ID: 945627066

View in Genome Browser
Species Human (GRCh38)
Location 2:212222764-212222786
Sequence CCTAATTTTGCATATTTTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 510
Summary {0: 1, 1: 0, 2: 4, 3: 47, 4: 458}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945627060_945627066 25 Left 945627060 2:212222716-212222738 CCTCTTTAATAAAACTGCAGTTT 0: 1
1: 0
2: 1
3: 32
4: 438
Right 945627066 2:212222764-212222786 CCTAATTTTGCATATTTTGGGGG 0: 1
1: 0
2: 4
3: 47
4: 458
945627061_945627066 1 Left 945627061 2:212222740-212222762 CCTTCATAGTTGTTACTAATATT 0: 1
1: 0
2: 1
3: 35
4: 295
Right 945627066 2:212222764-212222786 CCTAATTTTGCATATTTTGGGGG 0: 1
1: 0
2: 4
3: 47
4: 458

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945627066 Original CRISPR CCTAATTTTGCATATTTTGG GGG Intronic
900723449 1:4196751-4196773 CATAATTTTGCATTATTTTGAGG - Intergenic
903201847 1:21747265-21747287 TCTAATTGTACATGTTTTGGAGG - Intronic
903898586 1:26625285-26625307 GCTAATTTTGCATTTTTAGTAGG - Intergenic
904002465 1:27346595-27346617 GCTAATTTTTTATATTTTGTAGG - Intronic
904630045 1:31834153-31834175 GCTAATTTTGTATTTTTTAGTGG - Intergenic
905696048 1:39974443-39974465 GCTAATTTTGTATTTTTTGTAGG - Intergenic
906002349 1:42437844-42437866 GCTAATTTTGTATATTTAGACGG + Intronic
906861732 1:49368042-49368064 CCTCACTTTGCATATTTTTCAGG + Intronic
908015633 1:59831245-59831267 CCTATTTTTGGCTATTGTGGGGG + Intronic
910521445 1:88126428-88126450 CATAAATATGTATATTTTGGAGG - Intergenic
911465991 1:98252732-98252754 AATAATTATGCATATTTTGGGGG - Intergenic
911508194 1:98780018-98780040 CCTAATTTTGCAGATATTCTAGG - Intergenic
911509847 1:98798176-98798198 CATAGTTGTACATATTTTGGGGG + Intergenic
911741478 1:101390906-101390928 CCTAGTGTTGCATATTTAGTTGG + Intergenic
912285616 1:108365469-108365491 CCTAATGTTCCCTATTTTGGAGG - Intergenic
912434420 1:109650404-109650426 CCAATTTTTGCAGATTTTTGTGG - Intergenic
915099425 1:153488471-153488493 CCTAGTTGTACATATTTTTGGGG - Intergenic
916869012 1:168892235-168892257 CATATTCTTGTATATTTTGGGGG + Intergenic
917273798 1:173307909-173307931 CCTAATCATGCATAATTTTGAGG - Intergenic
917318022 1:173748626-173748648 CCTAATTTAGCATATTGTTTTGG - Intronic
918493951 1:185113055-185113077 TATAATTGTACATATTTTGGGGG - Intergenic
919021632 1:192113440-192113462 CCTATTTTTGCATAATTAGAAGG + Intergenic
919369722 1:196708235-196708257 GCTTATTTTGAATAGTTTGGGGG - Intronic
920114293 1:203609132-203609154 GCTAATTTTGCATTTTTAGTAGG + Intergenic
920267960 1:204739855-204739877 TCTAGTTTTCCCTATTTTGGTGG + Intergenic
921072612 1:211674979-211675001 CCTAATAATGGATATTTTGAGGG + Intronic
921113683 1:212065395-212065417 CATAATTTTACATATTTTGGGGG + Intronic
921417534 1:214907510-214907532 CGTCATTTTGCATAATTTAGTGG + Intergenic
921624856 1:217368665-217368687 CCTAATATTGGACATTTAGGAGG + Intergenic
921909703 1:220534187-220534209 TCTATTAGTGCATATTTTGGGGG + Intronic
922126205 1:222726550-222726572 GCTAATTTTGTATGTTTTAGTGG - Intronic
922302862 1:224318435-224318457 GCTAATTTTTAATATTTTGTAGG - Intronic
922423941 1:225477002-225477024 GCTAATTTTTTGTATTTTGGTGG - Intergenic
922899728 1:229127069-229127091 AATAGTTGTGCATATTTTGGGGG + Intergenic
923699533 1:236286621-236286643 ACAGATTTTGCATATTTTGGTGG + Intergenic
923715001 1:236417560-236417582 CCTGATTTTACAGTTTTTGGGGG + Intronic
1064618368 10:17187869-17187891 TCTAATTTTGGATATTTTCATGG - Intronic
1065037669 10:21656327-21656349 CGTAGTTGTACATATTTTGGAGG + Intronic
1065413463 10:25457553-25457575 GCTAATTTTGCATATTTTTACGG + Intronic
1065548182 10:26843286-26843308 GCTAATTTTGTATTTTTTAGTGG - Intronic
1066183393 10:32984993-32985015 GCTAATTTTTTATATTTTAGTGG - Intronic
1066599328 10:37087099-37087121 TACAATTGTGCATATTTTGGTGG + Intergenic
1068425190 10:56851448-56851470 CCTACTTACACATATTTTGGGGG + Intergenic
1068640981 10:59407443-59407465 CATAATTGTGCATATTTATGTGG + Intergenic
1068750230 10:60584002-60584024 CATAATCATACATATTTTGGGGG - Intronic
1069082609 10:64104267-64104289 GCTAATTTTGGAATTTTTGGGGG + Intergenic
1071194467 10:83141898-83141920 AATAATTGTACATATTTTGGGGG - Intergenic
1071477908 10:86040854-86040876 AATAATTGTACATATTTTGGGGG - Intronic
1071861755 10:89681396-89681418 CTTAATTTTACATCTTTTGTAGG - Intergenic
1072126590 10:92450926-92450948 CTTAACCTTGCCTATTTTGGGGG - Intergenic
1072282278 10:93877689-93877711 GCTAATTTTTTGTATTTTGGGGG - Intergenic
1073613512 10:104968875-104968897 CCCAATTTTAAATATTTTGAGGG + Intronic
1073640212 10:105244902-105244924 GCTAATTTTTTATATTTTAGTGG - Intronic
1073645806 10:105302365-105302387 TCTGATATTGCATATTTTTGTGG - Intergenic
1073893659 10:108128820-108128842 ACTAATTATGCATATTGTGATGG - Intergenic
1074066122 10:110015538-110015560 GCTAATTTTTTATATTTTAGTGG + Intronic
1074329237 10:112487422-112487444 CCTAATCTTGCATTTTTGAGAGG + Intronic
1074595302 10:114858983-114859005 CATAATTGTACCTATTTTGGGGG - Intronic
1075775021 10:124977543-124977565 CTAAATTTTGTATTTTTTGGTGG - Intronic
1076303795 10:129448970-129448992 GCTAATTTTGAATGTTTTAGAGG - Intergenic
1078506483 11:11952720-11952742 CCTAATCTTGCATATTCTTAGGG + Exonic
1078768790 11:14327339-14327361 CTTTATTTTGCATTTTTGGGTGG - Intronic
1078824075 11:14910273-14910295 TCAAAGATTGCATATTTTGGAGG + Intronic
1078982731 11:16555455-16555477 AATAATTGTGTATATTTTGGGGG + Intronic
1079714475 11:23728232-23728254 CCTATTTTTACATTTTATGGTGG - Intergenic
1081901566 11:46633188-46633210 CTAATTTTTGTATATTTTGGTGG + Intronic
1081923786 11:46805300-46805322 CCTGATTTAGCATATTCTGTGGG - Intronic
1083353734 11:62049530-62049552 GCTAATTTTGTATTTTTTAGTGG + Intergenic
1083566950 11:63727023-63727045 CTTAATTTTGTATTTTTTAGTGG - Intronic
1085722541 11:78925457-78925479 CCTTATTTTCCATATTTTCAGGG + Intronic
1085762485 11:79254199-79254221 CCTATCTTGGCATGTTTTGGGGG - Intronic
1085825033 11:79838116-79838138 TCTAATTTTTTAAATTTTGGGGG - Intergenic
1085890886 11:80577885-80577907 TACAATTGTGCATATTTTGGTGG - Intergenic
1086038421 11:82444926-82444948 ACTAATTTTGCAGATTCTGGTGG - Intergenic
1087195978 11:95304662-95304684 CCTTTTTTTGCACATTTGGGTGG + Intergenic
1087538903 11:99489917-99489939 AATACTTTTGCATATTATGGGGG + Intronic
1087876696 11:103367475-103367497 TGTAATTGTACATATTTTGGGGG + Intronic
1088559612 11:111099517-111099539 TATAATTTTGAATATTTTTGAGG + Intergenic
1088689393 11:112312217-112312239 CTTTATTTTGCACACTTTGGGGG + Intergenic
1089220067 11:116863392-116863414 GCTAATTTTTAATCTTTTGGGGG + Intronic
1089235294 11:117019182-117019204 GCTAATTTTTCATATTTTAGTGG + Intronic
1089618331 11:119707722-119707744 CATAGTTGTACATATTTTGGGGG + Intronic
1089713349 11:120333820-120333842 CCTATTTTTTTTTATTTTGGGGG + Intergenic
1089964055 11:122640932-122640954 CTGAATTTTGTATATTTTGGGGG + Intergenic
1089996459 11:122912574-122912596 CTAACTTTTGCATTTTTTGGTGG - Intronic
1090710737 11:129382674-129382696 CCTCATTTTGCATCTTCTGTTGG + Intronic
1092483223 12:8879324-8879346 GCTAATTTTGTATATTTAGTAGG - Intronic
1093091172 12:14922312-14922334 TCTAATTTTACTGATTTTGGTGG + Intronic
1095829395 12:46568578-46568600 GCTAATTTTGTATTTTTTAGTGG + Intergenic
1097421026 12:59379532-59379554 TCTAATTATGGATAATTTGGGGG - Intergenic
1097520591 12:60664845-60664867 AATAATTTTGCTTATTCTGGAGG + Intergenic
1098813829 12:75131068-75131090 TCTAGTTTTGTTTATTTTGGTGG - Intronic
1098953847 12:76668664-76668686 CCTTATTATGTCTATTTTGGGGG + Intergenic
1099159035 12:79216679-79216701 ATTATTTTGGCATATTTTGGAGG + Intronic
1099524628 12:83704740-83704762 GCTAATTTAACAAATTTTGGAGG - Intergenic
1099749156 12:86749494-86749516 CCTAATTTATAATATTTTGAGGG - Intronic
1099877030 12:88420114-88420136 CCTCATTATTCACATTTTGGTGG - Intergenic
1100346349 12:93735126-93735148 CATTTATTTGCATATTTTGGAGG - Intronic
1101409300 12:104456234-104456256 GTTAATTTTGAATAATTTGGAGG + Intronic
1101892322 12:108728387-108728409 CCTTATTTAGCATATTTTCAAGG - Intronic
1102094836 12:110229734-110229756 TACCATTTTGCATATTTTGGAGG + Intergenic
1102268517 12:111508741-111508763 CCTAAGTTTTCATTTGTTGGCGG - Intronic
1102845589 12:116178344-116178366 CCAATTTTTTCATAATTTGGAGG + Intronic
1103010889 12:117457421-117457443 CCTATTTTTGGGTATGTTGGTGG - Exonic
1103409669 12:120701785-120701807 CCTGATTTTGTACTTTTTGGTGG - Exonic
1104424163 12:128660833-128660855 CTTTATTTTAGATATTTTGGTGG - Intronic
1104510254 12:129371119-129371141 CATAGTTGTACATATTTTGGTGG - Intronic
1105702920 13:22947338-22947360 CATAAATTTTCATATTTTTGGGG - Intergenic
1105957012 13:25293180-25293202 ACTAATTTTGTATTTTTTAGTGG + Intergenic
1107587662 13:41869122-41869144 CCTATTTCAGCATATTTTGAAGG - Intronic
1108141055 13:47421920-47421942 CCTAACATTGCAAATTTTGTAGG - Intergenic
1108249877 13:48553520-48553542 CATAATTTTACATATTTATGGGG + Intergenic
1108791958 13:53980471-53980493 CATAATTTTACATATTTTGGGGG - Intergenic
1109290235 13:60465052-60465074 CATAATTATACATATTTTGGGGG - Intronic
1109755821 13:66758445-66758467 CATAATTGTGCATATTTGTGAGG + Intronic
1110724704 13:78806955-78806977 CATAGTTATGCATAGTTTGGGGG - Intergenic
1110846888 13:80199839-80199861 CATAACTTTCCATATTTTGTTGG + Intergenic
1111203348 13:84969312-84969334 AATAATTGTACATATTTTGGAGG + Intergenic
1111414240 13:87917908-87917930 CTTATTTTTGCATTTTTTTGTGG - Intergenic
1111419421 13:87992265-87992287 CTAAATTCTTCATATTTTGGTGG - Intergenic
1111565179 13:90004752-90004774 CCTAATTTTTCATTTTTTAAGGG - Intergenic
1112049739 13:95633516-95633538 CCTAATTTTGTATTTTTTTGTGG - Intronic
1112717803 13:102206514-102206536 GCTAATTTTGTATTTTTTGGTGG - Intronic
1113033763 13:106025435-106025457 ACTAATTGTACATATTTTGTGGG - Intergenic
1115546391 14:34468285-34468307 CCAGATTTTGTATGTTTTGGAGG - Intergenic
1115578509 14:34735433-34735455 CCTATTTTTTCATATTTTCATGG + Intergenic
1116141280 14:40997653-40997675 ACTAATTTTGAATTCTTTGGGGG + Intergenic
1116453898 14:45095471-45095493 CAAAATTTTTCATATTCTGGAGG - Exonic
1116645154 14:47518864-47518886 CCAACTTTTGCCTCTTTTGGAGG + Intronic
1116961250 14:50970404-50970426 GCTAATTTTGCATTTTTAGTAGG - Intergenic
1117773866 14:59162425-59162447 TATAATTTCCCATATTTTGGAGG - Intergenic
1118756038 14:68844285-68844307 CATAGTTATACATATTTTGGGGG + Intergenic
1119063019 14:71495489-71495511 CCTGATTTTGGTAATTTTGGGGG + Intronic
1120551383 14:85877134-85877156 CATTGATTTGCATATTTTGGTGG - Intergenic
1121074737 14:91059173-91059195 GCTAATTTTGTATTTTTTGTGGG - Intronic
1121147876 14:91601781-91601803 CCTAACTTTATATATTTTTGGGG - Intronic
1124101192 15:26695189-26695211 CCTAAGTGTACATTTTTTGGGGG - Intronic
1124597093 15:31100482-31100504 CATAGTTGTGCATATTGTGGGGG - Intronic
1124598150 15:31108656-31108678 GCTAATTTTGTATATTTTAGTGG + Intronic
1126258310 15:46654530-46654552 CCCAATTTTGCCGATTTTGAAGG - Intergenic
1126755720 15:51923217-51923239 CTAATTTTTGCATTTTTTGGTGG - Intronic
1127583233 15:60356614-60356636 CATAGTTTTACATATTTTGGGGG - Intronic
1128595493 15:68943624-68943646 CCTGATTTTACAGTTTTTGGGGG + Intronic
1129295981 15:74600385-74600407 GCTAATTTTGAATTTTTTAGTGG + Intronic
1129614432 15:77087210-77087232 CCTAACTTTGTACAATTTGGAGG - Intergenic
1134364987 16:13568883-13568905 GCTAAATTTGCATGGTTTGGAGG + Intergenic
1134420180 16:14080035-14080057 CCTAATGTTCCATCTTTTAGAGG + Intronic
1134452053 16:14369649-14369671 GCTAATTTTTAATTTTTTGGTGG - Intergenic
1134479877 16:14609599-14609621 CTTTATTTGGCGTATTTTGGGGG + Intronic
1135411155 16:22235660-22235682 ACTAATTTTGCATTTTTTAGTGG + Intronic
1138403746 16:56771126-56771148 CCTAATTTGGAAGATTTAGGGGG + Intronic
1138660404 16:58513299-58513321 CCTAATTTTGTGTATTCTGGTGG + Exonic
1138812713 16:60169753-60169775 CCTAATTTTTATTTTTTTGGGGG + Intergenic
1139015974 16:62689430-62689452 CATAATTGTGCATATTTATGGGG + Intergenic
1139621826 16:68151468-68151490 CTTAAAATTGCATCTTTTGGGGG + Intronic
1140540676 16:75753826-75753848 GCTAATTTTGTATTTTTTAGTGG - Intronic
1141481699 16:84310896-84310918 CCAGATTTTGAATATGTTGGGGG + Intronic
1144345140 17:14342888-14342910 AATAATTGTGCATATTTTGGGGG + Intronic
1145103995 17:20099721-20099743 CCTTATTTTATATATTTTGTGGG - Intronic
1146103277 17:30006820-30006842 GCTAATTTTGTTTATTTTTGTGG + Intronic
1147474583 17:40698624-40698646 TCTAGTTTTGCAGAATTTGGTGG - Exonic
1148065620 17:44867462-44867484 GCTAATTTTTTGTATTTTGGTGG + Intronic
1148572398 17:48680625-48680647 GCTAATTTTGTATTTTTTGTAGG - Intergenic
1149046662 17:52254540-52254562 CCTAATTTTTCATATATTTATGG + Intergenic
1150014441 17:61539480-61539502 GCTAATTTTGCATTTTTAGTAGG + Intergenic
1150328069 17:64272820-64272842 GCTAATTTTTTATATTTTAGTGG - Intergenic
1150480682 17:65506909-65506931 TGTAATTTTGCATAATTGGGGGG + Intergenic
1150662355 17:67094154-67094176 CTAAATTTTGTATTTTTTGGTGG - Intronic
1151462206 17:74261126-74261148 ACTACTTTTGCAGATTTTGCTGG + Exonic
1151868909 17:76823274-76823296 CCTAATTTTTAATTTTTTTGTGG + Intergenic
1152221571 17:79071322-79071344 GCTAATTTTTCATATTTTTTTGG + Intergenic
1153496064 18:5701049-5701071 CACAATTATGTATATTTTGGGGG + Intergenic
1155005889 18:21728681-21728703 AATAATTGTACATATTTTGGGGG + Intronic
1155900621 18:31385086-31385108 CATAAATTTGCATAATTTAGAGG - Intronic
1156195330 18:34768307-34768329 CCTTTTTTTGCTTTTTTTGGGGG - Intronic
1156443100 18:37211686-37211708 TCTAATTTTCTATAGTTTGGTGG + Intronic
1156446908 18:37243621-37243643 AATAAATTTGCATATTTTGTAGG - Exonic
1156794293 18:41023330-41023352 CCTAATCATGCATAATATGGAGG + Intergenic
1156883641 18:42109415-42109437 ATTAATTCTACATATTTTGGGGG + Intergenic
1157236951 18:45973879-45973901 CCTAATTTTGTATTTTTAGTAGG - Intergenic
1157797165 18:50585540-50585562 CATACTTTTGCACATTATGGGGG - Intronic
1158631659 18:59120506-59120528 CCTTAATTTGTAAATTTTGGGGG + Intergenic
1159152959 18:64544528-64544550 AATAGTTTTACATATTTTGGGGG + Intergenic
1159303311 18:66606235-66606257 ACTAATTTTTCATATATGGGGGG + Intergenic
1159549663 18:69881133-69881155 AATATTTGTGCATATTTTGGGGG - Intronic
1160180644 18:76632541-76632563 CATAACTTTACGTATTTTGGAGG - Intergenic
1160367434 18:78339345-78339367 CATAAATGTGTATATTTTGGGGG + Intergenic
1161052342 19:2171126-2171148 CTAAATTTTGTATTTTTTGGTGG + Intronic
1162103970 19:8358685-8358707 CCTAATCTTTTATTTTTTGGAGG + Intronic
1163947520 19:20553201-20553223 CCAAATTTTCCATATTTGTGAGG - Intronic
1164068525 19:21743694-21743716 CCTACTTTTCCATTATTTGGGGG - Intronic
1164683003 19:30148409-30148431 CCTCATTTTGCTCATTTTAGGGG + Intergenic
1165038798 19:33054363-33054385 ACTAATTTTGCATTTTTAGTAGG + Intronic
1166771099 19:45282829-45282851 CCTAATTTTTAATTTTTTAGGGG - Intronic
1167346802 19:48950989-48951011 GCTAATTTTGTATGTTTTGTAGG - Intergenic
1167537891 19:50066830-50066852 GGTAATTTTACATTTTTTGGCGG - Intergenic
1167885152 19:52493823-52493845 GCTAATTTTGCATTTTTAGTAGG - Intronic
1167889918 19:52530982-52531004 GCTAATTTTTCTTTTTTTGGGGG - Intronic
1168441249 19:56368983-56369005 TCTAATTTTGCTTACTTGGGTGG + Intergenic
925320416 2:2962108-2962130 CCGAATGTTACTTATTTTGGAGG - Intergenic
925375888 2:3385468-3385490 CTTAATTTTTATTATTTTGGTGG + Intronic
925404034 2:3594488-3594510 CCGAATCTTGCATGTTTTGGGGG - Intergenic
926741761 2:16117089-16117111 CCTACTTTGGCACATTTTGTTGG + Intergenic
927535754 2:23856872-23856894 CCTAATTTAGCATAATTTTTTGG - Intronic
928542916 2:32300099-32300121 GCTAATTTTGCATTTTTAGTAGG - Intronic
928763561 2:34613510-34613532 CTTATTTTTGTACATTTTGGTGG - Intergenic
928787093 2:34901607-34901629 CATAATTTTTAATATGTTGGTGG - Intergenic
929673246 2:43896369-43896391 CCTAATCTTGCATTTTTTAAGGG + Intronic
930015845 2:46970152-46970174 GCTAATTTTTTCTATTTTGGGGG + Intronic
930592604 2:53346874-53346896 CATAATTGTACATATTTTGGGGG + Intergenic
931142944 2:59483865-59483887 AATAATTATGTATATTTTGGGGG - Intergenic
931741160 2:65246239-65246261 CCCACATTTTCATATTTTGGAGG - Intronic
932978622 2:76635145-76635167 CCTGATCTTGCATAATTTGATGG - Intergenic
933449875 2:82434725-82434747 AATAATTTCACATATTTTGGGGG - Intergenic
935522952 2:104131709-104131731 ACTAATTTTACATATTTGTGGGG - Intergenic
935831345 2:107003985-107004007 ACTAATTTTGCAAATATTGAGGG + Intergenic
937129875 2:119501732-119501754 CATAGTTTTACATATTTTGGAGG - Intronic
937384327 2:121413844-121413866 CCTAATTTTGGTTATTTTCCTGG + Intronic
937757171 2:125554340-125554362 CCAAATTTTACATCTGTTGGGGG + Intergenic
938005059 2:127782504-127782526 CATAATTTTTCATAACTTGGGGG + Intronic
938645929 2:133330007-133330029 CATTATTTTCCAGATTTTGGAGG + Intronic
939168351 2:138664120-138664142 CATAATTTTGCAAAACTTGGTGG - Intergenic
939259756 2:139792203-139792225 CCTAATTGTGACTATTATGGAGG + Intergenic
939935464 2:148287271-148287293 CATAAATTTGCATATTTTATAGG + Intronic
939978027 2:148742613-148742635 GCTAATATTGCATTTTTTGTAGG - Intronic
940015996 2:149104930-149104952 CATAATTATGCATATTTATGGGG + Intronic
940389909 2:153120311-153120333 CTAAATTTTGCATATTTGAGGGG - Intergenic
940791902 2:158037825-158037847 AATATTTTTGCATTTTTTGGGGG + Intronic
940824299 2:158393374-158393396 CCTAATTTTGCTTAGGATGGAGG + Intronic
941094234 2:161217537-161217559 CTGAACTTTGCATATATTGGAGG - Intronic
941828346 2:169925132-169925154 GCTAATTTTCCAAATATTGGAGG - Intronic
941922585 2:170866276-170866298 GCTAATTTTTTGTATTTTGGTGG + Intergenic
942478019 2:176349691-176349713 CATAATTTTACATATTTATGGGG + Intergenic
943049413 2:182896930-182896952 CAGAATTTTCCATATTTTGAAGG - Intergenic
943236657 2:185329940-185329962 AATAATTTTACATATTTTTGGGG + Intergenic
943437871 2:187889553-187889575 AATAATTGTGCATATTTTTGAGG - Intergenic
943875221 2:193058711-193058733 CCTTATTTTGCTGATTTTGATGG + Intergenic
945243272 2:207696312-207696334 CTTAATTTTTTATATTTTAGTGG + Intergenic
945522940 2:210851469-210851491 AATAGTTTTGCAGATTTTGGTGG - Intergenic
945627066 2:212222764-212222786 CCTAATTTTGCATATTTTGGGGG + Intronic
945815976 2:214605350-214605372 CCTAATTTTGTATTTTTTTAAGG - Intergenic
946936270 2:224724138-224724160 CAGAATTGTACATATTTTGGGGG + Intergenic
947303256 2:228713709-228713731 CATAATTTTACAATTTTTGGTGG + Intergenic
947306221 2:228750441-228750463 TCTCATTATGCAAATTTTGGTGG + Intergenic
948195254 2:236090902-236090924 GCTAATTTTGCATTTTTAGTAGG + Intronic
949030418 2:241794263-241794285 CCTCATTTTAGATATTTTGTGGG + Intronic
949074147 2:242044577-242044599 CCTGATTTTGCATATTGAAGGGG - Intergenic
1168829360 20:836229-836251 CTAAATTTTACATTTTTTGGGGG + Intronic
1169897709 20:10522248-10522270 CTTAATGTTGCCTTTTTTGGGGG + Intronic
1170888417 20:20359497-20359519 GCTAATTTTGTATATTTAGTAGG - Intronic
1172739748 20:37156837-37156859 GCTAATTTTGCATTTTTAGTAGG + Intronic
1173088613 20:39949157-39949179 CCTAACTGTTTATATTTTGGGGG + Intergenic
1174467119 20:50726200-50726222 GCTAATTTTGTATTTTTTAGTGG + Intergenic
1174850411 20:53988529-53988551 CATAGTTTTACATATTTTCGGGG + Intronic
1175738356 20:61403052-61403074 GTTAATTTTGCAAATTTTGCAGG + Intronic
1175851446 20:62096194-62096216 GCTAATTTTTAATTTTTTGGTGG - Intergenic
1176958941 21:15138169-15138191 TCTAATTTTCCATATTTTTTTGG - Intergenic
1177677950 21:24327086-24327108 CATAATTGTGCATATTTATGGGG + Intergenic
1177711882 21:24786911-24786933 AATAATTATGCAAATTTTGGGGG - Intergenic
1177984575 21:27958533-27958555 CTTATTTTTGCTCATTTTGGGGG - Intergenic
1178972900 21:37196688-37196710 AATAATTTTGCATCATTTGGGGG + Intronic
1179175029 21:39002045-39002067 CCTATTTTGTCATATTTTGCTGG - Intergenic
1179497387 21:41781354-41781376 GCTAATTTTGTTTATTTTGGGGG - Intergenic
1182432887 22:30310981-30311003 CCCAATTTTCCACACTTTGGTGG - Intronic
1182898482 22:33878085-33878107 CATAATTTTAAATATTTTAGTGG - Intronic
1183253994 22:36749008-36749030 CATAGTTGTACATATTTTGGGGG + Intergenic
1183549441 22:38472862-38472884 GCTAATTTTGTATTTTTTAGTGG + Intronic
1183967922 22:41454199-41454221 GCCAATTTTTCATATTTTAGTGG - Intergenic
1185401462 22:50620337-50620359 GCTAATTTTGTATTTTTTAGTGG - Intergenic
1185412537 22:50692441-50692463 GCTAATTTTGTATTTTTTAGAGG + Intergenic
949149270 3:745135-745157 GCTAATTTTTTATATTTTTGTGG - Intergenic
949164078 3:916063-916085 CCTAAATTCGTATATGTTGGGGG - Intergenic
950022580 3:9798420-9798442 ACTATTTTTGCATATTTTTTTGG - Intronic
951195774 3:19821858-19821880 GCTAATTTTGTATTTTTTGTAGG - Intergenic
951448407 3:22809186-22809208 CATAATTGTGCATATTTATGAGG - Intergenic
953410273 3:42687003-42687025 CCCAAGTTGGCATATGTTGGAGG + Intronic
954382294 3:50226214-50226236 CCTCCTTTTGCATAGCTTGGCGG - Intergenic
955297868 3:57749820-57749842 ACTAATTTTGCATTTTTAGTAGG + Intergenic
955490809 3:59480357-59480379 CGTAATTGTACATAGTTTGGAGG - Intergenic
955739664 3:62076744-62076766 GCTAATTTTGTATTTTTTGTAGG + Intronic
955946514 3:64199596-64199618 CCAAATTTTCCCTATGTTGGTGG + Intronic
955973876 3:64462503-64462525 GTTATTTTTGCATTTTTTGGCGG - Intergenic
956123306 3:65987732-65987754 GCTAATTTTGCATTTTTTGTAGG + Intronic
956776154 3:72567272-72567294 CCTAATATAGAATATTTTGGAGG - Intergenic
957373671 3:79329043-79329065 GGTAATTTTACAGATTTTGGAGG + Intronic
957458404 3:80484054-80484076 CATAATTTTGCATATTTATGGGG - Intergenic
957849962 3:85794978-85795000 AATAATTTTGCATGTTTTTGGGG + Intronic
957877216 3:86163187-86163209 ACTAGTTGTGCATATGTTGGGGG - Intergenic
958094445 3:88924690-88924712 CTTAATTTGGAATATCTTGGAGG - Intergenic
958147658 3:89647405-89647427 CCTAAGTTTGAATATTTTTATGG + Intergenic
958493778 3:94815158-94815180 CCAAATTTTATATATTTTGATGG + Intergenic
959636253 3:108574836-108574858 CCTTATTTTGCAGATTTGTGTGG - Intronic
959725379 3:109536091-109536113 CCTTATTTGGAATATTTGGGGGG - Intergenic
959823193 3:110761466-110761488 CCTACTTTTCAATGTTTTGGAGG + Intergenic
959858023 3:111183612-111183634 CCTATTTTTGAATATTTTATGGG + Intronic
960053288 3:113257868-113257890 CCTATATTTGGATGTTTTGGAGG + Intronic
960440840 3:117686066-117686088 ACTAATTTAGACTATTTTGGAGG - Intergenic
961209475 3:125114588-125114610 CATATTTTTGTATTTTTTGGTGG + Intronic
962192696 3:133328014-133328036 ACTAATTTTTCATCTTTTGGGGG + Intronic
962335800 3:134528813-134528835 TCTAATTTTGGATCTTCTGGTGG + Intronic
963285269 3:143429149-143429171 CATAATTATGCATATTTATGGGG - Intronic
964229291 3:154444731-154444753 CCCAGTTTTGTATATTTTGATGG - Intergenic
964760383 3:160130159-160130181 CCTCAGACTGCATATTTTGGAGG + Intergenic
965178578 3:165368560-165368582 TCTAATATTGCATATTCTGGAGG - Intergenic
965680920 3:171250399-171250421 CCTGTTTCTGAATATTTTGGGGG - Intronic
965973718 3:174595064-174595086 CCTATTTTTGCTTATTTCTGCGG + Intronic
966099201 3:176245644-176245666 AATAATTGTACATATTTTGGAGG - Intergenic
967001930 3:185344111-185344133 CCCAATTTTGCATATGTTGATGG + Intronic
967565772 3:190970171-190970193 CTTAATTTGGTAAATTTTGGTGG - Intergenic
968409428 4:374932-374954 CCACATTTTTCATATTTTTGTGG - Exonic
970392521 4:15628955-15628977 AATAATTATGCATATTTTGGGGG + Intronic
970440221 4:16075241-16075263 TCAAAATTTGCATATTGTGGTGG + Intronic
971297020 4:25404012-25404034 CTAAATTTTGCATTTGTTGGAGG - Intronic
971519866 4:27535982-27536004 TATAGTTGTGCATATTTTGGGGG - Intergenic
972025667 4:34373586-34373608 GCTAAGCTTGGATATTTTGGAGG - Intergenic
972531700 4:39967138-39967160 GCTAACTTTTTATATTTTGGTGG - Intronic
973039524 4:45453055-45453077 CCTAATTGAACATAATTTGGGGG + Intergenic
973880310 4:55264971-55264993 GCTAATTTTGTATATTTAGTAGG - Intergenic
974304850 4:60121796-60121818 CCTAATTTTGTAGCTTTTGTAGG + Intergenic
974856070 4:67462539-67462561 CCTATTTTTGTATATGTTTGTGG - Intergenic
975029597 4:69599280-69599302 CCTAATTTTGAGTTTGTTGGAGG - Exonic
976381601 4:84405666-84405688 ACTCATTTTGCATATTTTTGGGG - Intergenic
976498073 4:85753783-85753805 CATAATTGTGCATATTTTGGGGG + Intronic
976740779 4:88355091-88355113 AGTAATTTTGCATAGTTTAGAGG - Intergenic
977545962 4:98377574-98377596 CATAATTTTGAAAATTTTTGAGG - Intronic
977759420 4:100714144-100714166 CATAATTGTACATATTTTGGGGG + Intronic
977934105 4:102780995-102781017 CTTAATTGTTAATATTTTGGGGG - Intergenic
978176364 4:105736483-105736505 AGTAATTGTGCATATTTTTGGGG + Intronic
978878580 4:113672876-113672898 CATAGTTTTACATATTTTTGAGG - Intronic
979120617 4:116895419-116895441 GCTAATTTTTCATATTTTTGTGG - Intergenic
980330520 4:131404385-131404407 GCTAATTTTTCAATTTTTGGTGG + Intergenic
980517413 4:133880876-133880898 CCGAATTTTGTATATGTTTGTGG + Intergenic
980527001 4:134002944-134002966 CCTAGTTTTGCAGTTTTTAGAGG - Intergenic
980935034 4:139218350-139218372 GCTAATTTTTTGTATTTTGGTGG + Intergenic
981482121 4:145249709-145249731 CCTGAGTGTGCATCTTTTGGTGG + Intergenic
982557546 4:156887380-156887402 TGTAATTTTACATATTTTTGGGG + Intronic
982561212 4:156930406-156930428 CCTAATATCACATTTTTTGGCGG + Intronic
983096642 4:163570397-163570419 CCTAGTTTTTCAACTTTTGGGGG - Intronic
983742165 4:171149467-171149489 ACTACTTTGGCATGTTTTGGTGG + Intergenic
985160791 4:187042183-187042205 GCTAATTTTGTATTTTTTAGTGG - Intergenic
985550366 5:530126-530148 GCTAGTTTTGCATATCCTGGAGG + Intergenic
985810539 5:2080560-2080582 CCTGATTTTGCAAACATTGGTGG - Intergenic
985899322 5:2776091-2776113 TGTAATTGTGCATATTTTGGGGG + Intergenic
986915308 5:12612589-12612611 CATAATTTTATATTTTTTGGAGG + Intergenic
986930869 5:12819076-12819098 GTTAATTTTGCATTTTTTGTAGG + Intergenic
987130931 5:14859531-14859553 CCTAATATTGAGTATTTTAGTGG - Intronic
987412622 5:17630003-17630025 AATTATCTTGCATATTTTGGGGG + Intergenic
988146806 5:27319731-27319753 CCTAATTTTACCATTTTTGGAGG - Intergenic
988269959 5:29001412-29001434 CCTAATTTTTCAGATCTTTGTGG + Intergenic
988316756 5:29641136-29641158 AATAATTATGCAAATTTTGGGGG - Intergenic
989415192 5:41166625-41166647 CCTGAATTTGCATACTGTGGAGG + Intronic
989778423 5:45236260-45236282 GCTAATTTTGCATTTTTGGTAGG + Intergenic
990161972 5:52951099-52951121 CCTAAAAGTGCATATTTTTGAGG + Intronic
990501225 5:56398487-56398509 ACTGGTTTTGTATATTTTGGTGG - Intergenic
991673660 5:69072084-69072106 GCTAATTTTGTATTTTTTGTAGG - Intergenic
991710205 5:69401443-69401465 CCTTATGATGGATATTTTGGTGG + Intronic
991964342 5:72076360-72076382 GCTAATTTTGCATTTTTTATGGG - Intergenic
993052633 5:82943580-82943602 GCTAATTTTGTATTTTTTAGTGG - Intergenic
993154066 5:84199309-84199331 ACTATTTTTGCATACTTTGAAGG + Intronic
993305666 5:86272193-86272215 CTTAATGTTCCCTATTTTGGAGG - Intergenic
993414152 5:87605155-87605177 GGTAATTTTGTATATTTTGTAGG + Intergenic
993939111 5:94037190-94037212 CATAATTTTCCATGTTTTTGTGG - Intronic
994468175 5:100165584-100165606 CCTAATCTTGCATATTTTCTAGG - Intergenic
994868438 5:105311359-105311381 AATAATTATGCATATTTTGGAGG - Intergenic
994915078 5:105964980-105965002 TGTAATTTTGCATTTTTTGTAGG + Intergenic
994942953 5:106348529-106348551 GCTAATGATGTATATTTTGGAGG + Intergenic
995122397 5:108550001-108550023 ACTAATATTAGATATTTTGGGGG + Intergenic
995497030 5:112757431-112757453 CCTCCTTTTGCCTTTTTTGGGGG - Intronic
996005160 5:118411523-118411545 TCTAATTTTTCTTTTTTTGGGGG - Intergenic
996058882 5:119011099-119011121 CATATTTTTGCCTATTTTGGAGG + Intergenic
996334284 5:122366144-122366166 CCTTATCTTGCTTAGTTTGGTGG - Intronic
997532844 5:134592891-134592913 GCTAATTTTGTATCTTTTTGTGG - Intergenic
997564764 5:134878373-134878395 CATAATTTTCTACATTTTGGTGG + Intronic
1000795497 5:165659493-165659515 CATAATTTTTCATTTCTTGGGGG + Intergenic
1000978741 5:167793668-167793690 CTAATTTTTGCATTTTTTGGTGG - Intronic
1001541615 5:172543430-172543452 AATAGTTGTGCATATTTTGGGGG + Intergenic
1002867366 6:1133783-1133805 CATAATTGTACATATTTTGGGGG + Intergenic
1003115637 6:3282091-3282113 CATGATTATGCATATTTTGTTGG - Intronic
1003554988 6:7131339-7131361 CCTCATTTTGCAGATTTGGAAGG + Intronic
1003594159 6:7459805-7459827 GCTAATTTTTCTTATTTTGTAGG + Intergenic
1005351439 6:24939566-24939588 GCTAAATTAGCATATTTTGGGGG + Intronic
1005351952 6:24945116-24945138 GGTAATTGTACATATTTTGGGGG - Intronic
1005620117 6:27612329-27612351 TCTGATTTTGTAAATTTTGGTGG - Intergenic
1005815824 6:29551941-29551963 CCTAATTTTTCATTTTTCAGAGG - Intergenic
1006236666 6:32639345-32639367 TATAATTTTCCATATTTTTGTGG + Intronic
1007120331 6:39375449-39375471 CATAATTGTATATATTTTGGGGG - Intronic
1008268230 6:49459012-49459034 CCTAGTTTTTTATTTTTTGGGGG - Intronic
1008371523 6:50737143-50737165 GCTAATTTTTGATTTTTTGGTGG + Intronic
1008881106 6:56381193-56381215 TTTAATTTTGCTTATTTTGGGGG + Intronic
1008900529 6:56609818-56609840 CATAATTTGTCACATTTTGGGGG - Intronic
1009265602 6:61550936-61550958 CCAATTTTTGTATTTTTTGGTGG + Intergenic
1009331750 6:62431137-62431159 CATGATTTTACATATTTTTGTGG + Intergenic
1010034745 6:71311840-71311862 CCTAATTTTGCAGATAATGAAGG + Intergenic
1010419248 6:75653193-75653215 GCTAATTTTGTATTTTTTAGAGG + Intronic
1010747986 6:79586029-79586051 GCTAATTTTGTATATTTTAGTGG - Intergenic
1010786750 6:80011739-80011761 CCTATTTCTGCATCTTGTGGTGG - Exonic
1010899976 6:81414991-81415013 CCTAATATTGTAATTTTTGGGGG + Intergenic
1011250219 6:85363597-85363619 CATAATTTTACATATTTGTGGGG + Intergenic
1012121674 6:95375732-95375754 TCTAAATATGCAAATTTTGGAGG - Intergenic
1012611131 6:101222358-101222380 CCCAGTTGTGCATATTTTTGGGG + Intergenic
1012694955 6:102367844-102367866 CATATTTTTACATATTTTAGAGG - Intergenic
1012756996 6:103244560-103244582 CATAGGTGTGCATATTTTGGTGG - Intergenic
1013352511 6:109318286-109318308 CCTAACTTTGAATATTCTGTAGG + Intergenic
1013643632 6:112113281-112113303 CATAGTTGTACATATTTTGGGGG - Intronic
1013742792 6:113307865-113307887 CTTAATTTCTCAGATTTTGGCGG - Intergenic
1014436663 6:121428088-121428110 CTTAGTTGTACATATTTTGGAGG - Intergenic
1015487952 6:133792871-133792893 CATAATTATACATATTTTGAAGG + Intergenic
1016722117 6:147311837-147311859 CCTAAAATAGCTTATTTTGGAGG - Intronic
1017044834 6:150337661-150337683 CTTATTTTTGTATTTTTTGGCGG - Intergenic
1017670873 6:156768522-156768544 CTTATTTTTGTATTTTTTGGTGG + Intergenic
1020782548 7:12535133-12535155 TCTTATTTTGGCTATTTTGGTGG - Intergenic
1021112837 7:16714983-16715005 TCTGATTTTGCATGTCTTGGGGG - Intergenic
1021546714 7:21821590-21821612 CATAGTTGTACATATTTTGGGGG + Intronic
1022147339 7:27558325-27558347 GCTTATTTTCCATTTTTTGGGGG + Intronic
1022650807 7:32272558-32272580 CTTAATTTTTAATATTTTGCTGG - Intronic
1022807287 7:33835218-33835240 CATAATTTGGCACAATTTGGCGG + Intergenic
1023411068 7:39889857-39889879 CCTCAGTATGCATATTTTGCTGG - Intergenic
1024675152 7:51631468-51631490 CCTAGTTGTACGTATTTTGGGGG + Intergenic
1024840472 7:53580339-53580361 CCTCATCTTTAATATTTTGGAGG - Intergenic
1026445365 7:70479989-70480011 CACAATTTGCCATATTTTGGGGG - Intronic
1027553357 7:79630072-79630094 CATAAATTTGAACATTTTGGGGG - Intergenic
1027696239 7:81414431-81414453 CCTAAATTCTCTTATTTTGGAGG + Intergenic
1028074199 7:86491278-86491300 CTATATTTTTCATATTTTGGTGG - Intergenic
1028357957 7:89932481-89932503 TCTAAGTTTGGATAGTTTGGAGG + Intergenic
1028892758 7:96006986-96007008 CATAGTTGTACATATTTTGGGGG - Intronic
1028896808 7:96050561-96050583 CATGATATTACATATTTTGGGGG + Intronic
1029151300 7:98482516-98482538 GCTAATTTTGTATTTTTTAGTGG + Intergenic
1029330386 7:99848695-99848717 TTTAATATTTCATATTTTGGTGG - Intronic
1031108891 7:117581919-117581941 CTAAATTTTGCATTTTTTGTGGG + Intronic
1032111366 7:129078633-129078655 CTAATTTTTGCATATTTTGTAGG - Intergenic
1032405175 7:131650603-131650625 GCTAATTTTAAATATTTTGTAGG + Intergenic
1033059755 7:138094925-138094947 CATAATTTTTAATATTTTGTTGG - Intronic
1033730545 7:144174451-144174473 GCTAATTTTTAATATTTTTGTGG - Intergenic
1033997638 7:147371248-147371270 TCTACTTTTGTATATTTTTGTGG + Intronic
1035437587 7:158870696-158870718 CTTTATTTTCCATATTTTGGGGG + Intronic
1036278953 8:7382349-7382371 AATAATTTTGCATTTTCTGGTGG + Intronic
1036342566 8:7929522-7929544 AATAATTTTGCATTTTCTGGTGG - Intronic
1038104041 8:24413527-24413549 CATAGCTTTACATATTTTGGGGG - Intergenic
1038237794 8:25777634-25777656 CATAATTGTGCATATTTATGGGG + Intergenic
1038506800 8:28091668-28091690 CAAAATTTTGCAAAATTTGGAGG - Intronic
1039162956 8:34643046-34643068 AATAATTGAGCATATTTTGGAGG - Intergenic
1039444225 8:37618149-37618171 AATAGTTGTGCATATTTTGGGGG - Intergenic
1039675027 8:39653723-39653745 CATAGTTGTACATATTTTGGGGG + Intronic
1040046713 8:42971843-42971865 GCTAAATTTTCATATTTTAGTGG + Intronic
1040432131 8:47353441-47353463 CCTAAGCTTGCATATTAGGGAGG - Intronic
1040505777 8:48046416-48046438 CCTAATTTTGTATTTTTAGTGGG + Intronic
1040765869 8:50910426-50910448 CCAAATATTGGATATTTTAGAGG + Intergenic
1041113983 8:54516625-54516647 CCTAATGAGGGATATTTTGGTGG - Intergenic
1041116308 8:54541006-54541028 CTTAATTTTCCTTTTTTTGGGGG + Intergenic
1041505102 8:58588041-58588063 CCTATTTTTAGTTATTTTGGGGG - Intronic
1042510282 8:69604084-69604106 CACAATTATACATATTTTGGGGG - Intronic
1042962370 8:74317616-74317638 CCTTATTTTTAATATTTTGTTGG + Intronic
1044134265 8:88565172-88565194 CATAGTTGTACATATTTTGGAGG - Intergenic
1044443547 8:92247711-92247733 CCTGATTTTTCATAGATTGGGGG - Intergenic
1045543544 8:103108411-103108433 CCCAATTTGTGATATTTTGGGGG - Intergenic
1046096622 8:109570319-109570341 CCTCATTGTGCACATTTTGCCGG + Intergenic
1046528362 8:115411091-115411113 CATTATTATACATATTTTGGTGG - Exonic
1047567140 8:126057674-126057696 CCTAATTATACCTATTTTGTGGG - Intergenic
1047713284 8:127572873-127572895 CATGATTTTGCATATTTTAATGG + Intergenic
1047972438 8:130096959-130096981 GCTAATTTTGTATTTTTTAGTGG - Intronic
1048521060 8:135155713-135155735 TATAATTTGGCATGTTTTGGGGG + Intergenic
1050448566 9:5754561-5754583 GCTAATTTTGTATATTTTGTAGG - Intronic
1050517803 9:6463114-6463136 GCTAATTTTGTATTTTTTAGTGG - Intronic
1050803601 9:9645922-9645944 ACTAGTTGTACATATTTTGGGGG + Intronic
1051758153 9:20428919-20428941 CCTAATTTTTATTTTTTTGGGGG - Intronic
1052060131 9:23949944-23949966 AATAATTTTACATATTTTGGGGG + Intergenic
1052065616 9:24015900-24015922 GCTAATTTTGTGTATTTTAGTGG - Intergenic
1053225352 9:36350402-36350424 CATGATTTTGAATATTGTGGAGG - Intronic
1054963675 9:70997799-70997821 CCTTTTTTTGCATGTTTGGGAGG + Intronic
1054988381 9:71290035-71290057 CATAGTTGTACATATTTTGGGGG - Intronic
1055105921 9:72512954-72512976 CTGAATTTTGGATAGTTTGGTGG + Intergenic
1055147352 9:72952404-72952426 CATTATTTTGCATATTTTGGTGG - Intronic
1057061758 9:92010224-92010246 GCTAATTTTTTGTATTTTGGTGG - Intergenic
1057606918 9:96505238-96505260 CCTAATTCTTCATATTGTGGGGG - Intronic
1058559321 9:106207812-106207834 TCTAATTTACCATTTTTTGGAGG + Intergenic
1058741640 9:107948626-107948648 CCTATTTTATCTTATTTTGGAGG + Intergenic
1060465196 9:123897801-123897823 CCTAATTTTTAAATTTTTGGTGG - Intronic
1060575945 9:124694272-124694294 TGTAATTTTGCATGTTTTGGGGG + Intronic
1060924821 9:127448989-127449011 GCTAATTTTGTATTTTTTGGTGG + Intronic
1061414838 9:130441931-130441953 CTTAGTTATACATATTTTGGGGG - Intergenic
1061740603 9:132702207-132702229 AATAATTTTGTATAATTTGGAGG + Intergenic
1186240470 X:7560214-7560236 CATAATTTTACATATTTAAGAGG + Intergenic
1188082845 X:25865652-25865674 CATAATTGTACATATTTTTGGGG - Intergenic
1188097161 X:26038088-26038110 CATAGTTGTACATATTTTGGGGG + Intergenic
1188097215 X:26039505-26039527 CATAGTTTTGCATAATTTGGGGG - Intergenic
1188371124 X:29370889-29370911 ATTAATTTTACATATTTTTGGGG + Intronic
1188489948 X:30726622-30726644 TCTAATATTTAATATTTTGGGGG + Intronic
1188659929 X:32746582-32746604 CATAATTATGCATATTTAGGAGG + Intronic
1189191897 X:39116598-39116620 CCTTTTTTTGCATAATATGGGGG + Intergenic
1189278758 X:39806197-39806219 CTAAATTTTGTATTTTTTGGTGG - Intergenic
1189373861 X:40451028-40451050 CATAGTTGTACATATTTTGGGGG + Intergenic
1189725811 X:43967253-43967275 AGTAATTTTTCATAATTTGGTGG + Intronic
1189926937 X:45964968-45964990 GCTAATTTTTTATATTTTTGTGG + Intergenic
1190173008 X:48126717-48126739 GCTAATTTTGTATTTTTTTGTGG + Intergenic
1190218011 X:48492989-48493011 CCTAATTTTGTATTTTTAGTAGG - Intergenic
1190825964 X:54018290-54018312 GCTAATTTTGAATTTTTTTGTGG - Intronic
1191227040 X:58054534-58054556 CCAAATATTTTATATTTTGGCGG - Intergenic
1191977200 X:66886372-66886394 CATAGTTGTACATATTTTGGGGG + Intergenic
1192220287 X:69193133-69193155 AATAATTTTGCATATTTATGGGG + Intergenic
1192301966 X:69914502-69914524 TATAATTATACATATTTTGGGGG + Intronic
1192662028 X:73052040-73052062 CCTTATTTTGCCTATTTTCATGG - Intergenic
1193055743 X:77148012-77148034 AATAATTGTACATATTTTGGGGG - Intergenic
1193116067 X:77776474-77776496 CACAATTTTACATAGTTTGGTGG - Intronic
1193414477 X:81204950-81204972 CATAATTGTGCATATTTATGGGG + Intronic
1194209769 X:91057813-91057835 ACTAATTTTGCAATGTTTGGAGG - Intergenic
1194622569 X:96191255-96191277 CCTAATTTTGCCTAATCTGGTGG + Intergenic
1198679243 X:139163955-139163977 CCTTATTTGGAATATTTGGGGGG - Intronic
1199260724 X:145771152-145771174 CGTACTTTTGCATATTTTGAAGG - Intergenic
1200342655 X:155414993-155415015 TCATTTTTTGCATATTTTGGAGG - Intergenic
1200803843 Y:7411765-7411787 CCTAATCTTACAAATTTAGGTGG + Intergenic