ID: 945636326

View in Genome Browser
Species Human (GRCh38)
Location 2:212356330-212356352
Sequence TCAGCCACAGGCAGAGCCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 364
Summary {0: 1, 1: 0, 2: 4, 3: 32, 4: 327}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945636323_945636326 6 Left 945636323 2:212356301-212356323 CCTCATTAATCAAGTTGTACACA 0: 1
1: 1
2: 4
3: 32
4: 234
Right 945636326 2:212356330-212356352 TCAGCCACAGGCAGAGCCAATGG 0: 1
1: 0
2: 4
3: 32
4: 327

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945636326 Original CRISPR TCAGCCACAGGCAGAGCCAA TGG Intronic
900166937 1:1247613-1247635 ACATCCACAGGCAGAGCCACGGG + Intergenic
900185427 1:1331062-1331084 TCAGCCACAGGCAGGGAACAAGG + Intergenic
900640751 1:3687106-3687128 TCAGGGACAGCCAGAGCCTAAGG - Intronic
901240818 1:7692149-7692171 TCAGTGACAGGGAGACCCAAAGG - Intronic
901446582 1:9311999-9312021 ACAGAGACAGGCAGGGCCAACGG - Intronic
901647542 1:10724723-10724745 CCAGCCAGAGGCAGGGGCAAGGG + Intronic
901923450 1:12551965-12551987 TCAGCCAAAGGCACAGCTCAGGG + Intergenic
902628111 1:17688584-17688606 TCAGCAGCTGGGAGAGCCAAAGG + Intronic
902797126 1:18807207-18807229 TCAGCCTGAGGCACAGCCAGGGG + Intergenic
902862585 1:19256948-19256970 TCAGGCCCAGGCTGAGCCAGTGG - Intronic
905359775 1:37411256-37411278 TCAGCCACAGGGAGGGGCACTGG + Intergenic
907248407 1:53122328-53122350 TCAGCCAAGGCCAGAGCCCAAGG - Intronic
907323189 1:53618573-53618595 ACAGCTACAGGCAGGGCCAGGGG - Intronic
908740045 1:67318076-67318098 TCAGCCACACGAAGACGCAAGGG + Intronic
910538656 1:88329539-88329561 AAAGCCTCAGGCAGAGCAAAGGG + Intergenic
911533258 1:99071126-99071148 CCAGTCACAGGCAGAGACATTGG - Intergenic
912473644 1:109922720-109922742 ACAGCCACAGCCACAGCCACAGG - Intronic
912987503 1:114449371-114449393 TCAGGCACATGTAGAGCCTATGG + Intronic
914376197 1:147076007-147076029 TCAGCCACCCGCAGATACAATGG + Intergenic
914944090 1:152048331-152048353 CCAGTCACAGGCACAGCCCAGGG - Intergenic
916418065 1:164611019-164611041 ACAGACACAGAAAGAGCCAAAGG - Intronic
916547669 1:165821677-165821699 TCAGCCACAGGAGGAGGGAAGGG + Intronic
918003885 1:180524024-180524046 TGAGCAACAGGCTGAGACAATGG - Intergenic
918142798 1:181732821-181732843 CCAGGCACAGGCAGAGCCAACGG + Exonic
920037860 1:203077166-203077188 CCAGCCAGAGGGAGAGCCAATGG + Exonic
921164175 1:212494255-212494277 TCAGACACAGGCAGAGCAGTGGG + Intergenic
921937540 1:220808697-220808719 TCACCCACAGGCAGAGCCCGCGG + Intronic
922346702 1:224702551-224702573 TCAGCCCCAGGCGCAGCCCAAGG + Intronic
923561868 1:235047712-235047734 TCAACCACAGCCAGACCCAAAGG + Intergenic
1063087490 10:2832801-2832823 CCAGCCACAGGGAGAGCCCTCGG + Intergenic
1063271521 10:4514767-4514789 TCTTCCAAAGGCAGAGACAACGG - Intergenic
1064224128 10:13467617-13467639 GCAGCCACAGACAGATCAAATGG - Intronic
1066065088 10:31756123-31756145 TCAGGCACAGGCTGGGCCCATGG - Intergenic
1066314351 10:34229108-34229130 ACAGCCACACGCCTAGCCAATGG + Intronic
1067805014 10:49386331-49386353 TCAGTCACAGCCAGGGCCACTGG - Intronic
1069555893 10:69398473-69398495 TCATCCACAGACAGAGTCAAGGG - Intronic
1069686140 10:70320037-70320059 TTGGCCACAGGCAGAGAAAATGG + Intronic
1070306845 10:75244867-75244889 TCACCCACAGGGAGATCCAGAGG - Intergenic
