ID: 945636645

View in Genome Browser
Species Human (GRCh38)
Location 2:212361743-212361765
Sequence GAATCAGTTGAGGATTGTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 217}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945636645_945636648 17 Left 945636645 2:212361743-212361765 CCTCCACAATCCTCAACTGATTC 0: 1
1: 0
2: 0
3: 14
4: 217
Right 945636648 2:212361783-212361805 AACTTCTATTCGACAATGTCTGG 0: 1
1: 0
2: 0
3: 8
4: 76
945636645_945636649 24 Left 945636645 2:212361743-212361765 CCTCCACAATCCTCAACTGATTC 0: 1
1: 0
2: 0
3: 14
4: 217
Right 945636649 2:212361790-212361812 ATTCGACAATGTCTGGCATGTGG 0: 1
1: 0
2: 1
3: 9
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945636645 Original CRISPR GAATCAGTTGAGGATTGTGG AGG (reversed) Intronic
902805478 1:18858969-18858991 GCATCACTTGGAGATTGTGGGGG - Intronic
904369506 1:30039689-30039711 GAATGAGTGGATGATTGTGGAGG - Intergenic
905679016 1:39853481-39853503 GGATCACTTGAGGCTTGAGGCGG - Intronic
906040098 1:42782200-42782222 AAATCAGTTGAGTGTGGTGGCGG + Intronic
907604725 1:55805214-55805236 GAGTCAGGGGAGGGTTGTGGGGG - Intergenic
907891436 1:58640243-58640265 GAATCCTTTGAAAATTGTGGAGG + Intergenic
910219253 1:84873900-84873922 GAATTAGCTGAGCATGGTGGCGG - Intronic
910274697 1:85436669-85436691 CAATCAGATGAGTATTATGGTGG + Intronic
910343341 1:86212463-86212485 AAATTAGTTGAGTATGGTGGTGG + Intergenic
912757841 1:112339532-112339554 GTTTCTGTGGAGGATTGTGGAGG - Intergenic
915413115 1:155718535-155718557 AAATTAGTTGAGCATGGTGGCGG + Intronic
919026035 1:192171832-192171854 GAATAATTTGAGGATTGTATTGG + Intronic
919320959 1:196037752-196037774 AAATTAGTTGAGCATGGTGGTGG - Intergenic
922935544 1:229419653-229419675 GAATTAATTGAGGATTGGAGGGG + Intergenic
923995189 1:239485779-239485801 TACTCAGTTTAGCATTGTGGAGG - Intronic
924537592 1:244950430-244950452 AAATTAGTTGAGCATGGTGGCGG - Intergenic
1063996716 10:11626625-11626647 GAGTCAGCTGGGCATTGTGGTGG + Intergenic
1065753687 10:28911778-28911800 CAATCAGCTGGGCATTGTGGTGG + Intergenic
1066497491 10:35956328-35956350 CATGCAGTTGAGGATTGTGGTGG - Intergenic
1066625139 10:37398398-37398420 CATGCAGTTGAGGATTGTGGTGG - Intergenic
1067746307 10:48938953-48938975 GAAGCCAGTGAGGATTGTGGCGG - Intronic
1068647382 10:59482570-59482592 AGATCAGTTGAGGCTTGGGGTGG - Intergenic
1068661960 10:59631948-59631970 GAATCCATTGAGGATAGTGTGGG - Intergenic
1070176644 10:73976334-73976356 AAATCAGTTGGGCATGGTGGCGG - Intergenic
1070207688 10:74280188-74280210 GAATCGCTTGAGGAAGGTGGAGG - Intronic
1070486112 10:76933282-76933304 CACTCAGTAGAGGTTTGTGGAGG - Intronic
1075047947 10:119160746-119160768 AAATTAGTTGGGCATTGTGGTGG - Intronic
