ID: 945627778

View in Genome Browser
Species Human (GRCh38)
Location 2:212232696-212232718
Sequence TACTTACTCCCGGCCGGGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 348
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 315}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945627778_945627782 -9 Left 945627778 2:212232696-212232718 CCACACCCGGCCGGGAGTAAGTA 0: 1
1: 0
2: 1
3: 31
4: 315
Right 945627782 2:212232710-212232732 GAGTAAGTAAAGATTCTAAATGG 0: 1
1: 0
2: 0
3: 13
4: 231

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945627778 Original CRISPR TACTTACTCCCGGCCGGGTG TGG (reversed) Intronic
900279255 1:1855409-1855431 CAATAACTCCCGGCCGGGCGCGG + Intronic
900311366 1:2035013-2035035 AACTCACTCATGGCCGGGTGCGG - Intergenic
901440907 1:9277741-9277763 TACTCAGTCTGGGCCGGGTGGGG - Intergenic
901900979 1:12362151-12362173 AACTTATTCATGGCCGGGTGTGG - Intronic
902858272 1:19225224-19225246 TGCTTGCTGCTGGCCGGGTGCGG + Intronic
902880094 1:19366396-19366418 AACAAACTCCTGGCCGGGTGCGG + Intronic
903161103 1:21489676-21489698 TAGTAACCCCTGGCCGGGTGCGG + Intergenic
905654093 1:39674946-39674968 AACTTTCCCCGGGCCGGGTGCGG + Intergenic
905936892 1:41831783-41831805 TGCTTGCTCCAGGCCAGGTGAGG - Intronic
906106318 1:43295050-43295072 TAATGACACCCGGCTGGGTGCGG + Intergenic
909378312 1:74966863-74966885 TAGTCATTCCAGGCCGGGTGCGG + Intergenic
910641059 1:89462461-89462483 TACTTAGTCTCTGCCAGGTGTGG - Intergenic
910895217 1:92062293-92062315 AAATTACTCCTGGCTGGGTGCGG + Intronic
910913819 1:92267411-92267433 AACTTAGTTCCGGCTGGGTGTGG + Intronic
914292284 1:146285390-146285412 TATTAACTTCCGGCCGGGCGCGG + Intergenic
914553328 1:148736173-148736195 TATTAACTTCCGGCCGGGCGCGG + Intergenic
915482618 1:156197466-156197488 TGCTTTGTCCCGGCTGGGTGCGG + Intronic
915818628 1:158996906-158996928 TAGGTACTCCTGGCTGGGTGCGG - Intergenic
916152859 1:161812680-161812702 TACCTGCTCCTGGCCGGGCGCGG - Intronic
918481563 1:184983127-184983149 TACTTCTTCCCGGCTGGGTGCGG - Intergenic
919765847 1:201127000-201127022 TCCCTCCTCCAGGCCGGGTGGGG + Intronic
919907747 1:202089590-202089612 TACTTGACCTCGGCCGGGTGCGG - Intergenic
921709184 1:218356507-218356529 TAATTTTTCCCGGCTGGGTGCGG - Intronic
922309493 1:224374678-224374700 AACTTGCCCCAGGCCGGGTGTGG - Intronic
922568092 1:226615127-226615149 TATTTGATCCAGGCCGGGTGCGG + Intergenic
923237466 1:232048118-232048140 TTCTTATTCATGGCCGGGTGCGG - Intergenic
923297197 1:232605402-232605424 AAGTTACTCCCAGCTGGGTGTGG + Intergenic
923711391 1:236390263-236390285 AACTTACTCATGGCCGGGCGTGG + Intronic
1063584821 10:7342685-7342707 GACTCACTCCAGGCCGGGCGTGG - Intronic
1065571032 10:27071462-27071484 AATGTAGTCCCGGCCGGGTGTGG - Intronic
1066186167 10:33012687-33012709 TACAAACTCCAGGCCGGGTGTGG + Intergenic
1066546114 10:36502518-36502540 TACTTACAGGTGGCCGGGTGTGG - Intergenic
1067827287 10:49586252-49586274 TACCCAGTCTCGGCCGGGTGTGG + Intergenic
1069520661 10:69117575-69117597 AACTGTCTCCAGGCCGGGTGAGG + Intergenic
1071174749 10:82912933-82912955 AAAGTACTTCCGGCCGGGTGCGG + Intronic
1071297944 10:84236004-84236026 AACGTATTGCCGGCCGGGTGCGG + Intronic