1070771483 10:79085010-79085032 GCAGCGTCCGGCAGAGCCAAGGG - Intronic
1072763860 10:98080548-98080570 TCAGCCCTAGGGAGAGGCAAGGG + Intergenic
1073094521 10:100971593-100971615 CCACCCACAGGCAGGGCCAGAGG - Intronic
1074329301 10:112488491-112488513 TCAGCCAGAACCAGACCCAAAGG + Intronic
1074438466 10:113454530-113454552 TCAGCCAGAGACAGAGAGAAGGG - Intergenic
1075002566 10:118809209-118809231 ACAGCTGCAGGCAGAGCCATGGG + Intergenic
1075021427 10:118955543-118955565 CAAGCCACAGGCAGAGGGAAGGG - Intergenic
1075954329 10:126508972-126508994 GAAGCCACAGCCAGAGCCCAGGG + Intronic
1076214062 10:128678803-128678825 CCAGCAAAAGCCAGAGCCAATGG - Intergenic
1078461829 11:11520408-11520430 TCAGCCACAGACACAGCCCCTGG + Intronic
1079744896 11:24113304-24113326 TCAGCCACAAGTAAACCCAAAGG - Intergenic
1080327690 11:31096559-31096581 CCAGCCCAAGGCAGAGACAAAGG - Intronic
1080774517 11:35373186-35373208 CCAGTCACAGGAAGAGGCAAGGG + Intronic
1080813152 11:35726148-35726170 TGAGCCAAAGGCAGAGGTAAAGG + Exonic
1082940767 11:58703238-58703260 TCAGACACAGGCTGAGACAGTGG + Intronic
1083405814 11:62456303-62456325 TCAGCCACAGAAAGTGGCAAAGG - Intronic
1083806498 11:65077411-65077433 TGAGTCAAAGGCAGAGCCGAAGG - Intronic
1084632748 11:70365277-70365299 TAAGCCACAGGCACAGAGAAGGG - Intronic
1084883051 11:72185773-72185795 TCAGCCACAGGCAGCATCAATGG - Intergenic
1087212043 11:95454406-95454428 TCAGGCACAGGCAGGACAAAAGG + Intergenic
1088524559 11:110738710-110738732 TCAGCTACTGCCACAGCCAAAGG - Intergenic
1088530335 11:110801292-110801314 TCAGCCACAGGCACAGTGCATGG - Intergenic
1089178955 11:116567737-116567759 GCAGCCCCAGGCTGAGCCAGAGG + Intergenic
1089847377 11:121469007-121469029 TCAGCCACACGCTGAGCCTTTGG - Intronic
1090252201 11:125259613-125259635 TCAGCCAGAGGCAAAGGTAAAGG - Intronic
1090662789 11:128893674-128893696 TCAGCTAAAGGAGGAGCCAAGGG + Intronic
1090853692 11:130593319-130593341 TCATCCACTGCCAGAGACAAGGG + Intergenic
1091046921 11:132333259-132333281 TCAGCCTCGGGCACAGACAAGGG + Intronic
1091702674 12:2674274-2674296 TGAGCCACAGGCAGGGGGAAGGG + Intronic
1092578951 12:9819181-9819203 TCAGGCACACGCAGAGCCCTGGG + Intergenic
1092988115 12:13866470-13866492 GCAGCTACAGGCAGAGACAAAGG + Intronic
1093133340 12:15418722-15418744 TCAGCCAAAGGCTGAGGCAATGG + Intronic
1094080189 12:26526335-26526357 TCAGGCACATGAATAGCCAAGGG + Intronic
1096618727 12:52849131-52849153 TCCGGCACGTGCAGAGCCAAGGG + Intergenic
1097185325 12:57193517-57193539 TCAGCCACAGGCACAGGGAAAGG - Intronic
1097363504 12:58684877-58684899 GCAGAGACAGGCAGAGGCAAAGG - Intronic
1101750154 12:107576823-107576845 TGAGCCACAGGCATATCCAGAGG - Intronic
1102459525 12:113091757-113091779 ACAGGCACGGCCAGAGCCAAGGG + Intronic
1103991317 12:124801249-124801271 TAATCCACAGACAGAGCCAACGG + Intronic
1107315526 13:39127481-39127503 TCAGCCACAAGCAGAGGAACTGG + Intergenic
1107507727 13:41051378-41051400 ACAGCCACAGGCAAAGAGAATGG - Intronic
1107947875 13:45436163-45436185 TCAGCCACAGTCAACCCCAAGGG + Intergenic
1108004431 13:45933043-45933065 ACAGCCATAGGGAGAGCAAAGGG - Intergenic
1108587450 13:51882978-51883000 CCAGCCACAGGCTGAGCCTGGGG - Intergenic
1110804398 13:79737151-79737173 TAAGCCACATGCAGAGTCATGGG - Intergenic
1111814360 13:93132233-93132255 TCAGGCACATGCAGAGCCCAGGG - Intergenic