1075630042 10:123995263-123995285 GACTCAGTTGAACAATGTGGGGG + Intergenic
1076029705 10:127147194-127147216 GAAGCCGTCAAGGATTGTGGTGG + Intronic
1076400269 10:130178851-130178873 AAATCAGTTGGGCATGGTGGCGG - Intronic
1077137195 11:1006428-1006450 AATTCAGCTGAAGATTGTGGGGG + Intronic
1078161631 11:8844882-8844904 GAATTAGCTGAGCAATGTGGTGG - Intronic
1086024512 11:82274004-82274026 TAATCACTTGAGACTTGTGGTGG - Intergenic
1087647231 11:100822356-100822378 GAATCAGTGGTGGATTATAGGGG + Intronic
1088340847 11:108764517-108764539 AAATTAGTTGAGTATGGTGGCGG + Intronic
1089995997 11:122908120-122908142 GAATCACCTGGGGAGTGTGGCGG - Intronic
1090002193 11:122971372-122971394 GAATCAGTTTAGAATGGTGAGGG - Intergenic
1090275316 11:125414593-125414615 GAAGCAGCTGAGGATTGGGGAGG - Intronic
1091719363 12:2801350-2801372 GAACAAGGTGAGGATTGGGGTGG + Exonic
1092926622 12:13278127-13278149 CAATCTGTTGGGGATGGTGGGGG - Intergenic
1093853183 12:24065880-24065902 GAATTAATTCAGGATTTTGGTGG - Intergenic
1095031255 12:37284219-37284241 GAATGATTTGAGGCCTGTGGTGG + Intergenic
1095297507 12:40543836-40543858 AAATCAGGTGAAGATTATGGGGG + Exonic
1098206327 12:68114106-68114128 GAAACCGTTGTGGACTGTGGGGG - Intergenic
1099385953 12:82013546-82013568 GAAATAGTTGAGAACTGTGGAGG + Intergenic
1099932743 12:89092270-89092292 GAATGAGTTTAAGATTTTGGGGG + Intergenic
1102152056 12:110695579-110695601 GAATGAGCTGGGGGTTGTGGTGG + Intronic
1103320969 12:120092725-120092747 CCATCAGCTGAGGACTGTGGCGG + Intronic
1104991771 12:132628491-132628513 AAATTAGCTGAGCATTGTGGCGG + Intronic
1111997020 13:95175460-95175482 AAATCAGTGGTGGATGGTGGCGG - Intronic
1112641963 13:101285447-101285469 AAATTAGTTGGGCATTGTGGCGG - Intronic
1113160595 13:107376363-107376385 AAAACAGTTGAAGAATGTGGAGG - Intronic
1118519722 14:66569511-66569533 AAATCAGCTGAGCATGGTGGGGG + Intronic
1119366106 14:74093099-74093121 AAATTAGCTGAGCATTGTGGCGG - Intronic
1120515567 14:85465635-85465657 GAATGAGTTGAGACTTTTGGAGG + Intergenic
1121094707 14:91208597-91208619 GAATTAGCTGAGTATGGTGGTGG + Intronic
1123193106 14:106590509-106590531 GAATCAGTTTAAGATTGTACTGG + Intergenic
1124252592 15:28116835-28116857 GAATCTGTGGATGACTGTGGGGG - Exonic
1125080597 15:35668335-35668357 TATTCAGTTTTGGATTGTGGTGG + Intergenic
1125647502 15:41284501-41284523 GTATCAGTTGAGGCCTGTTGTGG + Intergenic
1126370279 15:47938649-47938671 GAATCAATTTAGCATTGTGTTGG + Intergenic
1126647741 15:50892414-50892436 GAATTATTATAGGATTGTGGGGG - Intergenic
1127997285 15:64160797-64160819 AAATCAGCTGGGCATTGTGGTGG - Intronic
1128174288 15:65540889-65540911 GGCTCAGTTTAGGGTTGTGGAGG + Intronic
1130116171 15:81006479-81006501 CAATCAGATGAGGATGGTGGGGG - Intergenic
