ID: 945630101

View in Genome Browser
Species Human (GRCh38)
Location 2:212263976-212263998
Sequence CAACATGACCACAGCAATAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 115}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945630101_945630102 9 Left 945630101 2:212263976-212263998 CCTATATTGCTGTGGTCATGTTG 0: 1
1: 0
2: 0
3: 11
4: 115
Right 945630102 2:212264008-212264030 TTTTCTTTGCTTACTATGCCTGG 0: 1
1: 0
2: 1
3: 36
4: 316
945630101_945630103 20 Left 945630101 2:212263976-212263998 CCTATATTGCTGTGGTCATGTTG 0: 1
1: 0
2: 0
3: 11
4: 115
Right 945630103 2:212264019-212264041 TACTATGCCTGGAATAGTGCTGG 0: 1
1: 0
2: 2
3: 14
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945630101 Original CRISPR CAACATGACCACAGCAATAT AGG (reversed) Intronic
900206280 1:1433229-1433251 AAACATGACCACAGCCAGCTGGG + Intergenic
900689333 1:3970699-3970721 CCACTTGACCTCAGCACTATTGG - Intergenic
907559691 1:55377181-55377203 AAAAATGACCACAGAAATATTGG + Intergenic
908495452 1:64689746-64689768 CAGGATGACCACAGCCATAGAGG - Intronic
908802076 1:67890748-67890770 CAACATTACCACAAAGATATGGG - Intergenic
909587451 1:77306220-77306242 CAACATAACAAAAGCCATATAGG - Intronic
916465923 1:165074586-165074608 CAACCTGACCACAGCAGCACGGG + Intergenic
920995058 1:210982155-210982177 CAACATCCACACAGGAATATTGG + Intronic
921539099 1:216391180-216391202 CAATAAGACCAAAGCAATTTTGG - Intronic
922518920 1:226229316-226229338 TAACAAGACCACTGCAATATAGG - Intergenic
1063154644 10:3367947-3367969 CCACATCAGCACAGCAATACAGG + Intergenic
1063191668 10:3700644-3700666 CAACTTGACCACAGAATTATGGG - Intergenic
1071286523 10:84152986-84153008 AAACATGACCACATCTATATTGG - Exonic
1075323803 10:121513687-121513709 CAAAATGACAACAGCATTCTTGG + Intronic
1076254703 10:129012755-129012777 GAACATGACCCCAGCTACATCGG + Intergenic
1076469999 10:130711743-130711765 CAACATGCGCACAGCAACACAGG - Intergenic
1081477918 11:43453623-43453645 CAAAATGACCAGAGCAGCATTGG + Intronic
1082108514 11:48245804-48245826 CAAGATAACCACAGCGAAATGGG - Exonic
1083841243 11:65305511-65305533 CAAAATGACCACTGCAAGCTGGG + Intronic
1085783465 11:79430437-79430459 CAACATGACCCCTGCCATAAGGG - Intronic
1088152937 11:106768920-106768942 GAACATGACCACAGGTATAAGGG + Intronic
1089564843 11:119365252-119365274 ACACATGACCACAGCTACATGGG + Intronic
1090976463 11:131684267-131684289 CAACCTGACCACAGCGATCCAGG + Intronic
1092531343 12:9348213-9348235 CAACAGGCCCTCAGCAATCTAGG - Intergenic
1098496330 12:71139795-71139817 CAATATGTCCACAGCAACGTAGG + Exonic
1100627970 12:96356048-96356070 TATCATGTCCCCAGCAATATAGG + Intronic
1102395046 12:112578239-112578261 CAGCATGACCCCAGCAATAGTGG + Intronic
1104114595 12:125737153-125737175 AAACATGATCACAGTCATATTGG - Intergenic
1104459274 12:128941382-128941404 CAACACTTCCACTGCAATATTGG + Intronic
1109075887 13:57833938-57833960 CAACATAATCACAGCACTGTGGG - Intergenic
1109993648 13:70092341-70092363 CAACATGAACAAAGTCATATAGG - Intronic
1110139732 13:72113812-72113834 TAACATCAACACAGCTATATGGG - Intergenic
1111263131 13:85769949-85769971 CAAAATAACCACTGCAATACTGG - Intergenic
1113821236 13:113214957-113214979 CAAGATGTCCACAGCCACATGGG - Intronic
1115029745 14:28781144-28781166 CAGCATGTCCATAGCAATAAAGG - Intronic
