ID: 945633839

View in Genome Browser
Species Human (GRCh38)
Location 2:212321096-212321118
Sequence TCTACATTAAATAAAATTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 775
Summary {0: 1, 1: 0, 2: 6, 3: 70, 4: 698}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945633838_945633839 -10 Left 945633838 2:212321083-212321105 CCGATGGTAATCATCTACATTAA 0: 1
1: 0
2: 0
3: 9
4: 141
Right 945633839 2:212321096-212321118 TCTACATTAAATAAAATTTGTGG 0: 1
1: 0
2: 6
3: 70
4: 698

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945633839 Original CRISPR TCTACATTAAATAAAATTTG TGG Intronic
901525672 1:9821461-9821483 TATAATTAAAATAAAATTTGAGG + Intronic
901843811 1:11969939-11969961 TCTACAAAGAATAAAATTAGTGG + Intronic
901937955 1:12640074-12640096 TCTATGTTCAATAAATTTTGAGG + Intergenic
902182873 1:14702908-14702930 CCTCCATTAAAGAAATTTTGGGG + Intronic
902408800 1:16201046-16201068 TCTACAAAAAATAAAAATAGAGG + Intronic
903490715 1:23726119-23726141 TCTACAAAAAAAAAAATTTTAGG - Intergenic
903955947 1:27025900-27025922 TAGAGATTAAATAAAATATGAGG - Intergenic
904008617 1:27377281-27377303 TCTACAAAAAATAAAAATTTAGG - Intergenic
904867069 1:33587992-33588014 TTATCATTAAAGAAAATTTGAGG + Intronic
904966062 1:34373692-34373714 TGTTCATTGAAGAAAATTTGAGG + Intergenic
908001058 1:59679946-59679968 TCTCTATAAAATAAAATTAGAGG + Intronic
908172794 1:61524245-61524267 TATGCTTTAATTAAAATTTGTGG - Intergenic
908434126 1:64088412-64088434 TCTATATTAGAAAACATTTGTGG - Intronic
908528833 1:65013609-65013631 ACCAAATTAAATGAAATTTGTGG - Intergenic
909107136 1:71425644-71425666 TTTACATTAAAAAAAGTGTGTGG - Intronic
909216444 1:72896647-72896669 TTTCCATTAATTAAAATTTCAGG + Intergenic
909484984 1:76162575-76162597 TTTAAATGAGATAAAATTTGTGG + Intronic
909674949 1:78228395-78228417 TCTACATTTACTAAGCTTTGGGG - Intergenic
909791426 1:79683033-79683055 ACTACATTAAAAAAAATTCATGG + Intergenic
909796908 1:79751498-79751520 TCTGAATTAAAATAAATTTGGGG - Intergenic
909967841 1:81939468-81939490 TTCATACTAAATAAAATTTGTGG - Intronic
910035777 1:82786024-82786046 GCTACATCAAATGGAATTTGAGG - Intergenic
910134668 1:83953485-83953507 TCAATATTAAAGAAAATTTAGGG + Intronic
910309174 1:85803995-85804017 CCTACATTAAAAATAATTTTTGG + Intronic
910670686 1:89769713-89769735 TCAACATTAAATAAAATTCAAGG + Intronic
911403721 1:97409217-97409239 TTTACATAAAATCATATTTGGGG - Intronic
911815859 1:102349853-102349875 ACTAAATTAAATAAAATATTTGG - Intergenic
911878574 1:103202674-103202696 TGTACATGAACTAAAATTTTGGG - Intergenic
912140626 1:106721548-106721570 TCTACATACCAAAAAATTTGGGG - Intergenic
912655270 1:111481070-111481092 AATACATTAAATAATATTTTGGG + Intergenic
912740811 1:112195267-112195289 TCTTCCAAAAATAAAATTTGAGG + Intergenic
914165321 1:145170582-145170604 TTTACATTAAAAAAAAATCGGGG - Intergenic
914227457 1:145732807-145732829 ACTAATTTAAATAAAATTTGTGG + Intronic
914651139 1:149699211-149699233 TTTACATTAAAAAAAAATCGGGG + Intergenic
914723673 1:150309598-150309620 ACTACATTAAAAAAATTTTCCGG - Intergenic
916329803 1:163602393-163602415 TTTAGATTTCATAAAATTTGCGG + Intergenic
916403912 1:164477937-164477959 GCTACATTGAATAAAATCTTGGG + Intergenic
916541588 1:165760991-165761013 CCTACATTAAAGAGAATTAGCGG + Intronic
917529051 1:175816655-175816677 TGTACATTGAATAAAATTGTTGG + Intergenic
917600228 1:176566403-176566425 TTTACAGTAAATGAAAATTGGGG - Intronic
917736146 1:177922090-177922112 TCTAGACCAAATATAATTTGTGG + Intergenic
918798262 1:188935091-188935113 TCTACAAAAAATAAAATATTAGG + Intergenic
919023485 1:192138058-192138080 TCTGGATAAAATAAATTTTGAGG - Intergenic
919157458 1:193785304-193785326 TCTACATGTAAGAAACTTTGAGG + Intergenic
920064147 1:203253890-203253912 TCCCAAATAAATAAAATTTGAGG - Intronic
921107799 1:212000359-212000381 TCTACATTCAGATAAATTTGTGG + Intronic
921363031 1:214347548-214347570 TTTTCATTAAATAAAATAAGAGG + Intergenic
921608412 1:217181949-217181971 ACTACATGAAATAAAAGTTATGG - Intergenic
921853366 1:219954004-219954026 TATGGAGTAAATAAAATTTGAGG - Intronic
921915410 1:220604926-220604948 TCTAAATTTAATAAAAGTTTAGG - Intronic
922113589 1:222587729-222587751 TTTACATTAGATAAAAATGGGGG + Intronic
923247799 1:232150008-232150030 TCTAAAACAAATAAACTTTGAGG + Intergenic
923329801 1:232912421-232912443 TCAAAATTATATAAAATTTTAGG - Intergenic
924327863 1:242913688-242913710 TCTACTATAAAGAGAATTTGGGG + Intergenic
924518781 1:244787979-244788001 TTTAAATGAAATAAAATTAGAGG + Intergenic
924657947 1:245990466-245990488 TCGACCTTGAATAAAATTTCTGG + Intronic
1063271610 10:4515424-4515446 TCAACATTGAACCAAATTTGGGG - Intergenic
1063497379 10:6522648-6522670 TCTTCATTTAATAAAATGTTTGG + Intronic
1063767004 10:9153866-9153888 TGTGCATAAAATAAAATTTTAGG - Intergenic
1064211529 10:13364172-13364194 GCTACTTTAAAAAAAATTTCTGG + Intergenic
1064382299 10:14856694-14856716 TCTACAAAAAACAAAATTAGCGG + Intronic
1064404456 10:15048787-15048809 TTTAAATTAAATAAACTTTCAGG - Intronic
1064689656 10:17902296-17902318 TCTAAATTCTCTAAAATTTGAGG - Intronic
1065615845 10:27522047-27522069 TCTAAATAAAATGTAATTTGTGG + Intronic
1065731333 10:28712409-28712431 TCTAAATTAAAAAAAAATTAGGG - Intergenic
1065829117 10:29598388-29598410 ACCACAATAAAAAAAATTTGAGG + Intronic
1066020886 10:31300170-31300192 TCTATAATAAACAAAATCTGTGG - Intergenic
1066280072 10:33907689-33907711 TATATATGAAATAAAATTTATGG - Intergenic
1066355974 10:34684287-34684309 TATACATTAGAAAAAGTTTGAGG - Intronic
1066383809 10:34924326-34924348 TCTACTTTTAATAAAGTCTGTGG - Intergenic
1066994248 10:42549395-42549417 TCTACCTAAAAAAAAAATTGTGG - Intergenic
1068156216 10:53202466-53202488 TCTACTTGGAATTAAATTTGTGG + Intergenic
1068161487 10:53271161-53271183 TTTACAATAAAAAAAATTTAAGG - Intergenic
1068177089 10:53475141-53475163 TATAAATTAAATCAATTTTGGGG + Intergenic
1068443582 10:57092173-57092195 TCTGTATTACATAAAATTTCTGG + Intergenic
1069236888 10:66087116-66087138 TCTACATAATAAAAGATTTGTGG + Intronic
1069247769 10:66229131-66229153 TCAACATTCAATAAAATCTTTGG - Intronic
1069306691 10:66979788-66979810 TCTCCATAGAATAAAATTTTGGG - Intronic
1069442201 10:68439092-68439114 TTTACATAAAAAAACATTTGAGG + Intronic
1069649268 10:70032438-70032460 TCTACAAAAAATAAAATTATTGG + Intergenic
1070463695 10:76696492-76696514 TCTACAATAAACAAAAATTGAGG - Intergenic
1070530908 10:77336548-77336570 TCTACTTTCACTAAAAATTGTGG - Intronic
1072055098 10:91747282-91747304 TATACATTATATATAATATGTGG + Intergenic
1072335375 10:94393663-94393685 TCTCTTTTAAATGAAATTTGTGG + Intergenic
1072528633 10:96297396-96297418 ACTACCTTAAAAAAAAATTGAGG - Intergenic
1072984755 10:100129960-100129982 GTTACAATAAATATAATTTGAGG - Intergenic
1073243507 10:102073633-102073655 TCTGCTTTAAATAAAAATTCAGG + Intergenic
1073312429 10:102552929-102552951 TCAAAATAAAATAAAAGTTGTGG + Intronic
1073371086 10:102989801-102989823 TCAAAATAAAATACAATTTGGGG + Intronic
1073795955 10:106988723-106988745 TCTACAATAAATAAAAAATCAGG + Intronic