1071913816 10:90267815-90267837 AAATTACTCTAGGCCGGGTGTGG + Intergenic
1071969398 10:90887673-90887695 TATTTACCCTAGGCCGGGTGTGG - Intronic
1072091871 10:92136847-92136869 TACTCACTCTTGGCCGGGCGCGG - Intronic
1072234544 10:93441851-93441873 TACTAACTCTCGGCCGGGCACGG - Intronic
1072652480 10:97306424-97306446 TCCTTATTCCAGGCCGGGGGTGG - Intergenic
1073135633 10:101218558-101218580 TGCTTGCTCCCGGGAGGGTGTGG + Intergenic
1073357102 10:102865403-102865425 CATATACTCCTGGCCGGGTGTGG + Intronic
1073770117 10:106726794-106726816 TGCAGACTCTCGGCCGGGTGCGG + Intronic
1075277415 10:121106566-121106588 AAAATACTCCCGGCCTGGTGCGG - Intergenic
1078755034 11:14201048-14201070 TACCAACTCCTGGCCAGGTGCGG + Intronic
1080652204 11:34231771-34231793 TACACACTATCGGCCGGGTGCGG - Intronic
1080677080 11:34438567-34438589 TACTTAGACCCTGCTGGGTGGGG - Intergenic
1083046510 11:59741163-59741185 GAGCTACTCCTGGCCGGGTGTGG + Intronic
1083255439 11:61492569-61492591 TGCCTGCTCCCGGCTGGGTGCGG + Intergenic
1083980397 11:66163056-66163078 TAGTTACTGGTGGCCGGGTGTGG + Intronic
1084002367 11:66303510-66303532 TATTTACTTCAGGCCGGGCGCGG + Intergenic
1085639512 11:78183923-78183945 TAATTTTTCCTGGCCGGGTGCGG - Intronic
1087042048 11:93810679-93810701 TACTTCTCCTCGGCCGGGTGCGG - Intronic
1088165312 11:106927860-106927882 GACTTATTCCAGGCCGGGCGTGG - Intronic
1089049392 11:115533373-115533395 AAATCTCTCCCGGCCGGGTGCGG - Intergenic
1089475142 11:118753626-118753648 TACCCACTCTGGGCCGGGTGCGG - Intronic
1090003136 11:122979092-122979114 TACCTACACCTGGCCGGGCGCGG - Intronic
1091479085 12:808007-808029 TTATTGCTCCCGGCCGGGCGCGG - Intronic
1091492549 12:945724-945746 GACTTACTTCAGGCCAGGTGTGG - Intronic
1091688110 12:2578156-2578178 TAATTACTTCTGGCCGGGCGCGG - Intronic
1092066535 12:5594543-5594565 CAGTTACTCGTGGCCGGGTGTGG + Intronic
1092382760 12:8011173-8011195 TACTTTCTTGCGGCCGGGCGTGG - Intergenic
1092631236 12:10380353-10380375 TAATAAATCACGGCCGGGTGCGG - Intronic
1093023983 12:14230002-14230024 AACTTACTGCTGGCTGGGTGTGG - Intergenic
1096218760 12:49814192-49814214 TATTTTCTTCCAGCCGGGTGTGG + Intronic
1096440482 12:51638773-51638795 TAACTCCTTCCGGCCGGGTGTGG - Intronic
1097097696 12:56562830-56562852 TACCTGCTACTGGCCGGGTGCGG + Intronic
1097856122 12:64464150-64464172 TAATATCTTCCGGCCGGGTGTGG - Intronic
1098321486 12:69248954-69248976 ATCTTATTCTCGGCCGGGTGTGG + Intronic
1099167835 12:79328554-79328576 AAATTACTCATGGCCGGGTGCGG + Intronic
1102507962 12:113395819-113395841 TACTATCTACCAGCCGGGTGCGG + Intronic
1103824942 12:123730343-123730365 ACCTAACTCCTGGCCGGGTGTGG - Intronic
1103870697 12:124089272-124089294 TACTTATTGCAGGCCAGGTGTGG - Intronic
1106058584 13:26263422-26263444 TACCTACTCCCGGCCGGGCGCGG - Intronic
1106126277 13:26902292-26902314 TACCAACTCCAGGCCGGGCGTGG - Intergenic
1106507050 13:30380224-30380246 AACATACACCCGGCCGGGCGTGG + Intergenic
1107253634 13:38396013-38396035 AAATTATTCCCGGCCGGGCGCGG + Intergenic
1107563758 13:41581290-41581312 GACTCACTCTCGGCCGGGCGCGG - Intronic
1108971480 13:56381713-56381735 AAATTTCTCCCGGCCGGGCGCGG + Intergenic