1115516298 14:34188434-34188456 CAACAAGACCAAAACAATTTGGG - Intronic
1116515650 14:45801946-45801968 CAAAATAACCACATCAATATAGG - Intergenic
1116587794 14:46731873-46731895 CAATATGGCCATAGAAATATAGG - Intergenic
1121394736 14:93610517-93610539 AAACATGTCCAAAGCAATAATGG + Intronic
1124090213 15:26592330-26592352 CAAGATCACCACATCCATATTGG + Intronic
1124781792 15:32642809-32642831 CAACATAATAATAGCAATATAGG + Intronic
1127581340 15:60341764-60341786 AAAACTGACCACAGCAGTATTGG - Intergenic
1128622809 15:69165794-69165816 CATCATGAACACATCAATCTTGG - Intronic
1132524996 16:410073-410095 CAAAATGACCAGAGCAAGACGGG - Intronic
1135397137 16:22139753-22139775 CAGCATGACAACAGAAATTTAGG - Intronic
1147779949 17:42934096-42934118 CAACACGGCCACAGCAATGAAGG + Intergenic
1151739620 17:75971355-75971377 AAACTTGCCCACAGCCATATAGG + Intronic
1203166472 17_GL000205v2_random:101641-101663 TAACATGCATACAGCAATATAGG - Intergenic
1155674054 18:28408299-28408321 CAAGATGACTACAACACTATTGG - Intergenic
1167486967 19:49768177-49768199 CTATTTGACCACAGTAATATGGG + Intronic
926838629 2:17052808-17052830 CAACATGCCCACAGCTACATGGG - Intergenic
927062705 2:19439536-19439558 CAAGATGACCACAGTGATCTAGG - Intergenic
932224097 2:70025482-70025504 GAACTTGACCACAGCAATGTTGG - Intergenic
932414393 2:71564917-71564939 CACCATGACCACAGCAGCTTTGG - Intronic
938670602 2:133582961-133582983 CAACATGACCTCAGAAACAGGGG - Intergenic
941475056 2:165940778-165940800 CTTCATGACCACAGGGATATTGG + Intronic
945141529 2:206691805-206691827 CAAAATGACCACAGAAATAGGGG + Intronic
945630101 2:212263976-212263998 CAACATGACCACAGCAATATAGG - Intronic
946181540 2:217952005-217952027 GAACATGAACACAGCCAGATGGG + Intronic
946448522 2:219760365-219760387 AAACTTGACCAAAGAAATATTGG - Intergenic
1169448837 20:5694240-5694262 CAACAAGATCACAGCAAGAAGGG - Intergenic
1170368176 20:15619610-15619632 CAACATGGCCAAAGCCAAATAGG - Intronic
1170544406 20:17422687-17422709 CAACAGAACAACAGCAAGATGGG + Intronic
1171431681 20:25086738-25086760 CATCCTGACCACAGCTCTATGGG + Intergenic
1176335059 21:5588908-5588930 TAACATGCATACAGCAATATAGG + Intergenic
1176392698 21:6232040-6232062 TAACATGCATACAGCAATATAGG - Intergenic
1176405283 21:6357455-6357477 TAACATGCATACAGCAATATAGG + Intergenic
1176431874 21:6631648-6631670 TAACATGCATACAGCAATATAGG - Intergenic
1176468721 21:7084134-7084156 TAACATGCATACAGCAATATAGG + Intronic
1176492282 21:7465912-7465934 TAACATGCATACAGCAATATAGG + Intergenic
1176508360 21:7672471-7672493 TAACATGCATACAGCAATATAGG - Intergenic
1177691782 21:24519460-24519482 CAACATGACAACAGAAGCATAGG - Intergenic
1184843429 22:47066115-47066137 CAACATGCCAACAGCATTTTGGG + Intronic
1184996696 22:48212301-48212323 TAACGTGACCTCAGCCATATGGG + Intergenic
950349450 3:12333450-12333472 CAACAAAAACACAGGAATATAGG - Intronic
951579266 3:24144591-24144613 GAAATTGACCACAGAAATATAGG - Intronic
952561342 3:34597230-34597252 CAATGAGACCACAGGAATATTGG - Intergenic
955728198 3:61954927-61954949 CAACATGTCCTGAGCAAGATGGG + Intronic
955984173 3:64555831-64555853 CAGAATGACCACAGCATTTTGGG + Intronic
960422558 3:117465077-117465099 CACTATGACTATAGCAATATTGG + Intergenic
961671939 3:128538995-128539017 CAACATGGCCATACCAATCTGGG - Intergenic