1074213531 10:111361258-111361280 ATTACATAAAATAAAATTTATGG - Intergenic
1074336967 10:112587145-112587167 TTTTAATTAAATAAAATTTGTGG + Intronic
1074389257 10:113043407-113043429 GCTACAGGAACTAAAATTTGTGG - Intronic
1074478718 10:113798043-113798065 TCAATATTAATTAAAATTAGAGG - Intergenic
1075142315 10:119850235-119850257 TGTATATTACATAAACTTTGGGG - Intronic
1075585480 10:123654409-123654431 CCTACATTAAATAACTTTGGGGG - Intergenic
1075976326 10:126699151-126699173 TCTTCATTAAAAAAGATTTTAGG + Intergenic
1076129960 10:128007163-128007185 TCTACATTGATAAATATTTGAGG + Intronic
1076708823 10:132319755-132319777 TGTAAATTGAATAAAAATTGTGG + Intronic
1077977048 11:7258043-7258065 TATACATAATAGAAAATTTGAGG - Intronic
1078642235 11:13107607-13107629 TCTACATCCGATAAAATTTCAGG + Intergenic
1079495597 11:21039762-21039784 TCTAAAATGAATAAAATTGGAGG + Intronic
1079542346 11:21591627-21591649 TCTGAATTAAACAAAATTAGGGG - Intergenic
1080139805 11:28903031-28903053 CCTAAATTAAATAAAATATGGGG - Intergenic
1080153733 11:29083371-29083393 TCCAAAGGAAATAAAATTTGGGG + Intergenic
1080320221 11:30999773-30999795 TTTACATTAAAAATATTTTGAGG - Intronic
1080971396 11:37281267-37281289 TTTATATTAAATAAATCTTGAGG + Intergenic
1081100467 11:38995603-38995625 TCTACATTAAAGAACAATTTTGG - Intergenic
1081158220 11:39721374-39721396 TTTTCTTTAAAAAAAATTTGCGG - Intergenic
1081318687 11:41663816-41663838 TCTGTATAAAATAGAATTTGGGG + Intergenic
1082181774 11:49128642-49128664 TATACATTAAGTAAATTTTATGG - Intergenic
1082200187 11:49357430-49357452 TCTAAGTTAAGTATAATTTGAGG - Intergenic
1083627699 11:64080010-64080032 TCAAAATTAAATAAAATTCCAGG - Intronic
1084345618 11:68546186-68546208 TCTACATTAATCATGATTTGGGG - Intronic
1084431105 11:69111838-69111860 CCTACATTAAATAAAAGCTGAGG - Intergenic
1084623591 11:70291233-70291255 TCCACCTTAAAAATAATTTGTGG + Intronic
1086151608 11:83617311-83617333 TCTTCCTTTAATAACATTTGTGG + Intronic
1086496343 11:87407937-87407959 TCTAAATTATATAGTATTTGTGG - Intergenic
1086639283 11:89131355-89131377 TCTTCCTCAAATAAAATTTCAGG - Intergenic
1086655485 11:89348766-89348788 TCTAAGTTAAGTATAATTTGAGG + Intronic
1086660163 11:89406291-89406313 GCCACATTTATTAAAATTTGAGG + Intronic
1086683723 11:89706226-89706248 TATACATTAAGTAAATTTTATGG + Intergenic
1087741684 11:101895303-101895325 CCCAAATTAAGTAAAATTTGAGG + Intronic
1087783541 11:102328023-102328045 TGTAAAGAAAATAAAATTTGAGG - Intronic
1087852022 11:103042675-103042697 ACTACTTTAAATAAACTCTGGGG - Intergenic
1087922487 11:103882541-103882563 TCTACCTTAATGAAAATTTAAGG - Intergenic
1089592455 11:119552452-119552474 TCTACATTTAATTAAATTCCAGG + Intergenic
1090026818 11:123174724-123174746 TCTAGATTAAAGAAAATTCATGG - Intronic
1090060153 11:123457704-123457726 AATACATAAAATAAAATATGTGG - Intergenic
1090610845 11:128469058-128469080 TCTCTATTAAACAATATTTGGGG + Intronic
1091619119 12:2072684-2072706 TCTACATTAAAATATATTTTTGG + Intronic
1091717605 12:2790763-2790785 TCTACAAAAAATAAAATTACTGG + Intergenic
1091899768 12:4135285-4135307 TCTACATGAATGAAGATTTGCGG - Intergenic
1092131908 12:6118795-6118817 TCCACTTTAAATAAAATCTGGGG + Intronic
1092734025 12:11562410-11562432 TCTATTTAAAATAAAATTTCAGG - Intergenic
1092800738 12:12163605-12163627 TTTACTTTAAACAAAATTTTAGG - Intronic
1094028286 12:25981885-25981907 TCTATATCAAATTTAATTTGTGG + Intronic
1094160515 12:27384879-27384901 TGTACATGAAATAAAATTCAAGG - Intronic
1094276273 12:28679457-28679479 TTTACATTAGATAAACTCTGAGG + Intergenic
1094600511 12:31904914-31904936 TCTTCATTAAAACAAATTTTAGG - Intergenic
1095572975 12:43703624-43703646 ACTACTGTGAATAAAATTTGGGG + Intergenic
1095818800 12:46454134-46454156 TTTTCATTAGATAATATTTGTGG - Intergenic
1095949564 12:47774460-47774482 GCTACATGAAATAATATGTGTGG + Intronic
1096991458 12:55807500-55807522 TCTCTATTAAAAAAAATTTTTGG + Intronic
1097736181 12:63183618-63183640 TTTACTTAAAATAAAACTTGGGG - Intergenic
1097738766 12:63213415-63213437 TTTACTTAAAATAAAAGTTGGGG - Intergenic
1098122877 12:67260658-67260680 TATAAAATAAATAAAATTTTAGG - Intergenic
1098286158 12:68908994-68909016 TCAACATTAGATAAACATTGAGG - Intronic
1098593402 12:72241199-72241221 TCTACACTTATTAAAATTTGTGG - Intronic
1098626284 12:72674142-72674164 TCTATTTTAAAAAGAATTTGTGG - Intergenic
1099256176 12:80315788-80315810 TCAACATTAAAAAATATCTGTGG + Intronic
1099364493 12:81751235-81751257 TCTAAATTAAAAATACTTTGAGG - Intronic
1099383290 12:81982050-81982072 TTAACATTAAATATAATGTGGGG - Intergenic
1100151616 12:91744701-91744723 TATACATAATTTAAAATTTGTGG - Intergenic
1100533286 12:95480273-95480295 TTTACATTGAACAATATTTGGGG + Intronic
1100550195 12:95640028-95640050 TTTACAATAAATAAAAGGTGGGG - Intergenic
1101020874 12:100552755-100552777 TCTACAAAAAATAAAATGTCTGG + Intronic
1101395517 12:104343497-104343519 TCCACATTAAATAAAGTAAGAGG + Intronic
1101504399 12:105332294-105332316 TCCACATTAAAAAAAATTGTAGG + Intronic
1102549580 12:113682040-113682062 TCTCCATTAAAAAAAAAATGAGG - Intergenic
1102796196 12:115690932-115690954 TCTACATTAAAAACAAGTAGTGG - Intergenic
1103009994 12:117450711-117450733 TCTACAGTAAAAAAAAACTGAGG + Intronic
1105392476 13:19993476-19993498 TCTTCGTTCAATAAAATTGGAGG - Exonic
1105399270 13:20073857-20073879 TATACATAACATAAAATTTACGG + Intronic
1105465943 13:20640270-20640292 TCTACATTTAAAAAAATTAATGG + Intronic
1105534621 13:21253840-21253862 TCTTCATTAAACACTATTTGGGG + Intergenic
1106276236 13:28210461-28210483 TCTAAATCAGATAAAATTGGTGG - Intronic
1106344941 13:28867313-28867335 TCTATATTAAATCAAGTATGAGG - Intronic
1106612458 13:31296555-31296577 TCAACATATGATAAAATTTGGGG + Intronic
1106979799 13:35265417-35265439 TCTTGAGTAAAAAAAATTTGAGG + Intronic
1107663737 13:42666975-42666997 TCTACACTACATAAAATTAGAGG + Intergenic
1108007604 13:45967049-45967071 CCTACATTAAATACAGTTTTAGG + Intronic
1108438838 13:50428035-50428057 TCAATATTAAAGAAAATTAGAGG + Intronic
1108546226 13:51497477-51497499 TATTCATTAAATCATATTTGTGG + Intergenic
1108747013 13:53406077-53406099 TTTAAATTAAATTAAATTTCTGG + Intergenic
1108801418 13:54100791-54100813 TGTATATTAATTATAATTTGTGG - Intergenic
1108978257 13:56477327-56477349 TAAACATTTGATAAAATTTGGGG + Intergenic
1109109382 13:58296518-58296540 TTTATATAAAATATAATTTGGGG + Intergenic
1109582057 13:64353278-64353300 AATAAATTAAATAAAATTTGGGG + Intergenic
1109780046 13:67097701-67097723 TCTACACTAAAGAAAATTTATGG + Intronic
1110492617 13:76126670-76126692 TCTACAATATATTAATTTTGGGG - Intergenic
1110676556 13:78253478-78253500 TTTATTTTAAATAAAATTTAAGG - Intergenic
1111088479 13:83409382-83409404 TCTAAACTAAATAAAAATTTGGG + Intergenic
1111377018 13:87393648-87393670 TCTACAGTCTATGAAATTTGTGG - Intergenic
1111394119 13:87642311-87642333 TCTACAATAAATAATCTTTAAGG + Intergenic
1111842008 13:93461158-93461180 TCTAATAAAAATAAAATTTGTGG - Intronic
1111986213 13:95069392-95069414 TCTTCTTTAAAAAAAAATTGTGG + Intronic