1130714731 15:86321625-86321647 AAATTAGTTGAGCATGGTGGCGG + Intronic
1131229042 15:90647067-90647089 GAATAAGAGGAGGATTGTGGAGG - Intergenic
1131513974 15:93065581-93065603 GAATCACTCCAGGATGGTGGTGG + Intronic
1134656708 16:15952950-15952972 GAATCACTTGAAGGCTGTGGGGG + Intronic
1137830169 16:51536792-51536814 AAATCAGCTGAGCATGGTGGTGG - Intergenic
1139897078 16:70296151-70296173 AAATCAGCTGAGCATGGTGGTGG - Intronic
1143209962 17:5178705-5178727 GCATCATTTTTGGATTGTGGTGG - Intergenic
1143491672 17:7288785-7288807 GAATCACTCCAGGATGGTGGTGG + Exonic
1144295898 17:13874838-13874860 GAACCAGATGAGTAGTGTGGGGG + Intergenic
1146120735 17:30191721-30191743 GAATCAGTTGAGCCTGGTCGAGG + Intergenic
1148046209 17:44746667-44746689 AAATGAGTTGAGCATTGTGGCGG + Intronic
1148243862 17:46017601-46017623 AAATTAGTTGAGCATGGTGGCGG - Intronic
1149670041 17:58399533-58399555 GAAGGAGTTCAGGATTGTGAAGG - Intronic
1149945275 17:60918840-60918862 AAATTAGTTGGGCATTGTGGCGG - Intronic
1149997775 17:61413849-61413871 GAAGCAGTTGAGGCTGGGGGCGG - Intergenic
1152640566 17:81447587-81447609 GACTCAGAGGAGGACTGTGGCGG + Exonic
1153704884 18:7735265-7735287 AAATTAGTTGAGCATGGTGGTGG + Intronic
1154237919 18:12623776-12623798 AAATTAGTTGAGCATGGTGGTGG - Intronic
1158344332 18:56500276-56500298 AAATCAGCTGGGTATTGTGGCGG - Intergenic
1159147711 18:64476024-64476046 ATATCAGTTGAGGTTTCTGGAGG - Intergenic
1159787625 18:72733098-72733120 GATTCAGATGAGGAATCTGGAGG + Intergenic
1160809201 19:1005852-1005874 GAATTAGCTGAGCATGGTGGTGG + Intronic
1160844272 19:1159669-1159691 GAAACAGTGGGGGATAGTGGGGG + Intronic
1161368854 19:3897756-3897778 AAATCAGCTGAGCATGGTGGTGG + Intronic
1161970542 19:7577300-7577322 GAATTAGCTGGGCATTGTGGTGG + Intergenic
1165487798 19:36105846-36105868 AAATCAGCTGAGTATGGTGGTGG - Intergenic
1166502324 19:43351155-43351177 GAATCACTTGAAGCTGGTGGTGG - Intergenic
1166507781 19:43382306-43382328 GAATCACTTGAAGCTGGTGGTGG + Intergenic
1166971628 19:46572406-46572428 AAATCAGCTGAGCATGGTGGCGG + Intronic
1168483104 19:56737938-56737960 AAATTAGTTGAGCATGGTGGTGG - Intergenic
925867771 2:8244112-8244134 ATTTCAGTTGAGAATTGTGGTGG - Intergenic
926090364 2:10044994-10045016 AAATCAGCTGAGCATGGTGGTGG + Intronic
927770455 2:25856520-25856542 AACTCATTTGAGGATTGAGGAGG - Intronic
929543915 2:42843404-42843426 GAATCAGCAGAGGATGTTGGTGG - Intergenic
931174490 2:59839488-59839510 AAATTAGCTGAGCATTGTGGCGG + Intergenic
932064347 2:68537515-68537537 AAATTAGTTGAGCATGGTGGTGG - Intronic
932818845 2:74882390-74882412 GAGTAAGTTGAGGCTGGTGGAGG + Intronic
935401704 2:102667012-102667034 GAAGCAGATGAGGTTTGTGGTGG + Intronic
937469795 2:122165321-122165343 GAAACAGTTGAAGAATATGGGGG + Intergenic