965877284 3:173341357-173341379 AGACATGCCAACAGCAATATGGG + Intergenic
970373554 4:15433358-15433380 CTCCATCACCACAGCAAAATGGG + Intronic
970827879 4:20298613-20298635 CAACAAGTCCAGAGCAATAAAGG - Intronic
971805588 4:31354753-31354775 CAACTTGAACACAGGAATTTTGG - Intergenic
972164156 4:36261845-36261867 TAATAGCACCACAGCAATATAGG - Intergenic
975211576 4:71706713-71706735 CAAGCTGACCACAGCAAAAGAGG - Intergenic
975477226 4:74837189-74837211 CAAAATGAGCACAGGCATATCGG + Intergenic
975504655 4:75124579-75124601 TAGCATGGCCACAACAATATTGG - Intergenic
976500828 4:85787078-85787100 TAACAAGACCAGAGCAATACTGG - Intronic
978456715 4:108900823-108900845 TAAAATGACAACAGCCATATTGG + Intronic
980529262 4:134029906-134029928 CAACATGAGAACAGCAGCATGGG - Intergenic
980789335 4:137599329-137599351 AATTATGACCACAACAATATTGG - Intergenic
981571837 4:146160034-146160056 CAACATCCCCACAGCAATGAAGG + Intergenic
982349897 4:154403608-154403630 CAACATGATCAAAGCATTACAGG - Intronic
988104884 5:26731829-26731851 CATAATGCCCACAGCAATTTAGG - Intergenic
993940643 5:94054185-94054207 CAAAATGAAGACACCAATATTGG + Intronic
994562729 5:101396659-101396681 TAACATGCATACAGCAATATAGG - Intergenic
995519569 5:112988818-112988840 CAAAATGACCAAAGCAAAAGAGG - Intronic
999932360 5:156447433-156447455 CAACATGGCCACAGCAGGACTGG - Intronic
1010642383 6:78344363-78344385 CAGAAAGACAACAGCAATATTGG - Intergenic
1013426949 6:110020933-110020955 CAAGATGACCACAGAAAAACAGG - Intergenic
1019255406 7:46655-46677 CAACATCAATACAGCAATCTGGG + Intergenic
1019931545 7:4226502-4226524 CCACATGGCCACAGCAACAGGGG - Intronic
1020841496 7:13223366-13223388 CAACATGATAACAGCTATATTGG - Intergenic
1021755846 7:23851314-23851336 CCACTAGACCACACCAATATTGG - Intergenic
1023699772 7:42881693-42881715 CAAGATGAACTCAGCCATATTGG - Intergenic
1030424456 7:109356372-109356394 AAACATGACCAAACCAATTTAGG - Intergenic
1034331946 7:150290319-150290341 CCACATGCCCACAGCAATGATGG + Intronic
1034666091 7:152819551-152819573 CCACATGCCCACAGCAATGATGG - Intronic
1035258214 7:157645712-157645734 CCACATGACCACAGCAGCACCGG + Intronic
1042521681 8:69718994-69719016 CAACGTGAACACAGCATTAGGGG + Intronic
1043100932 8:76044790-76044812 CAATTTGACCACAGCCTTATGGG - Intergenic
1050710760 9:8460378-8460400 CAAAATTACAACAGAAATATTGG + Intronic
1051683638 9:19634202-19634224 TAACTTGCCCACAGCAATACAGG + Intronic
1052357756 9:27523269-27523291 CATCATTACCACAGTAACATTGG + Intronic
1055793132 9:79945317-79945339 CAAGATGACAACAGCTATCTTGG - Intergenic
1060066595 9:120507378-120507400 CAACTTAACCAAAGCAACATAGG + Intronic
1061049763 9:128187863-128187885 CACCATGCCCACAGCAACACTGG - Exonic
1061891176 9:133621014-133621036 GAACATGAGCACTGCACTATGGG + Intergenic
1203439665 Un_GL000195v1:177060-177082 TAACATGCATACAGCAATATAGG + Intergenic
1187429652 X:19210547-19210569 CAAAATGACCAGAGCAAGCTTGG + Intergenic
1193619694 X:83736982-83737004 CATCATGAGAACAGCATTATGGG - Intergenic
1193862871 X:86692629-86692651 CAACAGCAACACAGCAATATTGG - Intronic
1198615248 X:138451149-138451171 CAATATTACCAAAGAAATATAGG - Intergenic
1198663207 X:138994059-138994081 CAAAATGACAACAGCAAAACTGG - Intronic
1200847603 Y:7848000-7848022 TAACATGATAACAACAATATTGG + Intergenic