514514-60514536 TCCCTACTTGCTCTATGTTCTGG + Intronic
1151359326 17:73579089-73579111 CCAGTTCTAGCTCTTTCCTCTGG + Intronic
1152083709 17:78204806-78204828 CCAGCTCATGCTCTCTGTGCAGG + Exonic
1154020425 18:10659992-10660014 CCAGGGCTTGCTATTTGTTCAGG - Intergenic
1154024234 18:10691936-10691958 CCAGTTCTGTCTATATGTTATGG + Intronic
1155895902 18:31325306-31325328 CCAGTGCTTGCTGTTTGTTTTGG - Intronic
1159939161 18:74392916-74392938 TCTCTTTTTGCTCTATGTTCTGG - Intergenic
1162395169 19:10413971-10413993 CCATTTCTTGCTCTGTTTGCTGG + Intronic
1162839666 19:13347083-13347105 ACAGTTCTTGCTCTGTCATCCGG + Intronic
925207127 2:2016278-2016300 CATCTTCTTGCTCTGTGTTCTGG - Intronic
925231737 2:2238947-2238969 CCAGTTCTCACTCTTTGTGCAGG - Intronic
925711207 2:6742666-6742688 CCAGTGCTTGCTCTATGGTCCGG - Intergenic
929819761 2:45263705-45263727 CCCGAACTTGCTCTATGCTCAGG - Intergenic
931509686 2:62977314-62977336 ACTGTTTTTGCCCTATGTTCAGG + Intronic
931653851 2:64492168-64492190 ACTGCTCTTGCTATATGTTCGGG - Intergenic
931683672 2:64773849-64773871 CTATTTCTTGCTTTATGTTTTGG + Intergenic
932246665 2:70202377-70202399 GCTGTTCATGCTCTATTTTCTGG - Intronic
934952726 2:98589562-98589584 CCAATTTTTGCTCTATGTAATGG + Exonic
939017578 2:136920160-136920182 CAAGTTCTTGTCCCATGTTCAGG + Intronic
939084905 2:137707734-137707756 CAAGTTCTTGTCCTATGTCCAGG + Intergenic
940179279 2:150914135-150914157 CCAGTTCCTGCTCCATGAACTGG - Intergenic
940560316 2:155287482-155287504 CAAGTTTATGCTCTATTTTCAGG - Intergenic
941879562 2:170467049-170467071 CCAGTTCTTCTTCCAGGTTCTGG + Intronic
942525630 2:176849850-176849872 CCAGTCCTTGCTCTATTCTAAGG - Intergenic
942677333 2:178441704-178441726 CCATTTCTTTTTCTTTGTTCAGG - Exonic
944848783 2:203695803-203695825 CCACTTATTGCTCTCTGGTCAGG - Intergenic
945464092 2:210146319-210146341 CTAGTTCTTGTTTTTTGTTCGGG + Intronic
945626561 2:212214610-212214632 CCAGTTCTTGCTCTATGTTCTGG - Intronic
946281091 2:218665969-218665991 TCAGCTCTTGCTCCATGTGCTGG + Exonic
947875067 2:233462372-233462394 CCAGTTCCTGCTCCATGTCCCGG - Exonic
948334875 2:237200121-237200143 CAAGTTCTTGCCCCATGTCCAGG + Intergenic
1169384506 20:5136793-5136815 CCAATTCTTGTTTTAGGTTCAGG + Intronic
1170033668 20:11968215-11968237 CCAGTTCTTCCTCACTGTTGGGG - Intergenic
1170363629 20:15575778-15575800 CCAGTTTTTGCTCTGGGTGCTGG - Intronic
1170522969 20:17207371-17207393 TCAGTTCTTTCACTATTTTCAGG + Intergenic
1174144662 20:48443341-48443363 CCAGGACATGCTCTTTGTTCTGG - Intergenic
1174203525 20:48823590-48823612 CGAGTTCTTGCTCTGGGCTCCGG - Intronic
1174500316 20:50979534-50979556 CAAGGTCTTGCTCTGTTTTCAGG - Intergenic
1176004879 20:62855867-62855889 CCAGTTTCTGCTTTAAGTTCAGG - Intronic
1182965123 22:34514147-34514169 CCATTTCTTTCTCTCCGTTCTGG - Intergenic
1183793332 22:40092698-40092720 CAAGGTCTTGCTCTGTGTCCTGG + Intronic
1184205278 22:42998446-42998468 CCTTTTCTTGCTCTGTGTTTTGG - Intronic
950213676 3:11142402-11142424 CCAGTTACTGCTCTAAGTGCTGG + Intronic
950416674 3:12872889-12872911 CCCGTTCCTGCTCTTTGTTGGGG - Intergenic