1113349037 13:109510078-109510100 TCAGCCACTTCCATAGCCAACGG - Intergenic
1113973652 13:114210574-114210596 GCAGCCAAAGGCTGAGCCACGGG - Intergenic
1114962116 14:27905446-27905468 TCAGCCTCAGGTTTAGCCAAAGG - Intergenic
1116214264 14:41990843-41990865 TCTACCCCAGGGAGAGCCAAAGG - Intergenic
1117080815 14:52150475-52150497 TCAGACAGAAGCAGAGCCACTGG + Intergenic
1117145131 14:52829854-52829876 TAAGAGACATGCAGAGCCAAGGG + Intergenic
1117995885 14:61478008-61478030 TGTGCCACAGCCACAGCCAAGGG + Intronic
1118713024 14:68538236-68538258 TAAGCCAGAGGGACAGCCAAGGG + Intronic
1118769328 14:68931323-68931345 GCAGACAGAGGCAGAGCCCAGGG + Intronic
1119807127 14:77489480-77489502 TTAGCCACAGGCAGAGGAATAGG + Intronic
1122028705 14:98896722-98896744 TCAACCCCAGCCAGAGACAATGG + Intergenic
1122174764 14:99908760-99908782 TGAGCCACAGGCAGAGTCCCAGG + Intronic
1123946518 15:25241396-25241418 TCAGTGGCAGGGAGAGCCAAGGG + Intergenic
1124833139 15:33168877-33168899 GCAGCCACAGTCTGACCCAAAGG + Intronic
1125205929 15:37153575-37153597 TTAGGAACTGGCAGAGCCAAAGG + Intergenic
1126102997 15:45130572-45130594 GAAGCCCCAGGCAGAGCCAGCGG - Intronic
1128386727 15:67154463-67154485 TCAGCTACAGGCAGAGCACATGG + Intronic
1129669939 15:77602006-77602028 GCAGCCAGAAGCTGAGCCAAGGG + Intergenic
1131816133 15:96223177-96223199 TCAGCCCCAGGCAGAAGAAATGG - Intergenic
1133209940 16:4257984-4258006 GCAGCCACAGGGAGAGACATGGG - Exonic
1134800668 16:17081630-17081652 CCAGCCACAGGAGGATCCAAAGG - Intergenic
1135824406 16:25713873-25713895 CAAGCAACAGGCAGGGCCAAGGG - Intronic
1136275201 16:29175672-29175694 TCAGCAGCAGGCAGTGGCAATGG + Intergenic
1136873453 16:33828643-33828665 CTAGGCACAGCCAGAGCCAATGG + Intergenic
1137507386 16:49065933-49065955 TCAGCTACTGGCAGAGAGAAAGG + Intergenic
1138187082 16:54985077-54985099 CCAGCCCCAGGCAGGGCCCAGGG - Intergenic
1140019172 16:71221050-71221072 GCAGCCACAAGCAGAGCTCAGGG - Intronic
1141910705 16:87056751-87056773 TCAGCCAGAGGCAGTGAGAAGGG + Intergenic
1142079561 16:88141740-88141762 TCAGCAGCAGGCAGTGGCAATGG + Intergenic
1142305128 16:89280450-89280472 TCAGCGACGGGCAGAGCGTACGG + Exonic
1203098722 16_KI270728v1_random:1287412-1287434 CTAGGCACAGCCAGAGCCAATGG - Intergenic
1143092641 17:4458019-4458041 GGAGGCACAGACAGAGCCAAGGG - Intronic
1143591779 17:7889371-7889393 CCTGCCACAGTCAGAGCCCATGG + Intronic
1143894136 17:10123533-10123555 TCAGACACAGGCAGGGCTAAGGG + Intronic
1145764882 17:27451700-27451722 GCTGCCACATGGAGAGCCAATGG - Intergenic
1146500505 17:33360486-33360508 TGGGCTACAGGCAGAGGCAAGGG - Intronic
1147781912 17:42949242-42949264 ACAGCCACAGCCACAGCCACAGG + Intergenic
1148001405 17:44389585-44389607 TGAGCAACGGGCAGAGCAAAGGG + Intergenic
1148189152 17:45666769-45666791 GCTGCCACAGGCAGAGCACATGG - Intergenic
1148771884 17:50072117-50072139 TAAACCAAAGGCAGAGCCACTGG - Exonic
1149110238 17:53019510-53019532 TCAGCCACAGGTAGAGCAGCTGG + Intergenic
1149317405 17:55451420-55451442 TCAGCCACAGGAAGAGCCATGGG - Intergenic
1149456893 17:56795211-56795233 TCACCCACAGTGACAGCCAAGGG + Intronic
1150101059 17:62424026-62424048 TCAGCGACAGGCCGGGCGAAGGG - Intronic
1152557724 17:81062760-81062782 TAAGCCACCAGCAGAGACAATGG - Intronic
1158073735 18:53504300-53504322 TCAGCCACAGGCAGAGGTCATGG + Intronic