1109516410 13:63449040-63449062 AGCTTATTCCTGGCCGGGTGCGG + Intergenic
1112014310 13:95318827-95318849 TAGTTTCACCCGGCCGGGCGCGG + Intergenic
1112414851 13:99195615-99195637 TACTCAGTCTTGGCCGGGTGTGG + Intergenic
1115180512 14:30620918-30620940 TACATAATCTCTGCCGGGTGCGG - Intergenic
1115573837 14:34692148-34692170 TACTTACTCTGGGCTGGGCGCGG - Intergenic
1116962631 14:50982162-50982184 AACATACTCCTGGGCGGGTGAGG + Intronic
1120167238 14:81214353-81214375 TACTGAGACCCGGCCGGGAGCGG + Intronic
1120236695 14:81900398-81900420 TACTTAATATGGGCCGGGTGTGG + Intergenic
1121178515 14:91909205-91909227 TACTGATTCCTGGCCGGGCGCGG - Intronic
1122524381 14:102370359-102370381 ATCTTATTACCGGCCGGGTGTGG - Intronic
1122623371 14:103072039-103072061 GAATTACTCACGCCCGGGTGGGG + Intergenic
1124357874 15:29010546-29010568 AAAGAACTCCCGGCCGGGTGTGG - Intronic
1124437298 15:29661487-29661509 TACATCTTCTCGGCCGGGTGTGG - Intergenic
1124790504 15:32721462-32721484 TCCTGAATCCTGGCCGGGTGAGG + Intronic
1125247613 15:37659965-37659987 AAAGAACTCCCGGCCGGGTGTGG + Intergenic
1125465998 15:39953134-39953156 TACAGACTCCCGGCAGGGTGCGG - Intronic
1126064846 15:44818927-44818949 AACATACACACGGCCGGGTGTGG + Intergenic
1126390229 15:48141286-48141308 TGTTTACTTCCAGCCGGGTGTGG + Exonic
1126586962 15:50298374-50298396 AACTTACCTCTGGCCGGGTGTGG - Intronic
1126598654 15:50406599-50406621 TTCTAACTCCAGGCCGGGTGTGG - Intergenic
1126606877 15:50486840-50486862 AACTTACTAATGGCCGGGTGCGG + Intronic
1127856093 15:62954818-62954840 TATTTAAGACCGGCCGGGTGCGG - Intergenic
1128080355 15:64853582-64853604 TGCAAACTCCCGGCTGGGTGCGG - Intronic
1128125094 15:65186159-65186181 TCCTTAATCACGGCCGGGTGCGG - Intergenic
1130006189 15:80101170-80101192 TCTTTACTCCCGGCTGGGCGTGG + Intronic
1130288602 15:82576730-82576752 AACTGACTCCAGGCTGGGTGTGG + Intronic
1130413683 15:83669756-83669778 TACTCACTCCTGGCCGGGCGCGG - Intronic
1130894809 15:88161680-88161702 TACATACTCCAGGCAGGGAGAGG + Intronic
1131641162 15:94295238-94295260 TACCCAGTCCCGGCCAGGTGTGG - Intronic
1132095857 15:98984298-98984320 TACTTACTCCAGGCCGAGCACGG - Intronic
1132124840 15:99214215-99214237 GAGATCCTCCCGGCCGGGTGCGG + Intronic
1132552900 16:560642-560664 TACCTGCGCCCGGCCGGGAGCGG - Exonic
1134284509 16:12848711-12848733 TAGTCACTCAAGGCCGGGTGTGG - Intergenic
1134487620 16:14670774-14670796 TACTCAGACCCGGCTGGGTGTGG + Intergenic
1134603907 16:15554954-15554976 TACTTGCTCCTGGCCGGGCACGG - Intronic
1135350538 16:21725572-21725594 TTCTTACTTCTGGCCAGGTGTGG - Intronic
1136039734 16:27568751-27568773 AACTTATTTCCGGCCGGGTGCGG - Intronic
1136387521 16:29938761-29938783 TACCTCTTCCTGGCCGGGTGCGG + Intergenic
1137658140 16:50179070-50179092 TACTTTATTCCAGCCGGGTGCGG + Intronic
1138498885 16:57426195-57426217 TACTGAGGCCTGGCCGGGTGTGG - Intergenic
1139352239 16:66344027-66344049 TACTTAGTCCCTGCCAGATGAGG - Intergenic
1139946482 16:70645761-70645783 ACCTTAGTCCTGGCCGGGTGCGG + Intronic
1140609329 16:76579401-76579423 TACTTACTCCCGTTCGGCTGTGG - Intronic
1140745075 16:77974005-77974027 TACACACTCCTGGCCGGGTGCGG - Intronic
1143262180 17:5607609-5607631 CACTTAATCCAGGCCAGGTGCGG - Intronic