1112527479 13:100165505-100165527 TTTTCATTAAAGAAAATGTGAGG - Intronic
1112723562 13:102275350-102275372 TCTTCATTAGATAATATTTTTGG - Intronic
1112858495 13:103801037-103801059 TTTACATTAGTTCAAATTTGAGG + Intergenic
1112925198 13:104665597-104665619 TCAACAAAAAATAAATTTTGTGG + Intergenic
1113156162 13:107324970-107324992 TCTTCAGTAAATCAAATTTGTGG - Intronic
1114434120 14:22689531-22689553 TCTACTTTAAATAACAGGTGAGG - Intergenic
1114836269 14:26205962-26205984 TGGACATTTAATAGAATTTGGGG - Intergenic
1114849172 14:26361994-26362016 TCTACATTAAGAAAAATGTCTGG - Intergenic
1115020559 14:28675100-28675122 TCTACTTTTCATAAAATTTCTGG + Intergenic
1115188676 14:30722740-30722762 TCTAGATTAAGTACAATTTTAGG - Intronic
1115447223 14:33505041-33505063 AGTACTTTAAATAAAAATTGTGG + Intronic
1115656810 14:35451295-35451317 TTTTTATTAAAAAAAATTTGGGG + Intergenic
1116392288 14:44407505-44407527 TCTACACTCAACAAATTTTGAGG - Intergenic
1117051528 14:51865198-51865220 TGCACATTAAATAAAATTAGGGG - Intronic
1118100276 14:62591808-62591830 TTTTAAGTAAATAAAATTTGAGG + Intergenic
1118212970 14:63782895-63782917 TTTATATTAATTAATATTTGAGG - Intergenic
1118368265 14:65114016-65114038 TTTACATAAAGTAAAATTTAGGG + Intergenic
1118619108 14:67598641-67598663 TATACAATAAATTAAATTTTAGG + Intronic
1118831632 14:69438899-69438921 TCTACATTAAATAAAATATAGGG + Intronic
1119110947 14:71973382-71973404 TTAACATTAAATAAAATTCCTGG + Intronic
1119341218 14:73880270-73880292 TCTTTATTAAATAAAACTTTAGG + Intronic
1119393835 14:74310850-74310872 TTTTCTTTAAAAAAAATTTGGGG + Intronic
1119535668 14:75400741-75400763 TCTAAAATAAATCAAATTGGGGG + Intergenic
1119665707 14:76483602-76483624 TCTACATTACATACACATTGGGG + Intronic
1119810803 14:77517531-77517553 TCTCCATTAGATAAATATTGAGG - Intronic
1119816152 14:77569963-77569985 TTTAAATTAAAAACAATTTGTGG - Intronic
1119905827 14:78301129-78301151 TCCACATTAAATAAAATTTCAGG - Intronic
1120522290 14:85538134-85538156 CCTACATTAAATTAAGTTAGAGG - Intronic
1120961849 14:90132129-90132151 TCAACATTGAATGAACTTTGAGG + Intronic
1121132122 14:91457673-91457695 GGTACATTAAATCAAAATTGAGG - Exonic
1121488192 14:94337118-94337140 TCTAAAATAAAAAAAATTTAAGG - Intergenic
1122735302 14:103835906-103835928 TCTATATTAAAAAAAATTAAAGG - Intronic
1202842904 14_GL000009v2_random:139763-139785 TAAAGATTATATAAAATTTGTGG - Intergenic
1202912302 14_GL000194v1_random:130011-130033 TAAAGATTATATAAAATTTGTGG - Intergenic
1123489428 15:20769292-20769314 TTTAGTTTAAATAAAATTTAAGG + Intergenic
1123545927 15:21338379-21338401 TTTAGTTTAAATAAAATTTAAGG + Intergenic
1123850038 15:24345342-24345364 TCTATATTATATATAATTTTAGG + Intergenic
1123854977 15:24399889-24399911 TCTATATTATATATAATTTTAGG + Intergenic
1123871009 15:24572886-24572908 TCTATATTATATATAATTTTAGG + Intergenic
1124967349 15:34445478-34445500 TCTACATGAAAAAAAAAATGAGG + Intergenic
1125375562 15:39025139-39025161 TCTCCATCAAATTAAATCTGGGG - Intergenic
1125567698 15:40689715-40689737 TCTACATTAACGATAGTTTGTGG - Intergenic
1125626307 15:41112064-41112086 TCTACAGAAAATAAAATTTTTGG - Intronic
1126118931 15:45233882-45233904 TCCATTTTAAATAAAATTTCTGG + Intergenic
1126223941 15:46248000-46248022 TCAACTCTAAATAAAATTTGTGG + Intergenic
1126779781 15:52129584-52129606 TCTAGATTAAATACCATTTGGGG + Intronic
1126891350 15:53207724-53207746 TTTACCTTAAACAAAATGTGAGG + Intergenic
1127000191 15:54494441-54494463 TCTGCATTTTATAAAATTTTAGG + Intronic
1127614719 15:60672532-60672554 TCAACATTAACTAATACTTGTGG - Intronic
1128585387 15:68844971-68844993 TATAAATGAAATAAAATATGTGG - Intronic
1128757373 15:70192375-70192397 TATACATTAAAAATAATTTTTGG - Intergenic
1131103651 15:89714620-89714642 TTGACATTAAAAAAAATATGGGG - Intronic
1131413327 15:92229634-92229656 TCTACATCAAGCAAACTTTGGGG - Intergenic
1132297860 15:100755760-100755782 TCTACATAAAGTGAAATATGAGG - Intergenic
1202954270 15_KI270727v1_random:65651-65673 TTTAGTTTAAATAAAATTTAAGG + Intergenic
1133423499 16:5667020-5667042 TCAACCTCAAATGAAATTTGAGG - Intergenic
1134910055 16:18017629-18017651 ACGACATTTAAAAAAATTTGTGG - Intergenic
1135877046 16:26212318-26212340 TCTACAGTAGACAAATTTTGGGG + Intergenic
1136278893 16:29196179-29196201 TCAACATTGAAAAAAATTGGAGG + Intergenic
1137309446 16:47239629-47239651 TTTACATTAAATACAACTTGAGG + Intronic
1137317386 16:47340085-47340107 TTTACATTATATAAAATTTTGGG - Intronic
1137428448 16:48399227-48399249 TCTAAATAAATAAAAATTTGTGG - Intronic
1137868510 16:51926874-51926896 GGAAAATTAAATAAAATTTGTGG + Intergenic
1137898681 16:52241064-52241086 TGCTCATTAAATAAAAATTGAGG - Intergenic
1138715728 16:59019972-59019994 TATACAACAAACAAAATTTGTGG + Intergenic
1138916267 16:61468610-61468632 TCTATATTATACAAAATCTGAGG + Intergenic
1139734866 16:68978866-68978888 TTTCCATTAAAAAAAAATTGAGG + Intronic
1140943243 16:79743142-79743164 GCTACATTAATCAAACTTTGTGG + Intergenic
1141021885 16:80505007-80505029 CCACCTTTAAATAAAATTTGGGG - Intergenic
1141027262 16:80560284-80560306 TTTTCATTAAATAAAATTTGTGG - Intergenic
1141365278 16:83436938-83436960 CCTACATTAAAAAAAAATGGTGG - Intronic
1141931305 16:87205676-87205698 ACTACAAGATATAAAATTTGTGG + Intronic
1142439112 16:90082971-90082993 TCTAAATTAAAAAAAATTTTAGG + Intronic
1144227710 17:13166895-13166917 TCAACATTAAAGATAATTTTAGG + Intergenic
1145320288 17:21763154-21763176 TCTTCAATAAATAAATTATGAGG + Intergenic
1145710193 17:26964035-26964057 TCTACAAAAAATAAAATATTAGG + Intergenic
1145858694 17:28187778-28187800 ACTTAATTAAATGAAATTTGTGG + Intronic
1146717409 17:35098217-35098239 TGAAAATTAAATAAAATGTGGGG + Intronic
1147634069 17:41952066-41952088 TCTACAAAAAATAAAAATTAGGG + Intronic
1147710605 17:42461360-42461382 TTTAAAAAAAATAAAATTTGAGG + Intronic
1148368359 17:47073422-47073444 AATACATTAAATATATTTTGGGG - Intergenic
1149149688 17:53546007-53546029 TCAAGAATAAATAAAATTTCAGG - Intergenic
1149329448 17:55566301-55566323 TTTTCATTAAAAAAAATTTGTGG + Intergenic
1150662842 17:67099862-67099884 TCTATTTTAATTAAAATTTCTGG - Intronic
1150804235 17:68306524-68306546 TCTACATTTAAAAAAATTTTTGG - Intronic
1151031938 17:70751215-70751237 TTTACATTGTATAAAATTAGAGG + Intergenic
1151222882 17:72626422-72626444 TATACAGTAATTAATATTTGTGG + Intergenic
1151773773 17:76183641-76183663 TCCACATTAAAAAACATTTATGG + Intronic
1153139614 18:1955491-1955513 TGTACATGATATAATATTTGGGG + Intergenic
1153271032 18:3321549-3321571 TCTAAATGAATTGAAATTTGAGG + Intergenic
1153288321 18:3476823-3476845 TCTCAATTAAAAAAAATTGGGGG + Intergenic
1153411803 18:4801901-4801923 GCTACATTAATTAAATTTAGTGG + Intergenic
1153578555 18:6548303-6548325 TATAAATTAAATAAAGTTTATGG - Intronic
1154179772 18:12124410-12124432 TTAAGATGAAATAAAATTTGTGG - Intronic
1155545048 18:26906131-26906153 CATACATCAAATTAAATTTGAGG - Intergenic
1155753826 18:29464117-29464139 TCTATATGAAATAAAATTTGGGG - Intergenic