1158866642 18:61644016-61644038 TCAGCCACAGGCGGACCTAGAGG - Intergenic
1160286619 18:77549122-77549144 TGAGACACAGGCAGAGACTAGGG - Intergenic
1160286637 18:77549224-77549246 TGAGACACAGGCAGAGACTAGGG - Intergenic
1160916106 19:1497431-1497453 GGAGCCACAGCCAGAGCCAGAGG - Exonic
1160969133 19:1759678-1759700 TCAGCCAGGGACAGAGCCCAGGG - Intronic
1160983370 19:1826827-1826849 TCGGGCAGAGGCAGAGCCGAGGG - Intronic
1161085778 19:2334238-2334260 ACAGCCACGGGCAGAGCCACGGG - Intronic
1162516793 19:11153112-11153134 TCAGCCAGAAGCAGATCAAATGG - Intronic
1162881970 19:13666516-13666538 TCAGCCACAGGGTGACCCCACGG + Intergenic
1162938405 19:13993639-13993661 CCAGCCCCAGGCACAGCCACCGG - Exonic
1164436871 19:28237885-28237907 CCAGCCTGAGGCAGAGCAAATGG + Intergenic
1164527846 19:29024916-29024938 TCAACCCCAGGCAGTGCTAAGGG + Intergenic
1164753622 19:30673617-30673639 TCAGCCACAGGAGGAGAAAAGGG - Intronic
1165164299 19:33840627-33840649 TGAGCCACAGGCACAGCCCCAGG + Intergenic
1166410015 19:42550474-42550496 TCAGCCACAGCTAGAGCAGATGG - Intronic
1168116569 19:54224244-54224266 ACAGCCACAGGCAGAGAAAGAGG + Intronic
925751107 2:7091069-7091091 TCATCCCCAGGCAGAGCTCAGGG - Intergenic
925929565 2:8696077-8696099 TCACCCACAGTCACAGCAAAGGG - Intergenic
926313939 2:11696018-11696040 TCAGCAACTGTCAGAGCCATAGG - Intronic
926677413 2:15637877-15637899 TCAGAGACAGGCAGAATCAAAGG - Intergenic
927351819 2:22125125-22125147 TCTGCCACAAGCACAGCCACTGG + Intergenic
927941093 2:27103233-27103255 ACAGCCACAGGAACAGCCACAGG - Intronic
928312565 2:30222874-30222896 TTGGCCTCAGGCAGAGCCAGTGG - Intergenic
928387531 2:30883196-30883218 TTAGCCACAGGCTGAGTCAAGGG - Intergenic
930312933 2:49764544-49764566 AGAGCAATAGGCAGAGCCAAAGG - Intergenic
930608446 2:53516184-53516206 TCATGCACAGGTAGAGCTAATGG + Intergenic
931093327 2:58911091-58911113 TCAATCACAGGCAGACACAAAGG - Intergenic
931146980 2:59529891-59529913 TCAGCCACAGCCAGGGTAAACGG + Intergenic
932285756 2:70530365-70530387 TCATTCACAGGCAGATCCCAGGG + Intronic
932363563 2:71130513-71130535 TCGCCCTCAGCCAGAGCCAATGG - Exonic
932411671 2:71551298-71551320 TCAGGCAGAGGCAGTGTCAAGGG - Intronic
935529749 2:104218002-104218024 CCAGCCACATCCATAGCCAAGGG + Intergenic
936125552 2:109786649-109786671 ACAGCCACTGGCAGTGCCAATGG + Intergenic
936219141 2:110584819-110584841 ACAGCCACTGGCAGTGCCAATGG - Intergenic
936404899 2:112194185-112194207 TAAGCCACATGGAGAGCCCAAGG - Intergenic
938229089 2:129642481-129642503 TTATACACAGCCAGAGCCAAAGG - Intergenic
940393228 2:153157304-153157326 TGAGCCACATGCAGAGACAGTGG - Intergenic
940707628 2:157125097-157125119 TCAGGCACATGCAGAGCCCCAGG + Intergenic
944441037 2:199743647-199743669 CCAGTCAGAGGCAGAGGCAAGGG - Intergenic
945236120 2:207633135-207633157 ACAGCCACTTGAAGAGCCAAGGG + Intergenic
945459833 2:210093096-210093118 CCTGCCATGGGCAGAGCCAAGGG + Intronic
945636326 2:212356330-212356352 TCAGCCACAGGCAGAGCCAATGG + Intronic
947535560 2:230938723-230938745 CCAGCCACTGGCAGAGGCACTGG + Intronic
947643673 2:231722201-231722223 TCAGCCACTGGAAGAGCTGAGGG + Intergenic
947810045 2:232998468-232998490 GCAGCCAGAGACAGAGCCAGAGG + Intronic
948634957 2:239329059-239329081 GGACCCACAGGCAGAGCCCAGGG + Intronic
1169061125 20:2660998-2661020 TCAGCCACAGGCCAAGCCCAAGG + Intronic