937995251 2:127689683-127689705 AAATTAGTTGAGTATGGTGGTGG - Intergenic
938174210 2:129109576-129109598 TAATCAGTTGTGGATTATAGAGG - Intergenic
941036112 2:160570799-160570821 GAACCTGTTAAGGGTTGTGGGGG - Intergenic
941140200 2:161770985-161771007 GAAGCAGTTGTGGATAGAGGTGG + Exonic
942891164 2:180990470-180990492 GAATCAGCTGAGGAAGGTGTAGG - Intronic
943510065 2:188813969-188813991 GAATCAGTCTAGGAATGTGTCGG + Intergenic
944717342 2:202388636-202388658 GAATTAGTTGGGCATGGTGGTGG + Intronic
944903487 2:204239725-204239747 GAATGAAAAGAGGATTGTGGAGG + Intergenic
945636645 2:212361743-212361765 GAATCAGTTGAGGATTGTGGAGG - Intronic
948957592 2:241305908-241305930 AAATTAGTTGAGCATGGTGGCGG - Intronic
948966883 2:241389129-241389151 AAATCAGCTGGGCATTGTGGTGG + Intronic
1169717832 20:8640581-8640603 GAATCATTTCAGGAATGTGAGGG + Intronic
1172956620 20:38764429-38764451 AAATAAGTTGGGGATGGTGGTGG - Intronic
1175036781 20:56006725-56006747 GGATCAGGTGAAGATTGTGCTGG - Intergenic
1178064770 21:28892295-28892317 GAATCTCTTGAATATTGTGGTGG + Intergenic
1178171769 21:30049225-30049247 GCATAGGGTGAGGATTGTGGAGG + Intergenic
1178433674 21:32538217-32538239 AAATTAGTTGAGCATGGTGGCGG + Intergenic
1179192226 21:39133277-39133299 GAGACAGTTCAGGACTGTGGGGG - Intergenic
1182644930 22:31800581-31800603 GAAGCAGTTGAGGGATGGGGTGG - Intronic
1182820268 22:33210016-33210038 GAATTAGTAGAGGATTGGGGTGG - Intronic
1183779664 22:39990663-39990685 GAATAAGCTGAGGCTTCTGGAGG - Intergenic
1183864598 22:40694136-40694158 GATTCATTTGAGGATTGATGAGG - Intergenic
1184885102 22:47339281-47339303 GAGTCAGTAGAGGATTGAGTAGG - Intergenic
1185078869 22:48698377-48698399 GAATCAGTTGATGATGGTGATGG + Intronic
951536061 3:23741956-23741978 AAATTAGTTGAGCATGGTGGTGG + Intergenic
952270010 3:31821182-31821204 CAATGAGTTGAGGATTGGTGGGG + Intronic
952290266 3:32008300-32008322 AAATTAGCTGAGCATTGTGGCGG - Intronic
952535882 3:34308572-34308594 GAATCAGTGGAGGAGTGTCTTGG + Intergenic
953867407 3:46596241-46596263 GTATCAGTTGGGGTCTGTGGCGG + Intronic
954026557 3:47787633-47787655 AAATTAGTGGAGCATTGTGGTGG + Intergenic
954377989 3:50205056-50205078 GACTCCGTTGAGTCTTGTGGGGG - Intergenic
955684819 3:61539264-61539286 CAATTAGCTGAGGATGGTGGTGG - Intergenic
956593141 3:70937317-70937339 GAATCTGTTGAGTGTGGTGGAGG - Intergenic
956823376 3:72973702-72973724 GAATTGGATGAGGGTTGTGGGGG + Intronic
956966233 3:74464305-74464327 CATTCAGTTGAGAATTATGGGGG - Intronic
957094863 3:75768909-75768931 GAATCAGGTTGTGATTGTGGTGG - Intronic
957520597 3:81313555-81313577 GATTCAGGTGAGGATTCTAGAGG - Intergenic
959696282 3:109252529-109252551 AAATTAGCTGAGCATTGTGGTGG - Intergenic