1156123117 18:33869114-33869136 TCTACTTACAGTAAAATTTGAGG - Intronic
1156946661 18:42841326-42841348 GTTAAACTAAATAAAATTTGAGG + Intronic
1157310569 18:46549667-46549689 TCTTTATTAGATAAAATTTAAGG + Intronic
1157412438 18:47474754-47474776 CCTTTATTAAATAAAATTTAGGG + Intergenic
1158313166 18:56181068-56181090 TCTACACTAAATAAAAATAAAGG + Intergenic
1158714145 18:59862992-59863014 TCTACAAAAAATAAAAATTAAGG + Intergenic
1158744215 18:60179117-60179139 TCTATATAGAATATAATTTGGGG - Intergenic
1159081065 18:63736701-63736723 TCTAAATTTAAAAAAAATTGTGG - Intergenic
1159812707 18:73035682-73035704 TCCACATTAAAAATAATTTCAGG + Intergenic
1159839438 18:73380903-73380925 TTGACATCAAATACAATTTGAGG + Intergenic
1160469170 18:79112481-79112503 TCATCATTCAATAAAATTTTAGG - Intronic
1161006498 19:1939886-1939908 TCTACAAAAAATAAAAGTAGCGG - Intergenic
1163710308 19:18842692-18842714 TTTTAATTAAAAAAAATTTGGGG + Intronic
1164053416 19:21602504-21602526 TCTACAAAGAATAAAAATTGGGG + Intergenic
1164516136 19:28937257-28937279 GCTACTTTAAAGAAAAATTGAGG + Intergenic
1164566059 19:29326908-29326930 TCTACATAAAATAAAAACTTAGG - Intergenic
1165023418 19:32942034-32942056 TCTTCACAAAATAAAATTGGGGG + Intronic
1166145333 19:40830636-40830658 TCTACATTAAAAAAATTTTTGGG + Intronic
1166255506 19:41601622-41601644 TCTACATTACATCCCATTTGGGG + Intronic
1166568401 19:43779026-43779048 TCTACATAAAATAAAAAGGGTGG + Intronic
1167160372 19:47763677-47763699 GCTCCATTACAGAAAATTTGGGG - Intergenic
1167316035 19:48763271-48763293 TCTACAAAAATTAAAATTTCGGG + Intergenic
924963266 2:53945-53967 CCTATATTATATATAATTTGAGG - Intergenic
927218451 2:20683851-20683873 TCTCCATTAAAAAAAAAATGAGG + Intergenic
927533155 2:23829352-23829374 TTTACATTTCATAGAATTTGTGG + Intronic
928563137 2:32513370-32513392 TCTACATTAAGCATAATTTTAGG - Intronic
929065371 2:37968055-37968077 TCTAGATGACATAAAATTTCAGG + Intronic
929327730 2:40637483-40637505 TCTAAAATAAATGAAACTTGTGG - Intergenic
929381063 2:41354581-41354603 TCTAAATTAAATAATATGTTTGG + Intergenic
930360783 2:50376598-50376620 TCTTAATTAATTGAAATTTGTGG - Intronic
931080598 2:58765565-58765587 TCTACATTAAAAAAAACTCCAGG - Intergenic
931090123 2:58876685-58876707 TCTACAAAAAATGAAATTTCTGG - Intergenic
931405395 2:61972214-61972236 TTCTCATTAAAGAAAATTTGGGG + Intronic
932532031 2:72545621-72545643 ACTACATTAAATAAATGATGTGG - Intronic
933072169 2:77872309-77872331 GGTACATTACATAAAATGTGAGG - Intergenic
933117765 2:78496626-78496648 GCTAAATTGAATAATATTTGAGG + Intergenic
933289846 2:80425968-80425990 AAAACATTTAATAAAATTTGGGG + Intronic
934135172 2:88988970-88988992 TCTGCATAAAATATTATTTGAGG - Intergenic
934137092 2:89006551-89006573 TCTGCATAAAATATTATTTGAGG - Intergenic
934143479 2:89070921-89070943 TCTGCATGAAATATTATTTGAGG - Intergenic
934146195 2:89096507-89096529 TCTGCATAAAATATTATTTGAGG - Intergenic
934147918 2:89113890-89113912 TCTGCATAAAATATTATTTGTGG - Intergenic
934221362 2:90086718-90086740 TCTGCATAAAATATTATTTGTGG + Intergenic
934223070 2:90104068-90104090 TCTGCATAAAATATTATTTGAGG + Intergenic
934225760 2:90129634-90129656 TCTGCATGAAATATTATTTGAGG + Intergenic
934234013 2:90213939-90213961 TCTGCATAAAATATTATTTGAGG + Intergenic
934235136 2:90224791-90224813 TCTGCATAAAATATTATTTGAGG + Intergenic
934626232 2:95857189-95857211 TTAAGATGAAATAAAATTTGGGG + Intronic
934807332 2:97244127-97244149 TTAAGATGAAATAAAATTTGGGG - Intronic
934812233 2:97289939-97289961 TCTACATAAAATAAAAGTACAGG + Intergenic
934825461 2:97417984-97418006 TCTACATAAAATAAAAGTACAGG - Intergenic
934830178 2:97513060-97513082 TTAAGATGAAATAAAATTTGGGG + Intronic
936393915 2:112103801-112103823 TCTCAATAAAATAAAATTAGTGG + Intronic
936633122 2:114226088-114226110 TATTAATTAAATTAAATTTGAGG + Intergenic
936800834 2:116263158-116263180 AATACAATATATAAAATTTGTGG + Intergenic
937329511 2:121017740-121017762 TCTACATAGAAGACAATTTGAGG - Intergenic
937602211 2:123752108-123752130 TCCACCTCAAATTAAATTTGGGG - Intergenic
937644042 2:124246087-124246109 TATATATTATCTAAAATTTGAGG - Intronic
937935739 2:127242471-127242493 TCTCCAACACATAAAATTTGGGG + Intergenic
937950002 2:127377200-127377222 TCTATTTTAAATAAATTTTATGG - Intronic
938023843 2:127927665-127927687 TATACGTTAAATAAAATGTATGG - Intergenic
938602584 2:132857297-132857319 TCCACATTTAATACAATTTCTGG + Intronic
939242698 2:139581786-139581808 TCTACAATAAATAAAAATAAAGG + Intergenic
939303964 2:140385321-140385343 TCTTCAGAAAGTAAAATTTGGGG + Intronic
939698187 2:145354895-145354917 TCTCAATTAAATATTATTTGGGG - Intergenic
939818427 2:146925272-146925294 TTCACATTAAAAAAAATTTCTGG - Intergenic
940207824 2:151223608-151223630 TGTAAATTAAAAAAAAATTGAGG - Intergenic
940486688 2:154304750-154304772 ATTACAATAAATAATATTTGGGG + Intronic
941261325 2:163301536-163301558 TTTACATTAAATGAAATCTGAGG - Intergenic
941597349 2:167494556-167494578 TCTACATAAAATAGCATATGTGG + Intergenic
941790671 2:169548792-169548814 TCTAAATTAAAACAAAATTGAGG + Intronic
942291217 2:174473203-174473225 TCAAAATAAAATAAAAATTGTGG - Exonic
942691034 2:178585440-178585462 TATATATTAAAAAAAATTGGTGG - Intronic
942928973 2:181466594-181466616 TCTACAATAAAAATAATTTTGGG - Intronic
943065026 2:183076667-183076689 TCTACAGTAAATAAAAGATAAGG + Intergenic
943808754 2:192157678-192157700 TATACTTTTATTAAAATTTGAGG - Intronic
943810193 2:192176284-192176306 TCTACATCAAATAAACTTGTTGG - Intronic
943826903 2:192406602-192406624 TTTACATTAAATATTGTTTGAGG - Intergenic
943893789 2:193326619-193326641 TCATCATAAAAGAAAATTTGTGG + Intergenic
943958679 2:194229986-194230008 TCTACCTTAAATAAAAATTAAGG - Intergenic
944335874 2:198533582-198533604 TATACATAAAATCAAATATGAGG - Intronic
944420073 2:199520594-199520616 TTTTCATTTAATAAAATGTGAGG + Intergenic
945019127 2:205553463-205553485 TCTACATGAAATAGAAATTCTGG + Intronic
945270158 2:207930280-207930302 TGTACAGAAAATAAGATTTGAGG + Intronic
945397541 2:209338416-209338438 TCTACATTAAAGAAGATTATTGG - Intergenic
945633839 2:212321096-212321118 TCTACATTAAATAAAATTTGTGG + Intronic
945666545 2:212750985-212751007 TCTCCATAAAATAAAATTACAGG + Intergenic
945854407 2:215051284-215051306 TCTAGTTTACATAATATTTGAGG - Intronic
947600181 2:231442780-231442802 TCTACAAAAAATAAAATTAGTGG - Intergenic
1169596596 20:7206872-7206894 TGCACGATAAATAAAATTTGTGG + Intergenic
1170028231 20:11914275-11914297 ACTACATTAAATACAAATTATGG - Intronic
1170892526 20:20388224-20388246 TCTGCAAGAAATAAAATGTGTGG + Intergenic
1171174891 20:23044199-23044221 TCTAAGTTAAGTACAATTTGGGG + Intergenic
1171241591 20:23572250-23572272 ACTACATTGAATAAAAGTGGTGG + Intergenic
1171332490 20:24352711-24352733 GCTACATAAAATAAAAATTTTGG - Intergenic
1171540380 20:25947210-25947232 TCTAGATTAAAAAAAATTAAGGG - Intergenic
1172156731 20:32831142-32831164 TCTTCATTAAAAAAAATTAAAGG + Intronic
1173546927 20:43904788-43904810 ACAACATTAAATAAAGTTTGGGG + Intergenic
1173696675 20:45022079-45022101 TATACATAACATAAAATTTGAGG + Intronic