1169897791 20:10522823-10522845 TCAGCAACAGGCTGTGCCATGGG - Intronic
1170536823 20:17348941-17348963 TTAGCCAAGGGCAGAGCCACGGG - Intronic
1170732300 20:18985726-18985748 GTAGCCACATGCAGAGCCACGGG - Intergenic
1170937574 20:20823395-20823417 TGAGCCACTGCCACAGCCAAAGG - Intergenic
1171139583 20:22729356-22729378 TTAGTCACAGGAAGAGTCAAAGG + Intergenic
1171748977 20:29028950-29028972 TAAGCCAGAGGCAGTGCAAATGG + Intergenic
1172309929 20:33909862-33909884 TGAACCACAGGCATATCCAAAGG - Intergenic
1173161295 20:40654330-40654352 ACAACCGCAGGCAGAGCCAGAGG + Intergenic
1173953192 20:47009263-47009285 TCAGGCACAGGCAGATGTAAAGG - Intronic
1174091978 20:48056501-48056523 TCAGGCACAGCCAGATCCAGAGG - Intergenic
1174295086 20:49540093-49540115 TCAGCCATGGGCAGAGCAGAGGG + Intronic
1174547281 20:51334836-51334858 TCTACCAGAGGCAGAGCCACAGG + Intergenic
1175635658 20:60580533-60580555 TGAGCCCCAGCCAGACCCAAAGG - Intergenic
1175646121 20:60673302-60673324 TCACTCACTGGCAGAGTCAACGG - Intergenic
1176085858 20:63295137-63295159 CCAGCCACAGCCAGAGGCAGAGG - Exonic
1176147293 20:63571229-63571251 CCCACCACAGGCAGAGCCAGAGG - Intronic
1176147307 20:63571280-63571302 CCCACCACAGGCAGAGCCAGAGG - Intronic
1176147321 20:63571331-63571353 CCCACCACAGGCAGAGCCAGAGG - Intronic
1176147362 20:63571484-63571506 CCCACCACAGGCAGAGCCAGAGG - Intronic
1176147388 20:63571586-63571608 CCCACCACAGGCAGAGCCAGAGG - Intronic
1176147428 20:63571739-63571761 CCCACCACAGGCAGAGCCAGAGG - Intronic
1176147469 20:63571892-63571914 CCCACCACAGGCAGAGCCAGAGG - Intronic
1176147493 20:63571994-63572016 CCCACCACAGGCAGAGCCAGAGG - Intronic
1176316203 21:5246777-5246799 TAAGCCAGAGGCAGTGCAAATGG - Intergenic
1176386810 21:6142096-6142118 TGAGCCTCAGGGAGAGGCAAGGG - Intergenic
1178218386 21:30626556-30626578 GCAGCCACAGCCATAGCCCAGGG - Intergenic
1178674004 21:34615260-34615282 CCGGCCACCGGCAGATCCAACGG + Intergenic
1179405189 21:41120093-41120115 TTAGCCACAGGCAGATGGAATGG - Intergenic
1179541890 21:42088393-42088415 TCAGCCACAGGCAGTGGCCGTGG - Exonic
1179569345 21:42268941-42268963 TCAGCCCCAGGCACTGTCAAAGG + Intronic
1179736663 21:43396156-43396178 TGAGCCTCAGGGAGAGGCAAGGG + Intergenic
1180394007 22:12312699-12312721 TAAGCCAGAGGCAGTGCAAATGG - Intergenic
1180405740 22:12552051-12552073 TAAGCCAGAGGCAGTGCAAATGG + Intergenic
1181025377 22:20124589-20124611 CCAGGCACAGGCAGCCCCAAGGG - Intronic
1181308767 22:21932321-21932343 TCAGCCCCAGGAAGTGACAAAGG - Intronic
1181630021 22:24145973-24145995 ACAGCCAAGGGCAGAGCCAGAGG - Intronic
1181637429 22:24180954-24180976 TCAGACACAGGCTGAGCCCTGGG - Intergenic
1181966188 22:26658043-26658065 CAAGCCACGGGCAGAGCCAGAGG + Intergenic
1182002851 22:26935350-26935372 TCAGAGAGAAGCAGAGCCAAAGG - Intergenic
1182072936 22:27476167-27476189 TCAGCCCATGGCAGAGCCTACGG - Intergenic
1182154245 22:28054312-28054334 TCAGGCCGAGGCAGTGCCAATGG + Intronic
1182476903 22:30581378-30581400 TCAGGCCCAAGCAGAGGCAAAGG - Exonic
1182574574 22:31264291-31264313 TCAGCAGGAGGCAGAGCAAAAGG + Intronic
1182703862 22:32262348-32262370 ACAGCCACAGCCACAGCCACAGG + Intergenic
1185021619 22:48379944-48379966 TCAGGCAGTGGCAGAGCCAAGGG + Intergenic
1185045592 22:48527210-48527232 CCAGCCACAGGGAGTGCCACGGG - Intronic
1185061205 22:48607759-48607781 TCTGCAGCAGGCAGACCCAAAGG + Intronic
