ID: 945632766

View in Genome Browser
Species Human (GRCh38)
Location 2:212303101-212303123
Sequence GGGGTAAGTGGACCAAAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 139}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945632756_945632766 27 Left 945632756 2:212303051-212303073 CCTAAGTTTATTATTTTCTTAGG 0: 1
1: 0
2: 4
3: 56
4: 612
Right 945632766 2:212303101-212303123 GGGGTAAGTGGACCAAAAGGAGG 0: 1
1: 0
2: 0
3: 10
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945632766 Original CRISPR GGGGTAAGTGGACCAAAAGG AGG Intronic
902840271 1:19069929-19069951 GGGGTGCGGGGACCAGAAGGAGG - Intergenic
903066689 1:20703605-20703627 TGGGTAGGTGGAAGAAAAGGTGG + Intronic
905966762 1:42104808-42104830 TGGGTAAGTGGAAAAAGAGGAGG - Intergenic
907736027 1:57113025-57113047 GGGGTAAGGGGAGGAAAAAGGGG + Intronic
908195600 1:61743053-61743075 GGGGTGAGGGGACAAAGAGGAGG + Intronic
908486206 1:64596275-64596297 TGGTTAAGTGGACGATAAGGAGG + Intronic
911158023 1:94655561-94655583 GGGGTCAGTGGTACAAAATGAGG + Intergenic
912706542 1:111919292-111919314 AGGGTAATGGGACCAAAGGGAGG + Intronic
915893970 1:159796857-159796879 AGGGTAAGAGGACCTGAAGGAGG + Intergenic
916172504 1:162011343-162011365 AGGGTAACTGGACCCAAGGGGGG + Intronic
916395580 1:164383297-164383319 TGGGGAAGTGGAGTAAAAGGAGG + Intergenic
918149817 1:181788644-181788666 GGGGAAAGTGGTACAAGAGGAGG + Intronic
922410107 1:225365367-225365389 GGGTCCAGTTGACCAAAAGGTGG + Intronic
923648047 1:235844750-235844772 GGGGGAAGGGGACCAAAGAGGGG + Intronic
923816806 1:237389309-237389331 GGGGAAAATGGAGGAAAAGGTGG + Intronic
923894365 1:238252640-238252662 GGGGTGAGGGGATCAAGAGGAGG + Intergenic
924895305 1:248332260-248332282 GGGGTCTGTGGACCAGAGGGTGG - Intergenic
1064573861 10:16724404-16724426 AGGGAAACTGGACCAAAATGAGG + Intronic
1064615664 10:17152987-17153009 GGGGTAGGTGGAGAAAGAGGAGG - Intronic
1067518748 10:46978435-46978457 GTATTAAATGGACCAAAAGGTGG + Intronic
1067643500 10:48073399-48073421 GTATTAAATGGACCAAAAGGTGG - Intergenic
1067736386 10:48854760-48854782 GGGTTAAGTGGGCCCAAAGTAGG - Intronic
1074620650 10:115116790-115116812 GTAGTAAGTGGAGGAAAAGGTGG + Intronic
1074883065 10:117673297-117673319 GGGACATGTGGACCAAAAGAGGG + Intergenic
1076547393 10:131254443-131254465 GGGGTAACTGGAACTACAGGTGG + Intronic
1077408061 11:2391452-2391474 GGGGTGACTGGACAAAGAGGTGG - Intronic
1078632531 11:13016285-13016307 GGGGAGGGTGGACCTAAAGGAGG - Intergenic
1078973841 11:16448429-16448451 GGGGAAAGTTGAATAAAAGGAGG - Intronic
1079694039 11:23456412-23456434 GAGGCAAGTGGATCAGAAGGTGG + Intergenic
1081406455 11:42704483-42704505 GGGGTAAGTGAACAAAAGGCAGG - Intergenic
1081406624 11:42706036-42706058 GGGATAAGTGAACAAAAAGCAGG + Intergenic
1081595212 11:44454169-44454191 TGGGTAAATGGTCCAAAGGGAGG + Intergenic