1144250747 17:13414231-13414253 CAGTTATTCCTGGCCGGGTGCGG - Intergenic
1144551649 17:16246227-16246249 TAAGTACTTCAGGCCGGGTGCGG + Intronic
1144749087 17:17635828-17635850 TACTTAATTCCAGCTGGGTGTGG + Intergenic
1145900903 17:28489981-28490003 TAGATAATCCAGGCCGGGTGTGG + Intronic
1146229142 17:31093550-31093572 TACTCATTCCAGGCCAGGTGCGG + Intergenic
1146389235 17:32406190-32406212 TTCTTACTTTAGGCCGGGTGTGG + Intergenic
1146948046 17:36887433-36887455 TCCTTGTTCCCGGCTGGGTGGGG + Intergenic
1147874814 17:43613607-43613629 TTCTTCCTCCCGGCCGGGCGCGG - Intergenic
1148646154 17:49220552-49220574 AACTTAATCCTGGCCGGGCGCGG + Intronic
1148726016 17:49790485-49790507 TACATACCACCGGCCGGGCGTGG - Intronic
1149377638 17:56061561-56061583 TACAAACTACCGGCTGGGTGTGG - Intergenic
1149773203 17:59337477-59337499 GAATTTCTCCCGGCCGGGCGCGG - Intronic
1150068080 17:62128385-62128407 TATCTATTCCCGGCCGGGTGTGG + Intergenic
1150103518 17:62444568-62444590 TCCCTGCTCCTGGCCGGGTGCGG - Intronic
1151245708 17:72792969-72792991 TCCCTACTGCCGGCGGGGTGGGG + Intronic
1151614120 17:75197159-75197181 TACTGAATTCTGGCCGGGTGCGG + Intergenic
1152187229 17:78865332-78865354 TACTTAATGCCGCCCAGGTGCGG + Intronic
1156330459 18:36116946-36116968 TGCATACTCCCGGCCAGGCGCGG + Intronic
1157162956 18:45331399-45331421 TATTTAATCCTGGCCGGGTGTGG + Intronic
1158050129 18:53207971-53207993 TACATACTCCCAGCTGGATGTGG + Intronic
1158605136 18:58889507-58889529 TACAAACTCTTGGCCGGGTGTGG + Intronic
1160547931 18:79673730-79673752 TGTTAACTCCAGGCCGGGTGTGG + Intergenic
1161183941 19:2903500-2903522 AACTTAATCCAGGCCGGGCGCGG - Intronic
1161339449 19:3732933-3732955 AACTTAATGTCGGCCGGGTGTGG - Intronic
1162929272 19:13948638-13948660 AACATCCTCCTGGCCGGGTGTGG + Intronic
1163806076 19:19398645-19398667 AACTTACTTTCGGCTGGGTGTGG + Intronic
1165468491 19:35989431-35989453 TACCTACTTCAGGCTGGGTGCGG - Intergenic
1165528567 19:36377688-36377710 TACCTACTGGAGGCCGGGTGCGG + Intronic
1165544013 19:36518117-36518139 TAATTCTTCCGGGCCGGGTGCGG - Intronic
1166320849 19:42018021-42018043 TACTGACTCCCGGCTGGGCGTGG + Intronic
1167251752 19:48402425-48402447 TCTTTACTCCTGGCCGGGCGCGG + Intronic
1168395525 19:56044342-56044364 GACTTAAACCTGGCCGGGTGTGG - Intronic
926032247 2:9602134-9602156 TAATAACTCCTGGCCAGGTGTGG + Intronic
926247158 2:11130086-11130108 TGCTTGCTCCCGGGCTGGTGGGG + Intergenic
928208156 2:29302225-29302247 AATTAACTTCCGGCCGGGTGCGG + Intronic
928537376 2:32253672-32253694 TACGTGCTGCTGGCCGGGTGCGG + Intronic
928968324 2:36999720-36999742 TAAAACCTCCCGGCCGGGTGCGG + Intronic
929535440 2:42780775-42780797 TTAATACTCCCGGCCGGGCGTGG + Intronic
929846589 2:45536021-45536043 TGCATACTCCCTGCCAGGTGTGG - Intronic
930149546 2:48044491-48044513 TCCTAACTCCCGGCCGGGCGCGG - Intergenic
930651346 2:53967980-53968002 AATTTAGTCCAGGCCGGGTGCGG + Intronic
931220570 2:60285031-60285053 TACAGATTCCTGGCCGGGTGCGG - Intergenic
932923446 2:75943008-75943030 AACTTACTCATGGCTGGGTGTGG - Intergenic
934740230 2:96715225-96715247 TACATAATCCTGGCTGGGTGCGG - Intronic
935306446 2:101741456-101741478 CACCTACTACTGGCCGGGTGCGG - Intronic