1174814267 20:53673299-53673321 TCTCAATTAAATAATATTTCCGG - Intergenic
1175180801 20:57145730-57145752 TCAACATTCAAATAAATTTGTGG + Intergenic
1176166395 20:63676264-63676286 TCTTCAATAAATAAAGTGTGAGG - Intronic
1176631659 21:9144684-9144706 TAAAGATTATATAAAATTTGTGG - Intergenic
1176864956 21:14043551-14043573 TCAACTATAAATAAAATTTGTGG + Intergenic
1177454466 21:21317894-21317916 TATACATTAAAGAAAAGTTTTGG - Intronic
1177667364 21:24178469-24178491 TCTACATAAAAGAAAACTAGAGG + Intergenic
1177724354 21:24947959-24947981 TATACATTAAATTAAATGTATGG + Intergenic
1177799334 21:25812544-25812566 TCTACAAAAAATAAAAAATGAGG + Intergenic
1178282701 21:31297158-31297180 TTCACATTATATAAAATTAGAGG + Intronic
1178571247 21:33739092-33739114 ACTACATTAAAAAATATCTGAGG - Intronic
1178641914 21:34351733-34351755 CCTACATTCTCTAAAATTTGGGG + Intergenic
1179636480 21:42714315-42714337 TGTACGTAAAATAAAAGTTGGGG - Intronic
1180350667 22:11799532-11799554 TAAAGATTATATAAAATTTGTGG + Intergenic
1180374945 22:12082926-12082948 TAAAGATTATATAAAATTTGTGG + Intergenic
1180387543 22:12192543-12192565 TAAAGATTATATAAAATTTGTGG - Intergenic
1180566874 22:16677081-16677103 TTAAGATGAAATAAAATTTGTGG + Intergenic
1183609820 22:38892125-38892147 TCTAAATTAAAAGAGATTTGTGG - Intergenic
1183894159 22:40954442-40954464 ACTACATGTAATAAAATATGTGG - Intronic
1183969157 22:41463212-41463234 TGTAAATTAATTAAATTTTGGGG - Intronic
1184615023 22:45632100-45632122 TAAACATAAAATAAAATGTGAGG + Intergenic
949915581 3:8961295-8961317 TCTAAACTAAAGAAATTTTGGGG - Intronic
950351583 3:12359442-12359464 TTTAAATTAAATAAAGTTGGGGG - Intronic
950631130 3:14282838-14282860 TTTAAATGAGATAAAATTTGTGG - Intergenic
950858415 3:16126654-16126676 TCTACACTAAATGAGATTTATGG - Intergenic
951961447 3:28327421-28327443 TCTACATTAAAATAAAATTTAGG + Intronic
952660635 3:35842356-35842378 GCCACATTAAATGAGATTTGGGG - Intergenic
952959697 3:38581530-38581552 TCCACATTCAATAAAATGAGGGG - Intronic
955037132 3:55279670-55279692 TCTGCATTTAATAGGATTTGGGG + Intergenic
955758061 3:62246646-62246668 TCTCCATTAAAGAAAAGTTGTGG - Intronic
955928884 3:64035859-64035881 TGTATATTAAATGATATTTGGGG + Intergenic
956044258 3:65178542-65178564 TCTACATAAAGTAATATTCGAGG - Intergenic
956281594 3:67562608-67562630 TCTTTATTACATAAAATTGGGGG - Intronic
956538263 3:70304265-70304287 TGGAAATTAAATAAAATTTCTGG - Intergenic
956546932 3:70414871-70414893 TCTAAAGTAAATATAATTTTTGG + Intergenic
956563826 3:70613606-70613628 TCTTCTTTAAATAAAATTAGTGG - Intergenic
957019924 3:75114558-75114580 TATACATTAAATAAATTTTAAGG + Intergenic
957217346 3:77337474-77337496 TCAACATGAAATGAATTTTGAGG - Intronic
957269906 3:78016429-78016451 TCAACATTAAATAGAACCTGAGG - Intergenic
957274275 3:78069787-78069809 TCTATTTAAAATAGAATTTGAGG - Intergenic
957318535 3:78599518-78599540 TCTCAATTTAATAAAAGTTGAGG - Intronic
957496835 3:81003772-81003794 TCTATATTAACTAAACTTTGTGG - Intergenic
957798799 3:85047964-85047986 TATACATTAATTAAAAGTTGGGG - Intronic
957901302 3:86496552-86496574 CCAACAATTAATAAAATTTGTGG + Intergenic
957975110 3:87433259-87433281 TATAAGTTAAATAAAATGTGGGG + Intergenic
958653147 3:96963770-96963792 TATAAAGTAAATAACATTTGCGG + Intronic
958662677 3:97091650-97091672 TGTATGTTAAATAATATTTGTGG + Intronic
958748427 3:98165351-98165373 TCTAAAGTAAATACCATTTGGGG + Intergenic
959380116 3:105631480-105631502 TCTACTTTTGATAAAAATTGTGG - Intergenic
959643268 3:108665576-108665598 TATACATTTCATCAAATTTGGGG - Intronic
959772281 3:110112745-110112767 TCTACATAAAATAACATTTAAGG - Intergenic
959929882 3:111968418-111968440 AAGACATTAAATAAAATGTGTGG - Intronic
960047944 3:113214882-113214904 TGTACAATAAATAAAAACTGAGG - Intronic
960072934 3:113452173-113452195 TGTAAGTTAAATAAACTTTGTGG - Intronic
960235006 3:115272008-115272030 TCTAAATAAAATAAAATTAAAGG - Intergenic
960444274 3:117728796-117728818 TTTACATTAAATACATTTGGAGG - Intergenic
961135531 3:124506522-124506544 TATACATTAACTAGAATTTCAGG + Intronic
961309498 3:125986330-125986352 TCTCCTTTAAAAAAAATTTCAGG + Intergenic
962133856 3:132711605-132711627 TTTACATTAAAGAAACTTTCTGG - Intronic
962179882 3:133195274-133195296 TATACATTACTTAAATTTTGTGG - Intronic
962296507 3:134193718-134193740 TATACAGTAAACAAAATTTAAGG - Intronic
962576580 3:136760372-136760394 TTTACAGAAAATAAAATTAGAGG - Intergenic
962579728 3:136787207-136787229 ACTACAATTAATAAATTTTGAGG - Intergenic
962613092 3:137097508-137097530 ACTACCTTAAAAAAATTTTGAGG + Intergenic
962918041 3:139925384-139925406 TTCACATAAAATAAAATTTAAGG - Intergenic
963383788 3:144565092-144565114 TTTACCCTGAATAAAATTTGAGG + Intergenic
963582528 3:147144252-147144274 TCTATTTTTAATAAAATTTTAGG - Intergenic
963626138 3:147676342-147676364 TCTACAGCAAAAATAATTTGGGG + Intergenic
964309100 3:155373391-155373413 TCTTCATTAAACAAAATCTCTGG + Intergenic
964542508 3:157795252-157795274 TGGACCTTAATTAAAATTTGTGG + Intergenic
964575468 3:158161777-158161799 CATACATAAAATAAAATGTGTGG + Intronic
964653831 3:159043980-159044002 TCAACATTGCATAACATTTGGGG - Intronic
964740147 3:159956303-159956325 TCCACATTACAGAAGATTTGTGG + Intergenic
965132302 3:164716504-164716526 TCAACATTTAATAAAGTTGGTGG - Intergenic
965480122 3:169208351-169208373 GGTACATTTATTAAAATTTGTGG + Intronic
965753046 3:171997730-171997752 TTTAAATAAAATAAAAATTGAGG - Intergenic
965815800 3:172635486-172635508 TTTACATTAAAAAAAAGTTGGGG + Intronic
965944849 3:174227609-174227631 TCTAAATTAGATAAATTATGAGG - Intronic
966094442 3:176182535-176182557 TCTAAAAAAAATAAACTTTGAGG - Intergenic
966564665 3:181363069-181363091 TCTACCTTAAATTTAATTTGTGG - Intergenic
966640035 3:182179463-182179485 TCTACATTTAATACATTTTTAGG + Intergenic
967139028 3:186537827-186537849 TCAAGATTAAATAAAATCTCAGG + Intergenic
967438066 3:189474314-189474336 TCTTCATTATATAAAATTCAAGG + Intergenic
967660631 3:192104504-192104526 TCTACTTATAGTAAAATTTGAGG - Intergenic
968687502 4:1971189-1971211 TCTCAATTAAAAAAAAATTGTGG + Intronic
970258070 4:14190547-14190569 TATCCATTAAGTAGAATTTGAGG - Intergenic
970824809 4:20256894-20256916 ACAACATTTAATAAAAATTGGGG + Intronic
970849121 4:20580913-20580935 GCTACATGAAATAAAATGAGAGG + Intronic
971088073 4:23303017-23303039 TATCCATCAAATAAAATTTAAGG + Intergenic
971540385 4:27808846-27808868 TCTAGATGAAATAAGATTTGAGG + Intergenic
971629505 4:28972055-28972077 TCTACATAAAATTAAAAGTGAGG - Intergenic
971645962 4:29203537-29203559 TCTATATTAAATGAAATTACAGG - Intergenic
971765105 4:30820852-30820874 ATTACAGTAAAGAAAATTTGAGG + Intronic
971888655 4:32487236-32487258 TATAGATTATATAAAATTGGAGG - Intergenic
971966914 4:33570740-33570762 ACTATAATAAATAAAATTTCAGG - Intergenic
972050821 4:34731013-34731035 TGTTCATTAAATACATTTTGAGG - Intergenic
972711443 4:41600049-41600071 ACTGGATAAAATAAAATTTGGGG + Intronic
973697166 4:53501448-53501470 TCTACAAAAAATGAAATTAGTGG - Intronic