965205664 3:165717372-165717394 AAATTAGTTGAGCATGGTGGTGG - Intergenic
967884046 3:194321418-194321440 AAATTAGTTGAGCATAGTGGTGG + Intergenic
968144214 3:196284990-196285012 GAATGAGTTGAGAATGGTGGGGG - Intronic
970034745 4:11720236-11720258 GAAACAGTAGAGGGTTCTGGGGG + Intergenic
971354190 4:25879630-25879652 GAATCAGTGGAGGACTGGGAAGG - Intronic
971681932 4:29711009-29711031 CAATCAATAGAGGATAGTGGAGG - Intergenic
972101800 4:35429843-35429865 GAATAAGTTGAGGATAATAGTGG - Intergenic
972364551 4:38362009-38362031 GCATCTGTTGAGGCTTGTAGGGG - Intergenic
972559115 4:40210674-40210696 GAATAGGGTGAGGGTTGTGGTGG + Intronic
972863834 4:43205644-43205666 CCATCAGTTGAGGATTGGAGGGG - Intergenic
975177238 4:71301767-71301789 GAATCCCTTGAGGAATGGGGAGG + Intronic
976721326 4:88171727-88171749 GAATTCTTTGAGGATTGAGGAGG + Intronic
979887117 4:126041795-126041817 AAATCAGTTTATGATTGTGCTGG + Intergenic
981489421 4:145323959-145323981 GGATCAGCTGATGTTTGTGGGGG - Intergenic
981801598 4:148664315-148664337 AAATCAGGTGAGCATGGTGGCGG + Intergenic
982646462 4:158029968-158029990 CAAAAAATTGAGGATTGTGGAGG + Intergenic
982751491 4:159167331-159167353 TAATCAGCTGGGAATTGTGGTGG + Intronic
983342600 4:166483694-166483716 AAATTAGCTGAGCATTGTGGCGG + Intergenic
983414039 4:167433283-167433305 GATTCAGTTGAGAATTGTGAAGG - Intergenic
984323895 4:178227438-178227460 AAATCAGCTGAGCATGGTGGTGG - Intergenic
985695530 5:1338081-1338103 GAAGCAGTTGAGGGTGGTGCTGG - Intronic
986762232 5:10890371-10890393 AAATCAGCTGAGCATGGTGGCGG + Intergenic
986943363 5:12984461-12984483 GAAGCAGATAAGAATTGTGGTGG - Intergenic
989863607 5:46417835-46417857 GAAAGATTTGAGGCTTGTGGTGG - Intergenic
991640759 5:68749515-68749537 AAATCAGTTGAGGAAAATGGTGG - Intergenic
993323882 5:86510247-86510269 GAATCAAATGATGATTTTGGCGG + Intergenic
996154736 5:120084284-120084306 TATTCAGTTGAGGAGTGTGATGG + Intergenic
997445280 5:133935731-133935753 GAATCAGTGGGGGTTTGGGGAGG - Intergenic
997954323 5:138266829-138266851 AAATTAGCTGAGCATTGTGGCGG - Intronic
998116840 5:139544436-139544458 AAATTAGCTGAGCATTGTGGTGG - Intronic
1001867565 5:175118510-175118532 GAAATAGTTGAAGAGTGTGGAGG + Intergenic
1002527768 5:179824317-179824339 GAATCAGGTGAGGCTTGTGTTGG + Exonic
1002850911 6:995652-995674 GAAGCAGTTGAGGATGGAGAGGG - Intergenic
1004747260 6:18523275-18523297 GAATCAGCTGCCGAGTGTGGTGG + Intergenic
1005497953 6:26405230-26405252 GAATCAGAGGGGGATTGTGGTGG + Intronic
1007002297 6:38325533-38325555 GAATTAGCTGAGCATGGTGGTGG + Intronic
1009352613 6:62701195-62701217 GAATAAGATGAGGGTTGAGGAGG + Intergenic
1010250748 6:73704574-73704596 GACTCACTGAAGGATTGTGGTGG + Intronic
1010435503 6:75825441-75825463 AAATTAGTTGAGCATGGTGGTGG + Intronic