935832703 2:107017217-107017239 TACCCAGTCTCGGCCGGGTGCGG - Intergenic
936100202 2:109570810-109570832 TACCTAATACAGGCCGGGTGTGG - Intronic
938410557 2:131060312-131060334 TTCCTACTCACGGCCGGGCGCGG - Intronic
939944004 2:148386426-148386448 TACTTTATGCCGGCCGGGCGCGG + Intronic
942340511 2:174940315-174940337 TAATTACTCTCGGCTGGGCGTGG - Intronic
942736488 2:179119938-179119960 TACCCAGTCTCGGCCGGGTGCGG + Intronic
944218905 2:197282666-197282688 TAATCCCTCCAGGCCGGGTGTGG + Intronic
944650021 2:201820668-201820690 TGCTTACTCTCGGCTGAGTGTGG + Intronic
945452928 2:210014377-210014399 TACCTACTCCAGGCCGGGCGCGG - Intronic
945627778 2:212232696-212232718 TACTTACTCCCGGCCGGGTGTGG - Intronic
947261453 2:228227928-228227950 TATTTACTCCAGGCCAGGTATGG - Intergenic
1169165951 20:3424149-3424171 GATTTACTACAGGCCGGGTGCGG + Intergenic
1172644918 20:36462942-36462964 TATTTAGCCCCGGCTGGGTGTGG + Intronic
1172760992 20:37321777-37321799 TGCTTTTTCCCGGCTGGGTGTGG + Intergenic
1173492465 20:43494250-43494272 TGACTACTCCAGGCCGGGTGCGG + Intergenic
1173610887 20:44367043-44367065 AATTAACTCCTGGCCGGGTGCGG + Intronic
1174012686 20:47463325-47463347 TACTTGTTCCAGGCCAGGTGTGG + Intergenic
1174310709 20:49651786-49651808 TCCTAACACCAGGCCGGGTGTGG + Intronic
1176606219 21:8834411-8834433 CAATTAATCCAGGCCGGGTGCGG + Intergenic
1179123629 21:38572064-38572086 AACTTCCTTCCGGCCAGGTGCGG + Intronic
1180356292 22:11844106-11844128 CAATTAATCCAGGCCGGGTGCGG + Intergenic
1180381966 22:12148221-12148243 CAATTAATCCAGGCCGGGTGCGG - Intergenic
1181261316 22:21600019-21600041 TACTTATTCCTGGCCGGGCGCGG + Intronic
1181620566 22:24088317-24088339 AAATTACTCTTGGCCGGGTGTGG + Intronic
1182749520 22:32630270-32630292 TACATACATACGGCCGGGTGTGG - Intronic
1182814907 22:33153590-33153612 TACTTACTCATGGTGGGGTGTGG + Intergenic
1183530424 22:38350546-38350568 TACTTAGTGCTGGCCGGGTGCGG - Intronic
1183562253 22:38584472-38584494 TAGATACTCCAGGCCAGGTGTGG + Intronic
1183800460 22:40159251-40159273 TACTCAGTTCCGGCCAGGTGCGG - Intronic
1184751975 22:46491551-46491573 TACTTTCTCACGGCTGGGCGTGG - Intronic
1185027100 22:48421002-48421024 TGCTTAGTGCTGGCCGGGTGTGG + Intergenic
1185140632 22:49099228-49099250 TACCTAATTCTGGCCGGGTGCGG - Intergenic
950083946 3:10243321-10243343 CACATATTCTCGGCCGGGTGCGG - Exonic
950288700 3:11765989-11766011 TATTGACTCCAGGCTGGGTGTGG - Intergenic
951319546 3:21227695-21227717 AACAAACTCTCGGCCGGGTGTGG - Intergenic
952155204 3:30636229-30636251 TACCTAGTACGGGCCGGGTGCGG - Intronic
952330733 3:32362331-32362353 TAGTAACTGCCGGCCAGGTGCGG - Intronic
952636502 3:35538652-35538674 TACCTACTACAGGCCGGGTGCGG - Intergenic
952775534 3:37042568-37042590 TACTGATACTCGGCCGGGTGCGG + Intronic
953190726 3:40684954-40684976 TACTTACTCCCATCAAGGTGTGG - Intergenic
954110040 3:48428815-48428837 TCCTGACCCCCGGGCGGGTGGGG - Intronic
954198686 3:49011468-49011490 TCCTTGGTCTCGGCCGGGTGCGG - Intronic
954823579 3:53351852-53351874 AAATTACTCTGGGCCGGGTGCGG + Intergenic
957973461 3:87412425-87412447 TACATATTTCCTGCCGGGTGTGG - Intergenic