974030919 4:56775748-56775770 TTTACATTAGAAACAATTTGGGG - Intergenic
974476179 4:62384143-62384165 TCTTCAGTAAATAACATTTCAGG + Intergenic
974499543 4:62682822-62682844 TCTACGTTAAACAAAATTATTGG - Intergenic
974580187 4:63788598-63788620 GCTAAATTAATTAAAAGTTGAGG - Intergenic
974689780 4:65282241-65282263 ACTCCATTAAATAAATTATGAGG + Intergenic
974791780 4:66700369-66700391 TCAAAATTAAATAAAAGTTCAGG - Intergenic
974794994 4:66737171-66737193 TTTTCATTACTTAAAATTTGTGG + Intergenic
975567051 4:75768179-75768201 TCTACAAAAAATAAAAATTTAGG - Intronic
975648658 4:76570064-76570086 TCTACTTCAAATAAAGTTTGGGG + Intronic
976345649 4:83997040-83997062 TTTACATTAAACAAAATTAAAGG - Intergenic
977526137 4:98147397-98147419 TCTACATTTAATGGAATTTGAGG + Intergenic
977951248 4:102972745-102972767 TTTAAAATAAATAAATTTTGTGG + Intronic
978643780 4:110904051-110904073 TCTCAAATAAATAAATTTTGTGG + Intergenic
978975628 4:114866929-114866951 TCTACATCAAATGAAATTTCAGG - Intronic
979055007 4:115982126-115982148 TCCACTTTACATGAAATTTGAGG - Intergenic
979063049 4:116091126-116091148 TTGACATTCAATAAAATTTTAGG + Intergenic
979092170 4:116498281-116498303 TTTTCATTAACTAAAACTTGTGG + Intergenic
979715924 4:123837763-123837785 TATTCATAAAATAAAATTAGAGG - Intergenic
979994739 4:127416875-127416897 TATACATTTAAAAATATTTGAGG - Intergenic
980564367 4:134519373-134519395 TTTATTTTAAATAAAATGTGTGG - Intergenic
980697965 4:136384204-136384226 GCCACATAAAATAATATTTGAGG + Intergenic
980924779 4:139124280-139124302 TCCACAAAAAATAAAATTAGAGG + Intronic
981186488 4:141809750-141809772 TGTTCATTAAATAACATTGGAGG - Intergenic
981239718 4:142462465-142462487 ACTACATTAAACCAATTTTGAGG - Intronic
981503644 4:145477780-145477802 TTTACAATATATAAACTTTGGGG - Intergenic
981546640 4:145900708-145900730 TGTATATAAAATAAAATTTTAGG - Intronic
981760186 4:148185915-148185937 TCTACATTAAATACTCATTGTGG - Intronic
981964778 4:150586774-150586796 TTTAAATTAAATCAAATTTTAGG + Intronic
982697291 4:158616691-158616713 TATAATTTAAATAAAATTAGAGG + Intronic
982744194 4:159089539-159089561 TGTACATAATAAAAAATTTGTGG + Intergenic
982841382 4:160191748-160191770 TCTGCATAAAATAGAATTTTAGG - Intergenic
983007503 4:162502165-162502187 TCTATATTAAACTAAATATGAGG + Intergenic
983790920 4:171795843-171795865 TCTCCTTTAAAAAAAATTTCTGG - Intergenic
986104725 5:4648918-4648940 AACACATTAAATAAATTTTGGGG + Intergenic
986596999 5:9433116-9433138 TCCACAATAAATTAAAATTGGGG + Intronic
987210721 5:15679507-15679529 TCTACATTAATTTACATTTGGGG + Intronic
987218371 5:15763512-15763534 ACTACATCGAATATAATTTGTGG + Intronic
987501760 5:18720404-18720426 TATAACTTAAAGAAAATTTGAGG - Intergenic
987931287 5:24402199-24402221 TGGAAATGAAATAAAATTTGAGG - Intergenic
988026586 5:25700996-25701018 TCCACATTTAAAAAAAATTGTGG + Intergenic
988133679 5:27140020-27140042 TTTACTTTAAAGAGAATTTGAGG + Intergenic
988215873 5:28271988-28272010 TCTCCATTAACTAAAATTAAGGG - Intergenic
988552920 5:32212844-32212866 TTTACATTAAAAAATGTTTGTGG - Intergenic
989762099 5:45028265-45028287 TCTACATTGATAAAAATCTGTGG - Intergenic
990083897 5:51951719-51951741 TGTTCATTAAATAAAATTTGGGG + Intergenic
990191363 5:53263773-53263795 TCTACATTAAATGAAGTGTTTGG + Intergenic
990313058 5:54558214-54558236 TCTACTTTAAAAAATATTTAGGG - Intergenic
990479379 5:56194014-56194036 TCTGCCTTAAAGAAAATTTTAGG + Intronic
990481202 5:56212899-56212921 TCTATATTAAATAACATAAGGGG + Intronic
990644781 5:57831887-57831909 TCTAATTTAAAAAAAAATTGAGG - Intergenic
990652712 5:57920635-57920657 TGTATATCAAAGAAAATTTGAGG + Intergenic
990964750 5:61433230-61433252 TCTATATTAATTTATATTTGGGG + Intronic
991392572 5:66163097-66163119 TCTGCATGAAATAGAATTTCTGG - Intronic
991636714 5:68713392-68713414 TCTAGATTTGAAAAAATTTGAGG + Intergenic
991712761 5:69424308-69424330 GCAAGAATAAATAAAATTTGAGG + Intronic
992059038 5:73023778-73023800 TCTATATTAAACGAAATTAGTGG - Intronic
992473671 5:77081964-77081986 TCTATATTAATTAAAAATAGAGG + Intronic
993016604 5:82541615-82541637 TCTAAAATAAATGAAATTTTGGG - Intergenic
993042506 5:82831237-82831259 TTAACATTAATTAACATTTGTGG - Intergenic
993507936 5:88733941-88733963 TTTACTGTAAAGAAAATTTGGGG - Intronic
993608102 5:90019483-90019505 TCTCCTAGAAATAAAATTTGGGG - Intergenic
993775872 5:91994755-91994777 TCTCCAATACATAAATTTTGAGG + Intergenic
993886940 5:93425963-93425985 CCTACATTAAAAAAGATTTAAGG + Intergenic
993994070 5:94699325-94699347 TCTACATCTAAAAAGATTTGGGG - Intronic
994213822 5:97114646-97114668 TCTGCATATAATAAGATTTGCGG + Intronic
994286648 5:97976958-97976980 TCTACATTTTTTCAAATTTGGGG + Intergenic
994576233 5:101583155-101583177 GTTACATAAAATAGAATTTGTGG + Intergenic
994786763 5:104175582-104175604 TATACAATATATAAAATTTATGG + Intergenic
995210948 5:109538498-109538520 TCACCATTAAATATAATTTTAGG - Intergenic
995230996 5:109763252-109763274 TCTATGTTAAATAAAATTTATGG - Intronic
995438825 5:112167194-112167216 TCTACACTGTATAAAAATTGAGG + Intronic
995536317 5:113140069-113140091 TTTACATTTAATAAAACTCGGGG - Intronic
996339433 5:122419652-122419674 TCTAAAATAGATAAAATTTGGGG + Intronic
996478079 5:123943512-123943534 TAGTCATTAAATAAAATATGAGG + Intergenic
996651309 5:125880109-125880131 TCTACATAACATAAAACTTATGG + Intergenic
997203203 5:132025329-132025351 TCTAAATTAAACAAAAGTTCAGG + Intergenic
997937168 5:138122980-138123002 TATAAGTTAAAAAAAATTTGGGG - Intronic
998838431 5:146227256-146227278 TCTTCACAAAATAAAATTTAAGG - Intronic
999563907 5:152836424-152836446 TTTCAATAAAATAAAATTTGAGG + Intergenic
999898238 5:156058393-156058415 TGCACATTAAATAAAGTTTAAGG - Intronic
1000302482 5:159968742-159968764 TCTACAAAAAAGAAAATTTGGGG - Intronic
1000480459 5:161767499-161767521 TCTACATAAAATTAAATTTAAGG + Intergenic
1000619907 5:163471812-163471834 TATACATATAATAAAATGTGTGG + Intronic
1001385736 5:171337031-171337053 CCTCCATTAAAAAGAATTTGAGG + Intergenic
1002351031 5:178583863-178583885 TCAACAACAAATAAAAATTGGGG - Intronic
1003609517 6:7597271-7597293 CCTACATTTAGTAAAATTTGTGG + Intronic
1003919920 6:10823504-10823526 TCTACATTGAATACATTTTGTGG - Intronic
1004048845 6:12053466-12053488 TATAAATTAACTAAAATTTTAGG + Intronic
1004051612 6:12086249-12086271 TTTACATTAAATACACTTGGAGG - Intronic
1004777353 6:18862709-18862731 TCTACATTATTGAAAATGTGAGG - Intergenic
1005233802 6:23736370-23736392 TCTTCATTAAAAAAAAATTGTGG + Intergenic
1006343704 6:33462691-33462713 TCTATCTAAAATAAAAGTTGAGG + Intergenic
1006966623 6:37992709-37992731 ACTACAATAAAAAACATTTGAGG - Intronic
1007466331 6:42054060-42054082 TGTACATTTGATAAAATCTGTGG + Intronic
1007679599 6:43625170-43625192 ACTAAATTAAATAAAAAATGGGG - Intronic
1008150556 6:47945862-47945884 TTTACATTAACTAAAATATAAGG - Intronic
1008189269 6:48434377-48434399 CCTACAATAAATCAAATTGGTGG - Intergenic
1008324247 6:50158326-50158348 TCTATATTAAAAAATATTTGTGG - Intergenic
1008632696 6:53378899-53378921 GCTACATTAAATACTATTAGAGG + Intergenic