1083752229 11:64766986-64767008 GGGGGAAGAGGACCAGAGGGAGG + Exonic
1085284389 11:75350580-75350602 GGGGAAACTGGGACAAAAGGAGG - Intronic
1087301476 11:96440973-96440995 GATGTAAGTGGAACAAAAGTTGG + Intronic
1087546447 11:99590152-99590174 GGGGAAAGTGGAAAAAAAAGAGG + Intronic
1088970884 11:114773757-114773779 GGCCTAAGTAGAACAAAAGGTGG + Intergenic
1089395091 11:118131518-118131540 GGGCTAATTGGAGGAAAAGGAGG - Intergenic
1089814962 11:121164712-121164734 GGGGAAAGTGGACCAAGAATCGG + Intronic
1091066143 11:132514989-132515011 GGGCTAAGTGGAGCAGGAGGAGG + Intronic
1091696918 12:2633904-2633926 GAGGTAAATGGAAAAAAAGGAGG - Intronic
1092186520 12:6483687-6483709 GGGATAAGTGGTTGAAAAGGGGG + Intergenic
1095291139 12:40481635-40481657 GGGGCAAGTGGACCATCAGTAGG + Exonic
1096877677 12:54643380-54643402 GGGCAAAGTGAACAAAAAGGTGG - Intergenic
1096997896 12:55850631-55850653 GGGGTAAGAGGGCACAAAGGAGG + Intergenic
1098322341 12:69258754-69258776 GGAGGAAGTGGACCCAATGGAGG - Exonic
1102180005 12:110905243-110905265 GGGGTTAGGGGACAAAAATGGGG - Intronic
1102807172 12:115792304-115792326 GAGGAAAATGCACCAAAAGGGGG - Intergenic
1102916660 12:116759555-116759577 GGGGGAAGAGTACCAAAAAGAGG - Intronic
1109234279 13:59795936-59795958 GGGGTAAGTGCATCAATAAGAGG + Intronic
1110000544 13:70193905-70193927 GGGGTATGGGGGGCAAAAGGAGG - Intergenic
1110324042 13:74193591-74193613 GAGGAAATTGGAACAAAAGGTGG - Intergenic
1110695872 13:78487710-78487732 GGGGTCACTGTAGCAAAAGGTGG - Intergenic
1121212928 14:92222481-92222503 GGGGTAAGGGGACCACTAGTGGG + Intergenic
1125599358 15:40906930-40906952 GGGGGAAGGGGACCAAGAGGGGG + Intergenic
1126220258 15:46205158-46205180 AGGGCAAATGGACCAAAAGTAGG - Intergenic
1130366424 15:83243888-83243910 TGGGTCAATGGACCAAAACGTGG - Intergenic
1131961274 15:97792471-97792493 GGGGTAAGTAGAACAGATGGGGG + Intergenic
1135556859 16:23444450-23444472 GGGGTAAATGGACGAGAGGGTGG - Intronic
1136687413 16:32003410-32003432 GGGGTAAGTGGATAACAAGCAGG - Intergenic
1136788027 16:32946961-32946983 GGGGTAAGTGGATAACAAGCAGG - Intergenic
1136881758 16:33906828-33906850 GGGGTAAGTGGATAAAAAGCAGG + Intergenic
1139364185 16:66423523-66423545 AGGATAAGTGGACCCATAGGAGG + Intergenic
1203090252 16_KI270728v1_random:1208618-1208640 GGGGTAAGTGGATAACAAGCAGG - Intergenic
1143340419 17:6206744-6206766 GGTGTAATTGGAACATAAGGTGG - Intergenic
1143736921 17:8917341-8917363 GGGGGCAGGGGACCAAAAGTGGG + Intronic
1144257305 17:13481460-13481482 GGGGAAATTGGCCCAAAAAGGGG - Intergenic
1146618805 17:34379856-34379878 GGAGTAAGTGGACCAAATTATGG - Intergenic
1148367179 17:47064296-47064318 GGGGTAACTTGACCACATGGAGG + Intergenic
1148384991 17:47228005-47228027 TGAGTAAGTGGGCCAGAAGGAGG + Intergenic
1153825142 18:8868161-8868183 GGGGAATGTGGAGCAGAAGGTGG - Intergenic