952504883 3:33998732-33998754 CAAACTCTTGCTCTAGGTTCTGG - Intergenic
955043995 3:55342788-55342810 CCAGATCTTGCTGAATGTGCAGG - Intergenic
956977844 3:74602269-74602291 CCAGGTCTTGCTCTGTGGCCTGG - Intergenic
957937649 3:86965378-86965400 CCGTTTCTGGCTGTATGTTCAGG + Intronic
958033871 3:88148291-88148313 CCAGTTATTGTTCTTTGTACTGG - Intronic
958161163 3:89818302-89818324 TGAGTTCTTGCCCCATGTTCAGG + Intergenic
959183954 3:103020112-103020134 CCAGGTGTGGCTCTATGTCCTGG - Intergenic
961116535 3:124334644-124334666 CCAGTTTTTGTTCTGTGTTTTGG - Intronic
962056616 3:131878876-131878898 CCAGGCCTTGTTCTAGGTTCTGG + Intronic
962117841 3:132530865-132530887 CTAGTTCTTGCTCCATATTTGGG + Intronic
964202947 3:154138826-154138848 TCTGTTCTTGCTCTATCTCCAGG - Intronic
965117859 3:164515062-164515084 CCAGTTCTTGTCCCATGTCCTGG + Intergenic
965253472 3:166371897-166371919 CCTTTTCTTGATCTAAGTTCTGG + Intergenic
965807129 3:172553239-172553261 TGAGTTCTTGCTCTGAGTTCAGG - Intergenic
966629464 3:182056357-182056379 CCAAATATTGTTCTATGTTCTGG - Intergenic
967520762 3:190429644-190429666 CCTGTTCCTGCTCCATGTTTTGG - Exonic
967999904 3:195198168-195198190 TCAGTACTTGCTCCATGGTCAGG - Intronic
973796171 4:54428799-54428821 CAAGGTCTTGCTCTATCTCCCGG - Intergenic
973907817 4:55547949-55547971 TCAATTCTTGCTGTATGCTCTGG + Intergenic
974278431 4:59758809-59758831 CAAGTTCTTTTCCTATGTTCAGG + Intergenic
974420200 4:61663089-61663111 CGAGTTCTTGTCCCATGTTCAGG - Intronic
978248511 4:106603951-106603973 CGAGTTCTTGTCCTATGTCCAGG + Intergenic
980025681 4:127763376-127763398 CAATTTCTTGCTTTATTTTCTGG - Intronic
980655543 4:135779313-135779335 CCAGTTCTTGCTCTATTGCATGG + Intergenic
982823238 4:159970517-159970539 CCAGGGCTTGCTCTAGGTTGTGG + Intergenic
983715508 4:170776799-170776821 CTAGTTCTTGCCCTGTGTCCAGG - Intergenic
985081746 4:186272618-186272640 CCAATCCCTGCTCTAGGTTCTGG - Intronic
986613848 5:9596914-9596936 CCAGGTCCTGCTCTAGGTGCTGG - Intergenic
986957834 5:13176505-13176527 CCAGTTCAGGCTAGATGTTCAGG - Intergenic
987190208 5:15469841-15469863 CCAGTTCTTGTCCAATGTCCAGG + Intergenic
987951883 5:24686890-24686912 CAAGTTCTTGATCTGTGTCCAGG + Intergenic
989821746 5:45801023-45801045 CGAGTTCTTGTTCTGTGTCCAGG - Intergenic
998139344 5:139690962-139690984 CCACCTCTAGCTCTATGTTAGGG - Intergenic
998742933 5:145225636-145225658 CAAGTTCTCATTCTATGTTCTGG - Intergenic
999745995 5:154592283-154592305 CCTGTTCTTACTTTAAGTTCTGG + Intergenic
999968163 5:156832098-156832120 CCAGTTTTTGCCCTGTGTCCTGG - Intergenic
1002304677 5:178276165-178276187 GCTCTTCTTGCTCTATGTTAGGG + Intronic
1003373353 6:5550299-5550321 CCAGGTCTTGCTCTTTCATCAGG + Intronic
1003439049 6:6122584-6122606 CGAGTTCTTGCCCTGTGTCCAGG - Intergenic
1003673806 6:8184268-8184290 CAATTTCTTACTCTATGTTCAGG + Intergenic
1005696449 6:28356574-28356596 GCTGTTCATGCTCTATTTTCTGG + Intronic
1008979705 6:57468844-57468866 CCATTTCTTCATGTATGTTCAGG + Intronic
1009167828 6:60361759-60361781 CCATTTCTTCATGTATGTTCAGG + Intergenic
1012009602 6:93766305-93766327 CCAGTTATTCTTCTATTTTCAGG - Intergenic