958660318 3:97058590-97058612 TCCTTACTCCAGGCCGGGCATGG - Intronic
959115912 3:102177893-102177915 TTCTTTCTATCGGCCGGGTGTGG + Intronic
959664193 3:108903425-108903447 TACTGTATCGCGGCCGGGTGCGG + Intergenic
961759058 3:129151866-129151888 TACTTTATCAGGGCCGGGTGTGG + Intronic
961795735 3:129407621-129407643 TACATTCACCAGGCCGGGTGCGG + Intronic
966764268 3:183446092-183446114 TTCTTACTCATGGCCGGGCGCGG - Intergenic
967791198 3:193551121-193551143 TACATATTCCTGGCCAGGTGCGG + Intronic
968006195 3:195244873-195244895 AACCCACTCCCGGCCGGGTGCGG + Intronic
971460873 4:26894919-26894941 TAATTATTTCTGGCCGGGTGCGG + Intronic
971691222 4:29839232-29839254 GACCTGCTCCAGGCCGGGTGCGG - Intergenic
972756667 4:42054789-42054811 TACTAATTCCTGGCCGGGTGCGG - Intronic
973623426 4:52749509-52749531 CACTTACTCTGGGCCGGGTGTGG + Intronic
973801983 4:54487323-54487345 GACTCACTTCCGGCCGGGCGCGG - Intergenic
973998466 4:56484322-56484344 TACTGTCTCTCGGCCGGGCGTGG - Intronic
974798046 4:66779626-66779648 TATGTTCTCCAGGCCGGGTGCGG + Intergenic
974809366 4:66926284-66926306 TAATTTCTACAGGCCGGGTGCGG + Intergenic
976180732 4:82396268-82396290 TGCTTACGGCCGGCCGGGCGCGG - Intergenic
976402139 4:84619740-84619762 GAATCACTCCAGGCCGGGTGCGG + Intronic
977231405 4:94454523-94454545 TGCTTACTCTCTGCCTGGTGAGG + Intronic
977853650 4:101860719-101860741 TCCTCACTCAGGGCCGGGTGCGG - Intronic
978561762 4:110041368-110041390 TACCTACTGCAGGCCGGGTGTGG - Intergenic
980131689 4:128822209-128822231 TCTTTACTACTGGCCGGGTGTGG + Intronic
982425791 4:155258028-155258050 AACATACTCTAGGCCGGGTGCGG + Intergenic
982526392 4:156484496-156484518 TTCTTACTCATGGCCGGGTGCGG + Intergenic
982926269 4:161340616-161340638 TAATTACCCCGGGCCGGGCGAGG + Intergenic
984973519 4:185210240-185210262 TACTTACCCCCGGCGGGCGGCGG - Intronic
985131482 4:186742384-186742406 TACTGACCCCGGGCCGGGTTTGG - Intergenic
985218961 4:187682331-187682353 TTCTCAATCCTGGCCGGGTGCGG - Intergenic
986139887 5:5019496-5019518 AACTCACTCTCAGCCGGGTGCGG - Intergenic
987704199 5:21442765-21442787 AAGATACTCCAGGCCGGGTGCGG - Intergenic
990259257 5:54004202-54004224 TAAATATTCTCGGCCGGGTGTGG + Intronic
994123248 5:96141513-96141535 TACTTATTCCCAGATGGGTGGGG + Intergenic
994201245 5:96978745-96978767 TACTGACTCCTCGCCTGGTGGGG + Intronic
994674320 5:102802071-102802093 TACCTTTTCCCGGCCGGGCGCGG - Intronic
996945147 5:129057470-129057492 AACTTACTCCTGGCTGGGCGTGG - Intergenic
997133143 5:131297427-131297449 TACTGCATCCTGGCCGGGTGCGG + Intronic
997961635 5:138326629-138326651 AAGTTAGCCCCGGCCGGGTGCGG - Intronic
997991750 5:138550327-138550349 TACATACTTTCGGCCGGGCGTGG + Intergenic
998087748 5:139340717-139340739 CACATACTCTCGGCCGGGTGCGG + Intergenic
998920267 5:147060334-147060356 TACCTACTCTCAGCCAGGTGTGG + Intronic
1000004127 5:157167143-157167165 AACCTGCTTCCGGCCGGGTGGGG - Intronic
1001397364 5:171426916-171426938 TACCTACTTCTGGCCGGGCGTGG + Intronic
1001605426 5:172956645-172956667 TCCTGACACCAGGCCGGGTGTGG + Intergenic
1002362323 5:178682163-178682185 TAGTTAAACTCGGCCGGGTGCGG - Intergenic
1002756323 6:164011-164033 AACTTACTCATGGCCGGGTGTGG + Intergenic