1154092223 18:11376266-11376288 GGGGTCTGTGGACCAGAAGATGG - Intergenic
1155225803 18:23728212-23728234 GGCGTAAGTGGACAGATAGGAGG - Intronic
1157444537 18:47734973-47734995 GGGGGAGGTGGACATAAAGGGGG - Intergenic
1159597646 18:70398062-70398084 GTGGTAAGTGGACCAATTAGTGG - Intergenic
1163035306 19:14566141-14566163 CGGGGAAGTGGACCCCAAGGTGG - Exonic
1163197417 19:15732803-15732825 GGTGGAGGTGGACCAAGAGGAGG + Intergenic
1163680378 19:18678121-18678143 GGGGTCAGTGGAGCAAGAAGCGG + Intergenic
1165424102 19:35736535-35736557 TGGGTAACTGGAGCAGAAGGAGG + Intronic
1166496725 19:43308130-43308152 GGGGTGCCTGGATCAAAAGGGGG + Intergenic
925641700 2:5991670-5991692 TGGGTAGGTGGAGCAGAAGGTGG - Intergenic
926918958 2:17920435-17920457 GCAGGAAGTGGACCAAGAGGAGG + Intronic
928217079 2:29370763-29370785 AGGGGAAGTGGGCCAGAAGGTGG - Intronic
930270553 2:49251521-49251543 GGGGAAAGGGGAATAAAAGGAGG - Intergenic
932771807 2:74504634-74504656 GGGGGATGGGGACAAAAAGGAGG - Intergenic
933942000 2:87252839-87252861 GGGGTGAGGGGAACAAAAGGTGG - Intergenic
936338222 2:111608731-111608753 GGGGTGAGGGGAACAAAAGGTGG + Intergenic
943579833 2:189672294-189672316 GGAGTAAATAGACAAAAAGGTGG - Intergenic
945632766 2:212303101-212303123 GGGGTAAGTGGACCAAAAGGAGG + Intronic
946026821 2:216676885-216676907 GGGGTGAGTAGAGCAACAGGCGG + Intronic
948270958 2:236672783-236672805 GGGGTAAGTTGAGCAAATGTAGG + Intergenic
1171176335 20:23052802-23052824 TGGGTAAGTTCACCAAAAGGTGG - Intergenic
1173617203 20:44411009-44411031 GGGGTCAGTGGGCCAACAGCAGG + Intronic
1173691813 20:44966635-44966657 GGGGTCAGGGGAAGAAAAGGCGG + Intronic
1174389356 20:50208306-50208328 GGAGTCAGTGGAGCAAAGGGTGG + Intergenic
1175409677 20:58758629-58758651 CTGGTAAGTGGGCCATAAGGGGG - Intergenic
1175476520 20:59278878-59278900 GGGGAAAGTGAACCACAAGAAGG + Intergenic
1175750673 20:61495144-61495166 GAGGTATGAGGACCAGAAGGCGG + Intronic
1178058053 21:28821200-28821222 GGTGTCAGTGAACCAAATGGAGG - Intergenic
1183324405 22:37183645-37183667 GGGGGAAGGGGACAGAAAGGAGG + Intronic
1184281666 22:43440921-43440943 GGGGAATGAGGAACAAAAGGAGG - Intronic
1184906973 22:47494765-47494787 GAGGAAAGTAGAACAAAAGGAGG - Intergenic
949922667 3:9015188-9015210 GGGGAAAATGGAGCAAAAGGGGG - Intronic
950653677 3:14423498-14423520 GAGGAAAGTGGATGAAAAGGTGG - Intronic
951595074 3:24309919-24309941 GGGGTAAGTGAACAAACAAGTGG + Intronic
953455093 3:43034641-43034663 GAGGTGAGTGGACCAATATGTGG + Intronic
953796451 3:45989700-45989722 GGGGGAAGGGGACCAAGAGAAGG - Intronic
955341592 3:58129516-58129538 GGGGTGAGAGGAACAAAAGGGGG - Intronic
959374267 3:105568689-105568711 GGTCTAAGTAGACCAAAAGCTGG - Intronic
959890841 3:111554372-111554394 GGAGGAAGTAGATCAAAAGGTGG - Intronic