1013750864 6:113404580-113404602 CTCTTTCTTACTCTATGTTCTGG - Intergenic
1015384863 6:132610486-132610508 CCAGTTTTTGCTCTTTCTTGGGG - Intergenic
1016210889 6:141531969-141531991 CAAGTTCTTGTTCCATGTCCAGG - Intergenic
1016927926 6:149371435-149371457 CCTGTTCATACCCTATGTTCTGG + Intronic
1018307840 6:162476885-162476907 CCATTTATTGCTGTATATTCTGG - Intronic
1019587033 7:1810700-1810722 CCAGTTCTTTCTCGAGGTTCTGG + Intergenic
1019925174 7:4186886-4186908 CCAGTTCTTGCCCTGTGCTTTGG + Intronic
1020338111 7:7080178-7080200 CCATTTCCTTCTCTATGATCAGG - Intergenic
1024180613 7:46889818-46889840 AAAGTTCTTGCTTTATGTTGAGG - Intergenic
1026793075 7:73347479-73347501 CCACTTCTTGATTTATGTTTTGG + Intronic
1030874095 7:114792139-114792161 CCAGTTCTAGCTTTTTGTTAAGG + Intergenic
1032953330 7:136941908-136941930 CCAGTTCTAGCTATATGACCTGG + Intronic
1034252138 7:149701229-149701251 CCAGTTCTTGTCCCATGTCCAGG + Intergenic
1034495254 7:151417037-151417059 CCCGTTCCTGCTCTGTGGTCTGG - Intergenic
1037467059 8:19171645-19171667 ACATTTCTTCCTATATGTTCAGG - Intergenic
1037907651 8:22724888-22724910 CCAGTTCTTTGTCTATCTTCAGG - Exonic
1038159034 8:25019239-25019261 GCAGCTCTAGCTCCATGTTCTGG - Intergenic
1038805333 8:30785544-30785566 CCAGGTCTTGCTCTGTCATCTGG - Intronic
1039733144 8:40301467-40301489 ACAGTTCTTCCTCTTTGTTTTGG - Intergenic
1039822022 8:41142801-41142823 CATATTCTTGCTCTGTGTTCTGG - Intergenic
1039845595 8:41323431-41323453 GCAGTGCTTGTTCTATGCTCAGG - Intergenic
1041966041 8:63678194-63678216 TGAGTTCTAGCTCCATGTTCAGG + Intergenic
1042574691 8:70204981-70205003 CAAGGTCTTGCTCTGTCTTCCGG - Intronic
1043417139 8:80062945-80062967 CAAGGTCTTGCTCTATTTTGTGG - Intronic
1045361216 8:101435165-101435187 CAAGGTCTTGCTCTGTTTTCTGG + Intergenic
1047400045 8:124538840-124538862 CTGGTTCTTGATCTAGGTTCTGG - Intronic
1048847465 8:138614566-138614588 CCAGCTCTAGCCCTATGTACTGG + Intronic
1049203480 8:141352767-141352789 CCAGTTCTCGGTCTCTGGTCTGG - Intergenic
1051495315 9:17716313-17716335 ACAGTTCTTGGTCTTTGTTCTGG + Intronic
1052812492 9:33073969-33073991 CCAGTTCTGTCTCTATGGTTAGG - Intronic
1056289034 9:85123226-85123248 TCACTTCTTTTTCTATGTTCTGG - Intergenic
1058369297 9:104246304-104246326 CCATTTCTTGGTCTAGGTGCTGG - Intergenic
1059387811 9:113978539-113978561 CCAGTTCTGTCTGTATGCTCAGG + Intronic
1059871152 9:118578987-118579009 CCAGTCTTTGGTCTATGTTCTGG + Intergenic
1061218966 9:129237834-129237856 CCAGGGCTTGCTCTCTGTACTGG + Intergenic
1061766154 9:132882682-132882704 CCAGTCCATGCTAAATGTTCTGG + Intronic
1186581426 X:10823726-10823748 CCAGTTCTTGTTTTATTTACTGG - Intronic
1187209449 X:17214726-17214748 CCCATTCTTTCTCTATCTTCTGG - Intergenic
1188086618 X:25907012-25907034 ACAGTTCTTTCTCTATGGTCTGG - Intergenic
1190291386 X:48995054-48995076 CCACCACATGCTCTATGTTCTGG - Intronic
1198330482 X:135618144-135618166 CCATTTCTTTCTCAAGGTTCTGG - Intergenic
1198961965 X:142193035-142193057 CTAGTCCTTGCACTGTGTTCAGG + Intergenic
1200834553 Y:7720360-7720382 CTATTTCTTGATCTATGTGCTGG + Intergenic
1202143243 Y:21751172-21751194 CCAGCTTTTTCTCTATGTGCTGG + Intergenic