950024555 3:9811160-9811182 TCAGCCAAGGACACAGCCAAAGG - Intronic
950934934 3:16829223-16829245 TCAACTCCAGGCAGAGCCGAGGG + Intronic
953799752 3:46013442-46013464 TCAGCCACAGGATCAGCTAATGG - Intergenic
954063480 3:48088458-48088480 TCAGCCCCATCCAGAGCCCAAGG + Intronic
954131723 3:48564478-48564500 TCAGGCAGAGGCACCGCCAAGGG + Intronic
954135322 3:48579656-48579678 TCTGCCACAGGGAGAGCCTGGGG - Exonic
954937611 3:54341279-54341301 TCAGCCACTGGTAGAGTCTAAGG - Intronic
954974443 3:54679638-54679660 TCAGCAACTGCCAGAGACAAAGG - Intronic
955042716 3:55332959-55332981 CCACCCACAGGCAAAGCCACAGG + Intergenic
955195948 3:56804865-56804887 GCAGCCAAAGGCAGGGCCAGAGG + Intronic
956178410 3:66495918-66495940 TCAGCCAGAGGCCGTCCCAATGG + Intronic
959594479 3:108114389-108114411 TCAGCCCCAGGGACAGCAAAGGG - Intergenic
959692215 3:109209937-109209959 ACCGGCACAGGCAGAGCAAAAGG - Intergenic
960141875 3:114158993-114159015 TCAGGCTCAGGCAGAGGAAAGGG + Intronic
960672323 3:120165628-120165650 TCAGCCACCACCAGAGCCACAGG - Exonic
961721056 3:128896284-128896306 GCGGCCACAGGCAGAGCCCAGGG - Intronic
961793286 3:129391876-129391898 TCAGCTCCAGGGAGAACCAAAGG + Intergenic
961807289 3:129498494-129498516 TCAGCTCCAGGGAGAACCAAAGG + Intronic
962075640 3:132079263-132079285 TCAGACACTGGCCAAGCCAAGGG + Intronic
964041732 3:152269142-152269164 TCAGCCACGGGCAGACCCGCCGG - Intronic
964499277 3:157330778-157330800 CCAGCCACATCCAGAACCAAGGG + Intronic
965752080 3:171985741-171985763 TCAGTTACAGTCAAAGCCAAAGG + Intergenic
966361708 3:179137238-179137260 TCAGGCACATGCAGAGACCAAGG + Intergenic
966871599 3:184293454-184293476 TCAGCTACAAGCAGAGGCCAGGG - Intronic
967372215 3:188759587-188759609 TCAGTGACAGGCAGATCCCAAGG - Intronic
969155404 4:5205560-5205582 TCTGCCACAGCCAGAGCCTGGGG - Intronic
969289319 4:6228527-6228549 ACAGCCACAAGCATGGCCAATGG + Intergenic
969596674 4:8152965-8152987 CCAGGCAGAGGCACAGCCAAGGG + Intronic
971754384 4:30688688-30688710 CCAGCCACAGGCAGAGCTGCAGG - Intergenic
977667105 4:99654237-99654259 TCAGCGACAGGAAGAGACAATGG + Exonic
981093513 4:140756449-140756471 TCAGCGCCAGGCAGGGCTAAGGG + Intergenic
981514088 4:145588185-145588207 TCACCCACAGTCAGTGCAAATGG - Intergenic
982043758 4:151421105-151421127 TTAGCCAGAGGCAGAACAAAGGG - Intronic
982657788 4:158170904-158170926 TCAGCCGCAGGAAGCGGCAAGGG - Exonic
985249117 4:188005459-188005481 TCGGACACAGGCAGAGTGAAGGG - Intergenic
985692476 5:1321084-1321106 ACAGCCAAGGGGAGAGCCAAGGG + Intronic
985908718 5:2862895-2862917 CCAGCCACAGCCACAGCCACAGG + Intergenic
986091445 5:4512308-4512330 TCTGACACAGGCCGAGACAAGGG - Intergenic
986194311 5:5524123-5524145 TCAGCCACAGCCACAGCACAGGG - Intergenic
986310608 5:6548106-6548128 CCGCCCACAGGCAGAGCCTAGGG + Intergenic
986713334 5:10503497-10503519 TGAGCCAGAGGCAGAGCCAAAGG - Intergenic
989186885 5:38634569-38634591 CCAGCCAAGGGCTGAGCCAAAGG - Intergenic
993399552 5:87431837-87431859 TCTGCCACAGGGATGGCCAAGGG + Intergenic
993435875 5:87893584-87893606 TCTACCAGAAGCAGAGCCAATGG + Intergenic
993904919 5:93612130-93612152 CCAGCCACTGGCAGAGCCGTGGG + Intergenic
994184947 5:96807225-96807247 CCAGCCAGAGCCAGAGCGAAGGG + Intronic
998754192 5:145358200-145358222 TCAGGCAGAGGCAGAACCACTGG + Intergenic