1011595691 6:89013838-89013860 AAATTAGCTGAGCATTGTGGCGG + Intergenic
1013248698 6:108313163-108313185 GAGTCAGGTGAGGAATCTGGAGG + Intronic
1014339667 6:120188155-120188177 CAAGCTGATGAGGATTGTGGTGG + Intergenic
1014508733 6:122293803-122293825 GACTCAGTTAAGGATTTTGATGG + Intergenic
1017848645 6:158282984-158283006 AAATTAGTTGAGCATGGTGGTGG + Intronic
1020805614 7:12786669-12786691 GAATCATTTGACGATTGTCAGGG - Intergenic
1020907755 7:14085723-14085745 GAATCAGTTGCGACTTCTGGAGG + Intergenic
1022323459 7:29308612-29308634 GAATGCGTGGAGGATTGTGTGGG + Intronic
1024598491 7:50960065-50960087 GGATCAGAGGAGGACTGTGGAGG - Intergenic
1025972631 7:66342310-66342332 GAATCTGGTGAGGTTTCTGGAGG - Intronic
1026155424 7:67821743-67821765 AAATCAGTTGGGCATGGTGGTGG - Intergenic
1026567122 7:71498387-71498409 GAATCACTTGAGCCTGGTGGAGG + Intronic
1027526209 7:79271881-79271903 GAATCCTTTGAAGACTGTGGTGG - Intronic
1027924102 7:84437911-84437933 AAATCAGCTGAGGCTTGTAGGGG - Intronic
1028015244 7:85701960-85701982 GAATCATGTGAGTATTCTGGTGG + Intergenic
1028775744 7:94674104-94674126 AAATTAGCTGAGCATTGTGGCGG - Intergenic
1031316128 7:120260001-120260023 AACTCAGTTGAGGAATGTGTTGG + Intergenic
1031346853 7:120677446-120677468 GAAATAGTTGAGGATAGAGGTGG + Intronic
1032218470 7:129975878-129975900 AAATTAGCTGAGCATTGTGGCGG + Intergenic
1032595300 7:133233649-133233671 GAATCACTGGAGGTTTGTGAAGG + Intergenic
1033816778 7:145083139-145083161 GAATCAGGGGAGTAGTGTGGGGG - Intergenic
1033958850 7:146887296-146887318 GAATCAGTTGGGTGTGGTGGTGG - Intronic
1034139174 7:148800398-148800420 GAATCAGGGGAGATTTGTGGTGG + Intronic
1034586085 7:152093576-152093598 AAATTAGCTGAGGGTTGTGGTGG - Intronic
1038188176 8:25294477-25294499 CAAGAAGTTGAGGACTGTGGTGG - Intronic
1039507914 8:38065480-38065502 AAATTAGTTGAGCATGGTGGTGG + Intergenic
1040700263 8:50055109-50055131 GAAGCAGTTGAGGTTAGTGTGGG - Intronic
1042340695 8:67675689-67675711 GAGTCATTTGTGGACTGTGGAGG + Intronic
1043708848 8:83388037-83388059 GCATAATTTGAGGATTGTGAGGG - Intergenic
1044643599 8:94413983-94414005 AAATCAGCTGAGCATGGTGGTGG - Intronic
1044645767 8:94441555-94441577 GAATAAGTGGAGGTTTCTGGGGG - Intronic
1046126218 8:109911851-109911873 GAATGAGTTGGGGATTTGGGAGG + Intergenic
1047012160 8:120684379-120684401 GAATGAGTTAAGAATTTTGGGGG - Intronic
1047231852 8:123004327-123004349 GATTAAGTGGAGGATTGTGCAGG - Intergenic
1054876575 9:70103433-70103455 AAATCAGTTGAGGATAGATGTGG - Intronic
1055078304 9:72240475-72240497 AAACCATTTGAGTATTGTGGTGG + Intronic
1056719108 9:89058296-89058318 GATGCAGTGGAGGATGGTGGTGG + Intronic
1057541144 9:95972161-95972183 AAAGCAGTTGAGGATAGTGATGG + