ID: 945627552

View in Genome Browser
Species Human (GRCh38)
Location 2:212229670-212229692
Sequence AGGGCTGTTACAGCTTATCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 92}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945627552 Original CRISPR AGGGCTGTTACAGCTTATCC AGG Intronic
901413403 1:9100783-9100805 GGGGCTGTTACATCTGATCAGGG - Exonic
901514290 1:9734734-9734756 AGGGGTCTTACATCTTTTCCTGG - Intronic
903582988 1:24386330-24386352 AAGGCTGTTACCACTTAGCCTGG + Intronic
915599195 1:156912197-156912219 GGGGCAGGTACAGCTTTTCCTGG - Intronic
916011951 1:160714205-160714227 AGGGGTGTTACAGCTTTGCTTGG + Intergenic
917799381 1:178556474-178556496 AGGGCTCTTACACCTCTTCCAGG - Intergenic
918283105 1:183024130-183024152 GGGGCTGTCACCGCTTACCCAGG - Exonic
920841681 1:209560746-209560768 AGGGCTGGTACAGCTAAGCAAGG + Intergenic
923879475 1:238087589-238087611 AGGGTTGTAACAAGTTATCCTGG + Intergenic
1063814677 10:9758663-9758685 AGGGCTTTTACATTTTCTCCAGG + Intergenic
1067674488 10:48360004-48360026 AGGACTGTTACAAATTAACCGGG + Intronic
1068283577 10:54908426-54908448 AGGGCTGTGACAGCCTATTTAGG - Intronic
1071066003 10:81636944-81636966 AGGGCTGTCACTGCAGATCCAGG + Intergenic
1074509331 10:114098727-114098749 AGGGCTGTTTCAGCTTTCCCTGG - Intergenic
1076306214 10:129467209-129467231 CGGGCTGTCCCAGCATATCCGGG - Exonic
1079330115 11:19526158-19526180 AGGGCCATTACAGCTCCTCCTGG + Intronic
1086851335 11:91812727-91812749 AGGTCTGTTACAGGTTTTCATGG - Intergenic
1089518435 11:119048352-119048374 CGGGCTGGTACAGCTTGTCCTGG + Exonic
1097125227 12:56769081-56769103 AGGGCAGTTTCAGCTTTTCAAGG + Intronic
1097500335 12:60393081-60393103 AGGGCTGTGACACCTTCTCTGGG + Intergenic
1099040640 12:77649928-77649950 ATTGCTGTTTCAGCTTATTCTGG - Intergenic
1100654647 12:96628676-96628698 AGGATTGTTACAGCTGAACCGGG + Intronic
1101727314 12:107398722-107398744 ATGACTGTTACATCTTATACAGG + Intronic
1103510136 12:121467912-121467934 TGGGCTCTCAGAGCTTATCCAGG - Intronic
1115485091 14:33902359-33902381 AGGGCTGTAACACCTTCTCTGGG + Intergenic
1117606316 14:57431989-57432011 AGGGCTGTTACAGCTTCAAGTGG + Intergenic
1124232841 15:27960420-27960442 AGAGCTGTGCCAGCATATCCTGG - Intronic
1125512866 15:40302259-40302281 AGGGCACTTACATCTTGTCCAGG + Exonic
1128336833 15:66792092-66792114 AGGGTTGTTACAACTTAGGCAGG + Intergenic
1142157941 16:88541125-88541147 AGGCCTGCTCCAGCTTCTCCCGG - Intergenic
1143047414 17:4093145-4093167 AGGTCTTTTACATCTTATACAGG - Intronic
1143562536 17:7704398-7704420 AGGGCTGTTTCCAATTATCCTGG - Intergenic
1149169397 17:53791934-53791956 AGGGCTGTCACAGCCTGGCCGGG + Intergenic
1157617904 18:48998303-48998325 AGGGGTGTTACATCATGTCCAGG - Intergenic
1202632778 1_KI270706v1_random:15694-15716 AGGGCTGTGACACCTTATTTGGG - Intergenic
925826835 2:7857669-7857691 AAGGCTGTTAAAACTTATCATGG - Intergenic
928249228 2:29660257-29660279 AGAGCTGTTACTGCATTTCCTGG - Intronic
931429764 2:62198862-62198884 AGGGCTTTTTCAGCTGATGCAGG + Intronic
935382950 2:102471529-102471551 TGGGCTGCTACATCTTAACCTGG + Intergenic
942867959 2:180699080-180699102 AGGGCTGTGACACCTTATTTGGG - Intergenic
942957408 2:181789281-181789303 AGAGCTCTTACAGGTTTTCCAGG - Intergenic
943479927 2:188405025-188405047 GGGACTGTTCCAGCTGATCCAGG + Intronic
943706596 2:191041788-191041810 GGGGCTCTTACAGCACATCCTGG - Intronic
945627552 2:212229670-212229692 AGGGCTGTTACAGCTTATCCAGG + Intronic
1169844620 20:9976185-9976207 AGGGAAGATACAGATTATCCTGG + Intergenic
1170736164 20:19015710-19015732 AGGGCTGGGACTGCTAATCCTGG + Intergenic
1170946696 20:20897485-20897507 AGTGCTGCTGCAGCTAATCCAGG + Intergenic
1172869288 20:38125836-38125858 AGGGCTGTGAGAGCTTATATGGG + Intronic
1176644991 21:9341574-9341596 AGGGCTGTGACACCTTATTTGGG - Intergenic
1176820508 21:13651308-13651330 ATGGCTGCTACATCTTCTCCAGG - Intergenic
1180367960 22:11957660-11957682 AGGGCTGTGACACCTTATTTGGG + Intergenic
1183773547 22:39947430-39947452 AGGGCTGTTACAGATGTTCTTGG + Intronic
1184128058 22:42501399-42501421 AGGCCTGTCACAGCTTTTTCCGG + Intergenic
1184136849 22:42554712-42554734 AGGCCTGTCACAGCTTTTTCCGG + Intronic
1184666203 22:45990382-45990404 GGAGCTGTCACAGCTGATCCTGG + Intergenic
949247831 3:1946326-1946348 ATGGATGTTAGAGCTTATACTGG - Intergenic
950276485 3:11665665-11665687 AGTGCTGTCACAGCCTCTCCTGG - Intronic
952740878 3:36733218-36733240 AGGGCTGTAACAGCTAGTCTGGG + Intronic
955000006 3:54918803-54918825 AGGGCTGGTACAGCTCATGAGGG + Exonic
963341424 3:144039331-144039353 ATGGCTGTTACAGGTCTTCCAGG - Intronic
965261287 3:166489408-166489430 AGTGCTGTCACAGCTCCTCCAGG + Intergenic
968124080 3:196145644-196145666 TGGGCAGTTACAGATTCTCCTGG - Intergenic
1202741900 3_GL000221v1_random:63494-63516 AGGGCTGTGACACCTTATTTGGG + Intergenic
977443449 4:97099375-97099397 AGGGCTCATACACCTTTTCCAGG - Intergenic
980078112 4:128315397-128315419 AGGGATGTTACATCTTTTTCAGG + Intergenic
992085703 5:73276310-73276332 AGGGTTGTTACAACTGATCAAGG - Intergenic
992212472 5:74494353-74494375 AGGGCTGGTCCAGCTAATCAGGG - Intergenic
993536013 5:89087541-89087563 AGGGAGGTTACTGCTTTTCCTGG - Intergenic
998062266 5:139128083-139128105 AGGGCTGTAATAGCTTATGCAGG - Intronic
1000257981 5:159558987-159559009 AGTGCATTTACAGCTTATCTTGG + Intergenic
1004075576 6:12341451-12341473 AGGGCAGATACAGCTTCTCCAGG - Intergenic
1005659945 6:27987234-27987256 ATGGCTGTTACAGCTTATCTGGG + Intergenic
1006225808 6:32535351-32535373 GGTGCTGTTACAGCCTAGCCGGG + Intergenic
1009918828 6:70030900-70030922 GGGGCTATGACAGCTTTTCCAGG - Intronic
1017054420 6:150424647-150424669 AGGGCTGTTACAGCCTGGCTGGG + Intergenic
1021402255 7:20222754-20222776 GGGGCTGATCCAGATTATCCGGG - Intergenic
1033230001 7:139589146-139589168 ATGGATGTTACAGGTTATCCAGG - Intronic
1034337291 7:150331780-150331802 AGTGCTGCAATAGCTTATCCAGG - Exonic
1040381713 8:46879445-46879467 AGGGCTCATACACCTTTTCCAGG + Intergenic
1041065041 8:54074515-54074537 AGGGCTCATACACCTTTTCCAGG + Intronic
1044569429 8:93700662-93700684 CGGGCTGTTACCGGTTTTCCAGG - Exonic
1048969016 8:139634097-139634119 AGGGCTGGGACAGCTTAGCACGG + Intronic
1050987178 9:12097621-12097643 AGAGCTCTTACTGCTTATGCTGG - Intergenic
1054735996 9:68750359-68750381 CTTGTTGTTACAGCTTATCCAGG - Intronic
1055605797 9:77969113-77969135 AGGTCTGTTATTGCTAATCCAGG + Intronic
1056269204 9:84930277-84930299 AGTGTTGTTACAGCTTAGGCAGG + Intronic
1057074826 9:92132972-92132994 AGAGCTGTTACAGCTAATGAAGG - Intergenic
1058790917 9:108444657-108444679 AGTGCTGTTACAGCTTTGGCAGG + Intergenic
1059433953 9:114265464-114265486 AGGGCTCTTACCGGTTCTCCTGG - Exonic
1060281920 9:122220718-122220740 AGAGGTGTTACTGCTCATCCTGG + Intronic
1203526742 Un_GL000213v1:97613-97635 ATGGCTGCTACATCTTCTCCAGG + Intergenic
1203710530 Un_KI270742v1:93418-93440 AGGGCTGTGACACCTTATTTGGG + Intergenic
1188194999 X:27222593-27222615 AGGGCTGTGACACCTTCTCTGGG - Intergenic
1190518865 X:51255904-51255926 ATGGCTTTTAGAGCTTTTCCAGG - Intergenic
1190681644 X:52831231-52831253 AGGGCAGTTGCAGCTGCTCCTGG - Intergenic
1198259526 X:134953307-134953329 AGGTCTTTTTCAGCTTGTCCAGG + Intergenic
1198628024 X:138601527-138601549 AGGGCTGGTACAGCTACTCAAGG - Intergenic
1199996582 X:153030115-153030137 GGGGCTGCTTCAGCTCATCCAGG + Intergenic
1201683786 Y:16679170-16679192 AGGGCTCATACACCTTTTCCAGG - Intergenic