1009034933 6:58105674-58105696 TCTTCCTTTAATAAAGTTTGTGG - Intergenic
1009210449 6:60856391-60856413 TCTTCCTTTAATAAAGTTTGTGG - Intergenic
1009425820 6:63512498-63512520 TCCCCATTAAATAAAAAGTGGGG - Intergenic
1009894252 6:69727474-69727496 TATACATTTGATAAAAATTGAGG - Intronic
1010039428 6:71363643-71363665 TACACATTTAATAAAATTTCAGG + Intergenic
1010109132 6:72203714-72203736 TACACATTAAAATAAATTTGGGG - Intronic
1010172382 6:72988609-72988631 TCTATCTAAAATAAAACTTGGGG + Intronic
1010402194 6:75458686-75458708 TTTCCTATAAATAAAATTTGGGG - Intronic
1010619164 6:78053249-78053271 TCTACATAAAATAAAATAATTGG - Intergenic
1010769452 6:79811920-79811942 TCTACATATATTAATATTTGTGG - Intergenic
1011050474 6:83142528-83142550 TAAAAATAAAATAAAATTTGAGG + Intronic
1011301816 6:85883222-85883244 GCTGTATGAAATAAAATTTGGGG + Intergenic
1012788786 6:103665313-103665335 TCTAGATTAACAAAAATTGGAGG + Intergenic
1012866082 6:104619488-104619510 TCTAATGTACATAAAATTTGAGG - Intergenic
1013220362 6:108072691-108072713 TTTGCATTAAATAAATTCTGTGG - Intronic
1013604795 6:111737887-111737909 TCAAAATTAAGGAAAATTTGAGG - Intronic
1014857949 6:126425914-126425936 TTTACAGTAAATGAAATTTTGGG - Intergenic
1015150070 6:130027318-130027340 TTTATATTACATAAATTTTGTGG + Intronic
1015274113 6:131366939-131366961 TCTACCTTAAAAAAAAGTTGAGG + Intergenic
1015469267 6:133585358-133585380 TCTTCAACATATAAAATTTGGGG - Intergenic
1015508470 6:134013611-134013633 TCAAGATTAATTAAAATATGGGG + Intronic
1015678391 6:135777008-135777030 TCTACATTAAAAAGAAGTAGTGG - Intergenic
1016180295 6:141137956-141137978 TAAACATTAATTAAAATTTGGGG + Intergenic
1016542383 6:145180023-145180045 ACTGCATTAAATAAAATTTCAGG + Intergenic
1016586928 6:145698717-145698739 GCTTCATTATATAAATTTTGGGG - Intronic
1016845915 6:148568279-148568301 TATATATAATATAAAATTTGTGG - Intergenic
1017206558 6:151808839-151808861 TCTAGATGAAAGGAAATTTGGGG - Intronic
1017408362 6:154143403-154143425 TCTACATTTATTAAAATTATTGG + Intronic
1018302756 6:162420668-162420690 ACTACATTAAATTAAAATTCAGG + Intronic
1018326912 6:162680119-162680141 TCTATACTTAATAATATTTGAGG - Intronic
1018326913 6:162680177-162680199 TATATACTAAATAATATTTGAGG + Intronic
1019671331 7:2281257-2281279 TCTACAAAAAATAAAATTACGGG + Intronic
1020222124 7:6247369-6247391 TCTGCCTTAGATAAAATTAGTGG - Intronic
1020439336 7:8200981-8201003 ACTAAAGTAAATGAAATTTGTGG - Intronic
1020459178 7:8408686-8408708 TCAACATTAGGTAAAAATTGAGG - Intergenic
1020626838 7:10591506-10591528 TGCACATTAAAAAAAATTGGAGG + Intergenic
1020940782 7:14534097-14534119 TATTTATTAAACAAAATTTGTGG - Intronic
1021420200 7:20438380-20438402 TCTACATTGAATACCATATGAGG + Intergenic
1021576142 7:22107952-22107974 TCTACATGAAATAAACTGAGGGG + Intergenic
1022193991 7:28045737-28045759 TCTACAAAAAGTAAAATTAGCGG - Intronic
1022762880 7:33376026-33376048 TTTACATTAAAAAAACTTTTAGG + Intronic
1023061450 7:36331224-36331246 TCTTCATTACATAAAATGTCAGG + Intronic
1023597701 7:41849539-41849561 TCTACCATAAATAAAATCTAGGG - Intergenic
1024216431 7:47253107-47253129 TATAAATAAAATAAAAATTGAGG + Intergenic
1024569827 7:50714361-50714383 TATACTTTAAATATAACTTGAGG + Intronic
1024663493 7:51521843-51521865 TCTGCATTCAATCACATTTGAGG + Intergenic
1026767416 7:73169162-73169184 ACCACAATTAATAAAATTTGAGG + Intergenic
1026808753 7:73444653-73444675 TCCTCATTAAATACAATTTAGGG + Intronic
1026852582 7:73734482-73734504 TATATATAAAATAAAATGTGAGG + Intergenic
1027043883 7:74978864-74978886 ACCACAATTAATAAAATTTGAGG + Intronic
1027079762 7:75223488-75223510 ACCACAATTAATAAAATTTGAGG - Intergenic
1027412812 7:77939961-77939983 TCTACTGTAGATAAAATTTATGG + Intronic
1027497440 7:78905721-78905743 TGTACCTTAAATTAAATTAGAGG - Intronic
1028024120 7:85815277-85815299 TTTATATTTAATAAAATTTTAGG - Intergenic
1028351039 7:89848535-89848557 TCTAAATTAAATTTATTTTGAGG - Intergenic
1028546095 7:92003023-92003045 TCTAAAGTAAATAAAAGTTTTGG + Exonic
1028579393 7:92390186-92390208 TCCACATTAAATAAAACAAGTGG - Intronic
1028674672 7:93444930-93444952 TATGCATTAAATAAAATATATGG - Intronic
1028789227 7:94834609-94834631 TTTACATTAAATAAAAAGTCTGG - Intergenic
1028939649 7:96507050-96507072 TCTTTATTAAAAAAAATTAGAGG + Intronic
1029388976 7:100262077-100262099 ACAACAATTAATAAAATTTGAGG - Intronic
1029897713 7:104003042-104003064 TATAAATGGAATAAAATTTGTGG + Intergenic
1029922822 7:104283767-104283789 GCTACATATAATAAAATTTGGGG - Intergenic
1030456747 7:109784108-109784130 TCTGTATTAAATAAAATTTCTGG - Intergenic
1030947887 7:115749119-115749141 TCTAACATAAATAAAGTTTGGGG - Intergenic
1031227760 7:119062586-119062608 GTTATATTAAATAATATTTGGGG - Intergenic
1031538037 7:122959342-122959364 TCTAAATTAAATCTAATTTGGGG - Intergenic
1031658590 7:124391720-124391742 TTTTAAGTAAATAAAATTTGTGG - Intergenic
1032936478 7:136738554-136738576 TGTACATTCAATAAATTCTGGGG - Intergenic
1033610964 7:142962564-142962586 TCTGTATTAAAAAAAATATGAGG + Exonic
1033771867 7:144561226-144561248 TCTTCATTAAATAACTGTTGAGG - Intronic
1033774094 7:144587645-144587667 TCTACATTGCATTATATTTGGGG + Intronic
1034065462 7:148132466-148132488 TCTACATTAAAATACATTTCAGG - Intronic
1034249802 7:149679806-149679828 TCTACAATAATCAAAAATTGTGG - Intergenic
1034822025 7:154224589-154224611 TGTACATTAAATACCATATGTGG + Intronic
1035163837 7:156971635-156971657 TCGAGCTAAAATAAAATTTGAGG - Exonic
1035189722 7:157155644-157155666 TCTTCACTAAATAAATTTAGTGG - Intronic
1035747201 8:1970752-1970774 TCTCAAAAAAATAAAATTTGGGG + Intergenic
1036980988 8:13469995-13470017 TATAAATGAAATAAAAATTGAGG - Intronic
1037227684 8:16613160-16613182 TCAACATTAATTAATATTTGAGG - Intergenic
1037230988 8:16658397-16658419 TCTTCAGACAATAAAATTTGAGG + Intergenic
1038141828 8:24853614-24853636 TATAAAATAAATAAAATTTTTGG + Intergenic
1038191723 8:25327714-25327736 TTTAAATTAATTAAAATTGGAGG + Intronic
1038671154 8:29584301-29584323 TCTTCATTAAGTCAAAGTTGTGG - Intergenic
1038868355 8:31464606-31464628 TTCACGTTAAATAAAATTTAAGG + Intergenic
1038908529 8:31935421-31935443 TCTACAAAAAATAAAATATTAGG - Intronic
1039127984 8:34225780-34225802 TCTACATAGAATAAAATATAAGG + Intergenic
1039365577 8:36924901-36924923 TCAACTCTAAATAAAATCTGTGG - Intronic
1039898102 8:41730555-41730577 TCTTCATCAAATAGAACTTGAGG - Intronic
1041036602 8:53797697-53797719 TCCACTTTAAACAAAATTAGTGG + Intronic
1041144335 8:54857424-54857446 TTTACATTAAATATAATGTAAGG + Intergenic
1041282766 8:56228265-56228287 TTTAGATTAAATAAAAGTTCTGG + Intergenic
1041695537 8:60732248-60732270 TCTACATTTTAAAAAATTTCTGG - Intronic
1041790522 8:61691689-61691711 TCTCCATTAAATTTGATTTGGGG + Intronic
1041862223 8:62527366-62527388 TTAACATTAAATGGAATTTGAGG + Intronic
1042013249 8:64274653-64274675 CTTACATTGAATAAAATATGTGG + Intergenic
1042044413 8:64632540-64632562 TCTACTCTTAATAAATTTTGAGG - Intronic
1042084277 8:65090138-65090160 TATACAGTAAATAAAATATTGGG + Intergenic