960523501 3:118682482-118682504 GGGGTACCTGGATCAGAAGGAGG - Intergenic
963221625 3:142819316-142819338 GGGGAAAGGGGAACTAAAGGAGG - Intronic
963328156 3:143884727-143884749 GGGGGAAGGGGAGGAAAAGGAGG + Intergenic
963833551 3:150033949-150033971 GGGGTAATTGCACCCAAAAGTGG + Intronic
965698559 3:171436129-171436151 GAGGGAAGTGGACCAGATGGAGG - Intronic
966691237 3:182743540-182743562 GGGTTAAGTAGACCAGAAAGAGG - Intergenic
970789176 4:19836251-19836273 GGGGTAAGGTGAGCAAAAGATGG + Intergenic
979400300 4:120241043-120241065 GAGATAAGTGTACCAAAAAGTGG - Intergenic
984479199 4:180277219-180277241 GTGGTAAGTGGAACAAAACCTGG + Intergenic
984768166 4:183415439-183415461 GGGGCAAGAGAACCAAGAGGAGG - Intergenic
991959863 5:72033946-72033968 GGTTTAAGTGGACCACAGGGTGG - Intergenic
997256239 5:132430308-132430330 TGGGTAAGGGGACCCAAAGGAGG - Intronic
1001292217 5:170471760-170471782 GGGGAAAGAGGATCTAAAGGAGG - Intronic
1010623537 6:78106904-78106926 GGGCTAAGAGGGACAAAAGGGGG - Intergenic
1011607439 6:89118283-89118305 GGGGTTAGAGGACCCAGAGGTGG + Intergenic
1013669514 6:112384350-112384372 CTGGTAAGTGGACCACAGGGAGG - Intergenic
1028285924 7:88998780-88998802 GGGATAATTGGGCCAAAAGCAGG + Intronic
1029362908 7:100100428-100100450 GGGCTAAGGGGACCCAAAGAAGG - Intronic
1033201947 7:139380680-139380702 GGAGAAAGTGGGCCAAAATGAGG - Intronic
1037423147 8:18725538-18725560 GGGGAAAGTGGAACATGAGGTGG - Intronic
1038559344 8:28557772-28557794 GTGCTAAGTGGAACAAAAGAAGG - Intronic
1044070824 8:87757338-87757360 GGGGAAAGGGGAAAAAAAGGAGG + Intergenic
1044204528 8:89477169-89477191 GGGGGAAGTGGCCCAAGATGAGG + Intergenic
1044473305 8:92597419-92597441 AGAGTAAGTGGACTTAAAGGTGG - Intergenic
1046194958 8:110850476-110850498 GGGGTAATTGGACATTAAGGGGG - Intergenic
1050074932 9:1853445-1853467 GGGATAAGTTGGCCAAAAGAAGG - Intergenic
1051302708 9:15670116-15670138 GGAGTAAGTGGAGCAAGAGTAGG - Intronic
1053477651 9:38393618-38393640 AGGGTGAGGAGACCAAAAGGAGG - Intronic
1055350503 9:75381857-75381879 GGGGTAGGTGGACGAAATGCTGG + Intergenic
1058205652 9:102102449-102102471 GGAGTCAGTGAACCAAAAGTAGG - Intergenic
1058602615 9:106686792-106686814 GGGGTAAGTGCAACAAAAGAAGG + Intergenic
1061932298 9:133839363-133839385 TGGATAAGTGGACAGAAAGGTGG + Intronic
1186264570 X:7818561-7818583 GGGGGAAGAGGAGGAAAAGGAGG + Intergenic
1186709200 X:12174842-12174864 AGGTTAAGTGGACCAGAAGAAGG - Intronic
1188473765 X:30568590-30568612 GGGATAAGGGGTCCTAAAGGGGG - Intronic
1189139874 X:38592146-38592168 GGGGTGACTGGATCATAAGGCGG - Intronic
1192404609 X:70871830-70871852 GGGGAAAGTGGAGAAAAAAGGGG - Intronic
1192536859 X:71935742-71935764 AGGGGAAGTGGAACAAAAGGAGG + Intergenic
1192606919 X:72528075-72528097 GGGCTAAGAGGACAGAAAGGTGG - Intronic
1199639447 X:149846358-149846380 GGGGCATATGGACCAAATGGGGG + Intergenic