1004404699 6:15322073-15322095 TACTTCTTCCAGGCCGGGCGCGG - Intronic
1004891145 6:20101823-20101845 AAAATACTCCCGGCCGGGCGCGG + Intergenic
1005297959 6:24445315-24445337 TACCTATTTCAGGCCGGGTGCGG - Intronic
1005480061 6:26247258-26247280 GATTTACTCCTGGCCGGGCGCGG + Intergenic
1005991787 6:30907808-30907830 TACACACTCCAGGCCGGGCGCGG - Intergenic
1006478478 6:34273195-34273217 AACACTCTCCCGGCCGGGTGCGG - Intergenic
1007596979 6:43057165-43057187 TATTTATAACCGGCCGGGTGTGG - Intronic
1007752773 6:44080513-44080535 TAGTTTCTCTGGGCCGGGTGCGG - Intergenic
1009339142 6:62531855-62531877 TATTTAATTCAGGCCGGGTGTGG - Intergenic
1012470201 6:99564132-99564154 TATTTAATCCTGGCCGGGCGCGG + Intronic
1013508263 6:110820525-110820547 GATTTACTACCAGCCGGGTGTGG - Intronic
1013550389 6:111202183-111202205 CAGTTACCCACGGCCGGGTGTGG + Intronic
1014858299 6:126430660-126430682 TATTGACTCCTGGCTGGGTGCGG + Intergenic
1015040314 6:128708463-128708485 TACAAACTCCAGGCCGGGCGCGG - Intergenic
1015150340 6:130030370-130030392 GATTTAAACCCGGCCGGGTGCGG + Intronic
1016037347 6:139396871-139396893 AGCTTACTGTCGGCCGGGTGCGG - Intergenic
1016049563 6:139516378-139516400 AACCTGCTCCCGGCCGGGCGCGG - Intergenic
1016065431 6:139677826-139677848 TACTTACTTAAGGCCGGGCGCGG - Intergenic
1017648854 6:156563037-156563059 TACAGATCCCCGGCCGGGTGTGG + Intergenic
1018312775 6:162528000-162528022 TATTTACTCAGGGCCAGGTGTGG + Intronic
1018529312 6:164745677-164745699 TAGTAACACCCGGCCGGGCGCGG - Intergenic
1019566571 7:1683856-1683878 TACCTACTCCAGGTTGGGTGTGG + Intergenic
1020064318 7:5175795-5175817 TACACACACCCGGCCGGGCGCGG + Intergenic
1020325077 7:6968074-6968096 TACTTATATTCGGCCGGGTGTGG - Intergenic
1021880688 7:25092809-25092831 AAATTACTTCCGGCCGGGCGCGG + Intergenic
1024731843 7:52262035-52262057 AACTTACTTCAGGCCGGGCGCGG + Intergenic
1025027060 7:55525198-55525220 TACAGACTCTCGGCCGGGCGCGG + Intronic
1025265655 7:57454732-57454754 TTCTGAATCCCGGCCGGGAGTGG + Intronic
1026457436 7:70584889-70584911 TACATGCTCCTGGCTGGGTGAGG - Intronic
1027596118 7:80176643-80176665 TACTAACTCTTGGCCAGGTGTGG + Intronic
1028621456 7:92833436-92833458 TACTTGCTCCCCGCCGGCTCAGG + Exonic
1029376688 7:100181655-100181677 GGCTTTGTCCCGGCCGGGTGTGG + Intronic
1029716242 7:102328403-102328425 GACTTTGTCCTGGCCGGGTGTGG - Intergenic
1029722879 7:102381607-102381629 GACTTTGTCCTGGCCGGGTGTGG - Intronic
1030189768 7:106798894-106798916 TAAAAACTCCCGGCTGGGTGTGG - Intergenic
1030195894 7:106853342-106853364 TTCAAACTCCTGGCCGGGTGTGG + Intergenic
1030291901 7:107881035-107881057 GATTTACTCTCGGCCGGGCGCGG + Intergenic
1031492809 7:122410051-122410073 AACTTACTACTGGCAGGGTGCGG + Intronic
1033081920 7:138306656-138306678 TAGTTAGTCCAGGCCAGGTGCGG + Intergenic
1033082149 7:138308560-138308582 AACTTATACCTGGCCGGGTGTGG + Intergenic
1033974355 7:147081741-147081763 TAATGAATCTCGGCCGGGTGCGG - Intronic
1034476553 7:151287715-151287737 GACTTTGTCCCGGCCGGGTGCGG + Intergenic
1035211258 7:157329979-157330001 TTCCTATTCCCGGCCAGGTGCGG + Intergenic
1035878177 8:3214132-3214154 TACTTACTTCTAGCCGGGCGTGG - Intronic
1035986654 8:4440703-4440725 TAATTAATTCTGGCCGGGTGTGG + Intronic