999795073 5:154981618-154981640 TCAGGCAAAGGCAGTGCCATGGG + Intergenic
1002313622 5:178329511-178329533 TCAGCCAGAAGTAGGGCCAAGGG + Intronic
1002315724 5:178341817-178341839 CCAGAAACAGGAAGAGCCAAGGG - Intronic
1003247692 6:4398285-4398307 TCAGCCACTGGCAGAGGGAGAGG - Intergenic
1004288662 6:14346550-14346572 TCAGCCCCAGGCAGGGCACAGGG + Intergenic
1005023395 6:21439135-21439157 TCAACCACAGGAAGAGAAAAAGG - Intergenic
1006098667 6:31672043-31672065 TCAGACAGAGGCAGGGCCAGGGG - Exonic
1006829732 6:36961597-36961619 GAAGGCACAGGCAGAGCCAAGGG + Intronic
1008889354 6:56468549-56468571 TCAGCCTCAGGCAGTGACACAGG - Intronic
1008969092 6:57346137-57346159 TCAGGCACAGGATGAGACAAAGG - Intronic
1011032388 6:82937863-82937885 TCAGAGGCAGGAAGAGCCAAGGG + Intronic
1011811379 6:91135896-91135918 TCAGGAAAAGGCAGAGACAATGG + Intergenic
1012322036 6:97861689-97861711 GCAGCCAAAGTAAGAGCCAAGGG - Intergenic
1013165771 6:107590566-107590588 ACAGCCTCAGGAAAAGCCAAAGG - Intronic
1013308584 6:108872567-108872589 TCAGCCAGAGGAACAGCCAGTGG + Intronic
1013352480 6:109318021-109318043 TGAGACACAGGCAGGGCCACTGG + Intergenic
1013354802 6:109337252-109337274 TCAGCTCCAGGCACAGCCTAAGG + Intergenic
1014222791 6:118815282-118815304 TCAGCCACAGGGTGAGACAAAGG - Exonic
1014605562 6:123469732-123469754 TGAGCCAGAGCCAGAGCCAGAGG + Intronic
1018176787 6:161184281-161184303 TATGCTACAGGCAGAGCCAGTGG + Intronic
1018398842 6:163402380-163402402 TCAGGCCCAGGTAGAGCAAACGG + Intergenic
1018449965 6:163898595-163898617 ACGGACACAGGCAGTGCCAATGG - Intergenic
1019008279 6:168821954-168821976 CCAGCCAAAGTCAGGGCCAAAGG + Intergenic
1019692709 7:2425546-2425568 TCAGCCACATCCAGAAACAATGG - Intronic
1020242876 7:6409318-6409340 TCATCCCCAGCCAGAGCCCAGGG + Exonic
1022134143 7:27431664-27431686 TCAGCTACAGCCAGAGCACAAGG - Intergenic
1022829575 7:34052034-34052056 ACAGCCATAGCCAAAGCCAATGG + Intronic
1023756582 7:43423960-43423982 CCAGGTACAGACAGAGCCAAAGG + Intronic
1024125644 7:46291816-46291838 TCAGCCACAGTCAAAGCCCTTGG + Intergenic
1024181550 7:46900384-46900406 CCAGCCATTGGCAGAGGCAATGG + Intergenic
1024927720 7:54635664-54635686 TCAGTCACAGCCACAGCCACGGG - Intergenic
1025028242 7:55535482-55535504 GCAGAGACAGGAAGAGCCAATGG - Intronic
1026063335 7:67046266-67046288 TCAACCACAAGCAGAACCAAAGG - Intronic
1026237734 7:68542983-68543005 TCAGCCAGAGGCTGAGCCTATGG - Intergenic
1026715008 7:72781231-72781253 TCAACCACAAGCAGAACCAAAGG + Intronic
1027721599 7:81748604-81748626 ACAGCAATAGACAGAGCCAAAGG - Intronic
1028650342 7:93143881-93143903 TAAGTCACAGAAAGAGCCAAAGG - Intronic
1029905945 7:104093497-104093519 TCAGCCACCGGAAGTGCCATGGG - Intergenic
1030139020 7:106285695-106285717 TCAGCCATAGACAGAGCCGCCGG - Intronic
1030168515 7:106578783-106578805 TCAGCCACATTCATAGCCAATGG + Intergenic
1030627020 7:111855367-111855389 TTGGCCACAGACAGAGACAAAGG + Intronic
1033480136 7:141731626-141731648 AGAGCCAGAGTCAGAGCCAATGG - Intergenic
1034548792 7:151807261-151807283 TCAGCCACCAGCAGACCCATGGG + Intronic
1035109791 7:156471532-156471554 TCAGCAAAGGGCAGAGGCAAAGG - Intergenic
1035209023 7:157314153-157314175 GCAGCCGCGGGCAGAGCCACAGG - Intergenic
1035424302 7:158757509-158757531 ACAGTGAGAGGCAGAGCCAAAGG + Intronic
1035611079 8:964854-964876 ATGGCCACAGGCGGAGCCAAAGG - Intergenic