1042737132 8:72002010-72002032 ATTTCATTAAATAATATTTGGGG + Intronic
1042884715 8:73535769-73535791 TCAACATTAAAGGAAAATTGTGG + Intronic
1042905419 8:73767169-73767191 TCTTAATTAAAAAATATTTGAGG - Intronic
1042993788 8:74670310-74670332 TCTAACTTAAATAATTTTTGAGG - Intronic
1043018963 8:74976659-74976681 AATACATTAAAAAAAACTTGGGG + Intergenic
1043057963 8:75464117-75464139 TCAGCATCAAATAATATTTGTGG - Intronic
1043358526 8:79441784-79441806 TTTATATAAGATAAAATTTGTGG - Intergenic
1043603006 8:81963373-81963395 TCTAATTTAAATAAAAATTGAGG - Intergenic
1043863014 8:85343249-85343271 TTTACATTAAAAAAATATTGAGG + Intronic
1044981276 8:97718984-97719006 TCTTCATTAATTAAAATCTATGG - Intronic
1045153397 8:99436224-99436246 GATACATTAAATAATATTTAAGG + Intronic
1046017641 8:108624486-108624508 TCTTCCTTAAAGAAAATTTGTGG + Intronic
1046078619 8:109342668-109342690 TCTACAAAAAATAAAATTAGTGG - Intronic
1046301929 8:112305931-112305953 TCTAAAATACATAAAATTTCAGG + Intronic
1046312185 8:112451836-112451858 TCTACATTTAAAAATCTTTGGGG - Intronic
1046839290 8:118839576-118839598 TCAACATTAAATTTAATATGAGG + Intergenic
1047031361 8:120885152-120885174 TCTACATTAAAAAAAAACTTAGG + Intergenic
1047279873 8:123435863-123435885 TCTCAATTAAAAAAAATATGTGG + Intronic
1047381189 8:124365336-124365358 TCTCTATTAAATAAACTTTTGGG - Intronic
1048724866 8:137372137-137372159 TCTCCATTAAATAAACTTTGGGG + Intergenic
1049131785 8:140851548-140851570 TTTACTTTTAATAAAATTTGGGG - Intronic
1049491550 8:142906096-142906118 ATTAAATTAAATTAAATTTGGGG - Intronic
1050185435 9:2967948-2967970 TCTACAATGAAAAAAATCTGGGG - Intergenic
1050200244 9:3137740-3137762 TCAAAATTAAAAAAAAATTGTGG + Intergenic
1051076290 9:13241169-13241191 CCTACAGTAAATAAACTTTACGG + Intronic
1051076806 9:13248570-13248592 TCTTCATTAAAAAAAAATTTTGG - Intronic
1052077023 9:24155691-24155713 TCTACATGAAATTAATTTTATGG + Intergenic
1052122412 9:24734213-24734235 TCAACATTAAATAAACTTTTGGG + Intergenic
1052146807 9:25060588-25060610 TCTAGAGTAAAGAAAATTTCAGG - Intergenic
1052148743 9:25085090-25085112 TATACAATAAATAAAATTTTAGG + Intergenic
1052418371 9:28207438-28207460 TTAAAAATAAATAAAATTTGAGG - Intronic
1052561852 9:30093866-30093888 TTTACATTATCTAATATTTGAGG + Intergenic
1053394218 9:37758084-37758106 TCTACAGTGAATAATATTTATGG + Intronic
1053469438 9:38335696-38335718 TCTACAGTAAAATAAAGTTGGGG - Intergenic
1053538309 9:38947773-38947795 AAAACATTAAATAAAATATGTGG - Intergenic
1053611695 9:39720264-39720286 TCACCATTAAAAAAAATTTCTGG - Intergenic
1053869727 9:42478263-42478285 TCACCATTAAAAAAAATTTCTGG - Intergenic
1054086560 9:60750891-60750913 TCACCATTAAAAAAAATTTCTGG + Intergenic
1054241826 9:62622130-62622152 TCACCATTAAAAAAAATTTCTGG + Intergenic
1054555950 9:66656652-66656674 TCACCATTAAAAAAAATTTCTGG + Intergenic
1054627826 9:67416146-67416168 AAAACATTAAATAAAATATGTGG + Intergenic
1054742704 9:68824519-68824541 TGTTCATTAAAAAAAATTTCTGG - Intronic
1054781742 9:69172477-69172499 TGTAAATTAACTAAAATTAGAGG - Intronic
1055702434 9:78960314-78960336 GCTTCAATATATAAAATTTGGGG - Intergenic
1055734996 9:79317656-79317678 TGTGCATTAAATCAAGTTTGGGG - Intergenic
1056985840 9:91363053-91363075 TCTACATTGGATAAAAGTTGAGG - Intergenic
1057108184 9:92441396-92441418 TCTCCATCAAATAAAATGTAAGG + Intronic
1057434537 9:95027453-95027475 TCTAAATTAAATTTACTTTGAGG + Intronic
1057957546 9:99423757-99423779 TCTATTTTATATAAAATTGGGGG - Intergenic
1058090907 9:100804372-100804394 GGTACTTTAAAAAAAATTTGTGG + Intergenic
1058324887 9:103682890-103682912 TTTAAAATAAATAAAAATTGAGG + Intergenic
1059015169 9:110507470-110507492 TGTGCATTAAATAAAAGTTTAGG + Intronic
1059486497 9:114631146-114631168 TCTACAAAAAATAAAATCAGCGG + Intronic
1060578338 9:124719502-124719524 CCTACATTAAATAATTTTTAGGG - Intronic
1061963631 9:134000905-134000927 TTTAAATTAATTAAAATTAGAGG + Intergenic
1203754487 Un_GL000218v1:112291-112313 TAAAGATTATATAAAATTTGTGG - Intergenic
1203713867 Un_KI270742v1:124793-124815 TAAAGATTATATAAAATTTGTGG - Intergenic
1203537328 Un_KI270743v1:53232-53254 TAAAGATTATATAAAATTTGTGG + Intergenic
1203583209 Un_KI270746v1:34136-34158 TTAAGATGAAATAAAATTTGGGG - Intergenic
1185706617 X:2272246-2272268 TTCACATCAAATAAAATATGAGG - Intronic
1185867729 X:3638375-3638397 CCTAGAATCAATAAAATTTGGGG + Intronic
1186359852 X:8829446-8829468 TCTACATTAAATGAAATGAAAGG - Intergenic
1186556758 X:10568130-10568152 TGTACATGAAATCAAATGTGGGG + Intronic
1187179499 X:16930221-16930243 TAAAAATTGAATAAAATTTGTGG + Intergenic
1187196392 X:17088954-17088976 TCTACATTAAATTAATTTGGAGG + Intronic
1187614718 X:20980694-20980716 TTAACATCAAATAAAATTTGTGG + Intergenic
1188151148 X:26677393-26677415 TTTCCATTAAATAAGATATGTGG + Intergenic
1188197691 X:27258474-27258496 TCTACATTAAAGAATAGTTGTGG - Intergenic
1188891255 X:35612691-35612713 TCCTTATTAAATAAAACTTGAGG - Intergenic
1188930198 X:36099709-36099731 ACAACATTAATTAAAATTTAAGG - Intronic
1189462978 X:41257344-41257366 TCTGAATTATATGAAATTTGAGG + Intergenic
1189507705 X:41628629-41628651 TCTACAGTAAGTAAACTTTGTGG - Intronic
1189839226 X:45054786-45054808 AATACGTTAAACAAAATTTGAGG - Intronic
1190684425 X:52858414-52858436 TCTACATAAAATAAAAATATAGG + Intergenic
1190798628 X:53768666-53768688 TCAAAATTACATAAAATTAGAGG - Intergenic
1191588363 X:62853369-62853391 TGTACATTAAATATAGTTTAAGG + Intergenic
1193151002 X:78124655-78124677 TCTTTATTAAATAACTTTTGAGG + Intronic
1193531056 X:82655174-82655196 TTTAAATTAAAGAAAATGTGAGG + Intergenic
1194162342 X:90469177-90469199 TCTAAATAAAATAAAATTTTTGG - Intergenic
1195263189 X:103154001-103154023 TTTCCATTAAATAAAATTCCAGG - Intergenic
1195537490 X:106025156-106025178 TCTACATTAAAAATTATATGGGG - Intergenic
1195643641 X:107205434-107205456 TCTACAGTAAACAAAAAATGGGG - Intronic
1196059968 X:111397607-111397629 AAGACATTAAATAAAATTTGGGG - Intronic
1196197440 X:112850963-112850985 TTAAAATTAAAAAAAATTTGAGG - Intergenic
1197161731 X:123331173-123331195 TATACATTATATAATATTTTAGG - Intronic
1197187084 X:123599412-123599434 TATTCATTAAAAAATATTTGAGG - Intergenic
1197330110 X:125143296-125143318 TTTCCTTTAAATAAAATTAGAGG - Intergenic
1197951567 X:131903191-131903213 TGAAGATTATATAAAATTTGTGG - Intergenic
1198027917 X:132726885-132726907 TTTACTTTAAAAAAAAATTGTGG - Intronic
1198462062 X:136873121-136873143 TCTAGATTAAAAAAAACTTTTGG - Intronic
1199005011 X:142685601-142685623 TTTAAATTAAATAAAGGTTGAGG - Intergenic
1199478167 X:148269140-148269162 TCTAAATTAAATCCAATTAGAGG - Intergenic
1200372834 X:155745176-155745198 TTTAATTTAAACAAAATTTGGGG - Intergenic
1200508622 Y:4046914-4046936 TCTAAATAAAATAAAATTTTTGG - Intergenic
1201168118 Y:11229936-11229958 TAAAGATTATATAAAATTTGTGG - Intergenic
1201225274 Y:11812649-11812671 TCTACTATAAAGAGAATTTGGGG + Intergenic
1201339148 Y:12913490-12913512 TCTACATTGAAAAAAGTTTTTGG - Intronic
1201594730 Y:15655324-15655346 ACTACCTTAGTTAAAATTTGTGG - Intergenic