1037404256 8:18524491-18524513 TACATACATCAGGCCGGGTGTGG + Intergenic
1037996363 8:23355233-23355255 TCCCAACTCCCGGCCGGATGCGG - Intronic
1038541123 8:28390871-28390893 TACCTACTACAGGCCAGGTGTGG - Intronic
1039982652 8:42421512-42421534 TACTGAATATCGGCCGGGTGCGG + Intronic
1041075601 8:54166787-54166809 TAATATCTCCTGGCCGGGTGCGG - Intergenic
1041165979 8:55092752-55092774 TACATACTGTGGGCCGGGTGTGG - Intergenic
1041822934 8:62060437-62060459 TACTTACTCCCAGCAGGGCGCGG + Intergenic
1047269993 8:123348384-123348406 TACTTAATACTGGCCGGGTGCGG + Intronic
1048411842 8:134182978-134183000 TGTATACTTCCGGCCGGGTGCGG - Intergenic
1049712761 8:144073560-144073582 TACTAACGACCGGCCGGGTGTGG + Intergenic
1049844711 8:144794237-144794259 TATTTATTTCCGGCCGGGTGCGG + Intergenic
1051446490 9:17145129-17145151 TAAATTCTCCAGGCCGGGTGCGG - Intronic
1052849454 9:33367941-33367963 TAGTTACTCTGGGCCGGGCGCGG + Intronic
1055148293 9:72962638-72962660 TATTTATTCCTGGCCGGGTATGG + Intronic
1055502868 9:76919256-76919278 TAATTTCTCCAGGCCAGGTGTGG + Intergenic
1055959668 9:81808396-81808418 TTCTGACTCCTGGCCGGGCGCGG - Intergenic
1057038295 9:91828421-91828443 TACATATTCTCGGCAGGGTGCGG + Intronic
1057866229 9:98683717-98683739 AAATTAATCCAGGCCGGGTGCGG + Intronic
1059231814 9:112727676-112727698 TACCCAATCCCGGCCGGGCGCGG - Intergenic
1061171369 9:128957752-128957774 TACCAAATCCTGGCCGGGTGCGG - Intronic
1061556322 9:131371890-131371912 AAAATACTCCCGGCCGGGCGCGG - Intergenic
1061851599 9:133419128-133419150 TACCCACTCCCGGCCGGGCACGG - Intronic
1185715172 X:2335740-2335762 AAGTTACTCCTGGCCAGGTGCGG - Intronic
1186689933 X:11964432-11964454 CACTGAATCCCGGCCGGGTATGG - Intergenic
1187076341 X:15938928-15938950 TACTTACAACTGGCCGGGCGTGG - Intergenic
1187281651 X:17861568-17861590 TACTGCCTCCCGGCGGGCTGGGG + Intergenic
1187961135 X:24567658-24567680 TACTTAACATCGGCCGGGTGCGG + Intronic
1187986397 X:24817317-24817339 TATTTACTGTCGGCCGGGCGCGG + Intronic
1188545047 X:31295702-31295724 TACTAAGTCAAGGCCGGGTGTGG - Intronic
1189093725 X:38115192-38115214 TACTTATTTCAGGCCGGGCGCGG + Intronic
1189359371 X:40337771-40337793 TGCTTAATTCCGGCCAGGTGTGG - Intergenic
1189418891 X:40837900-40837922 TACCTTTTCCTGGCCGGGTGTGG - Intergenic
1189889781 X:45588920-45588942 TACTAGCTCTTGGCCGGGTGCGG + Intergenic
1193379768 X:80805643-80805665 TACCTACCCCAGGCCGGGCGCGG + Intronic
1195130787 X:101848980-101849002 TAATCAGTCCAGGCCGGGTGTGG - Intronic
1195903384 X:109821300-109821322 GAATAACTCCCGGCCGGGCGCGG + Intergenic
1196129826 X:112143117-112143139 AACTTTCTCCAGGCCGGGTGCGG - Intergenic
1196796789 X:119508298-119508320 TAAGAATTCCCGGCCGGGTGTGG - Intergenic
1197200941 X:123747917-123747939 TAATCAGTCCTGGCCGGGTGTGG + Intergenic
1197831330 X:130646340-130646362 GACTTACTCCAGCCTGGGTGAGG + Intronic
1198200875 X:134417567-134417589 TACATACACTGGGCCGGGTGCGG + Intronic
1199312418 X:146336837-146336859 AACTTACTGCAGGCCGGGCGCGG - Intergenic
1201077345 Y:10197744-10197766 TACCCACTCCCGACCGGGGGAGG + Intergenic
1201154884 Y:11122075-11122097 CAATTAATCCAGGCCGGGTGCGG + Intergenic