1035622537 8:1044737-1044759 GCAGCCACAGGCACAGACACAGG - Intergenic
1037639107 8:20726631-20726653 GTAGCCCAAGGCAGAGCCAAAGG - Intergenic
1037912436 8:22751800-22751822 CCAGCAACAGGCAGAGGCCAAGG - Intronic
1041085219 8:54250283-54250305 ACAGCAGCATGCAGAGCCAAGGG - Intergenic
1044252696 8:90022615-90022637 TCAGACAGAGGCAGAGACACAGG - Intronic
1044848720 8:96407257-96407279 TGAGGCCCAGGCACAGCCAATGG - Intergenic
1045546987 8:103138500-103138522 TCAGCCAGAGGGATGGCCAAGGG + Intronic
1047695329 8:127397679-127397701 TCAGGCAGAGTGAGAGCCAAAGG - Intergenic
1048574847 8:135682382-135682404 TTAGCCACTGGCAGACTCAAGGG + Intergenic
1049700300 8:144008096-144008118 TCAGCAACAGGCAGACCCGGAGG + Intronic
1049725252 8:144142794-144142816 TCACCCGGAGGCAGGGCCAAGGG + Intergenic
1050373569 9:4947576-4947598 TAAGCCACAGGCTGAGAAAAAGG - Intergenic
1051342083 9:16121049-16121071 TCAGCCGCAAGCGAAGCCAAAGG + Intergenic
1051357386 9:16252441-16252463 GCAGCCACAGACAGTACCAATGG - Intronic
1051699110 9:19800973-19800995 TAATCCACAGGGAGGGCCAATGG + Intergenic
1052586485 9:30435551-30435573 TCAGCTACAAACAGATCCAATGG + Intergenic
1053354844 9:37436855-37436877 GGATCCACAGGCAGAGCCAAGGG + Exonic
1053439934 9:38107879-38107901 CCAGCCACAGCCAAAGCCATGGG + Intergenic
1056319993 9:85426915-85426937 TCAGCCACAGCAAGAGCCTGAGG - Intergenic
1059151611 9:111954436-111954458 TCAGCAGCAGGAGGAGCCAATGG - Intergenic
1060385515 9:123223905-123223927 TCTGACACAGGCAGAACCAAAGG + Intronic
1060731127 9:126037709-126037731 TCAGCCCCAGACAGAGCGAGAGG - Intergenic
1060819156 9:126651578-126651600 TTAGCCCCAGGCAGGGCCATGGG + Intronic
1061048254 9:128179060-128179082 GCAGCCACAGGTACAGCCACAGG - Exonic
1062605752 9:137348213-137348235 TCAGACACAGCCACAGCCACAGG + Exonic
1185750683 X:2608353-2608375 TCAGACACAGGCAAGGCCAGAGG - Intergenic
1185769327 X:2753384-2753406 TCATTCACAGTAAGAGCCAAAGG + Intronic
1188190407 X:27165478-27165500 TTAGCCACAGACTGAACCAAAGG - Intergenic
1188203940 X:27329094-27329116 TAAGCCACAAACAGATCCAAAGG + Intergenic
1188667318 X:32840042-32840064 TCAGCCACAGGCTAAGGTAAAGG + Intronic
1188968565 X:36584186-36584208 TCAGCCAAATGAAGAGCCATGGG + Intergenic
1191898142 X:66015183-66015205 TGACCCACAGGCAGAGCCTAGGG + Intergenic
1192437027 X:71149158-71149180 TGTGCCAAAGGCAGAGCCAGTGG + Intronic
1193374822 X:80746848-80746870 TCAGGCAAAGGCAGATCCACTGG + Intronic
1193978097 X:88148807-88148829 ACAGCCACAATCAAAGCCAAGGG - Intergenic
1195004606 X:100673440-100673462 TGACCCACAGCCAGACCCAAAGG + Intergenic
1195546230 X:106115369-106115391 ACAGCCACTGCCAGAGCCATTGG + Intergenic
1195918529 X:109959389-109959411 TGAGTCAGAGGTAGAGCCAATGG + Intergenic
1196037548 X:111162939-111162961 TCAGACACAGGAGGGGCCAATGG - Exonic
1196178717 X:112667804-112667826 TCAGCTACAGGTGGAGCAAATGG + Intronic
1196187929 X:112764404-112764426 TGAGCAACAGGTAGAACCAAAGG - Intergenic
1196457025 X:115898229-115898251 CCAGCCACCAACAGAGCCAATGG + Intergenic
1197969616 X:132101410-132101432 TCAGCCGCAGGCTGAGCCAAGGG + Intronic
1199578890 X:149341908-149341930 TCAGTCACAGCCAGAGTCATTGG + Intergenic
1200088922 X:153625461-153625483 ACAGCCCCTGGCAGAGCCAAGGG + Intergenic
1201301177 Y:12506237-12506259 TCATTCACAGTAAGAGCCAAAGG - Intergenic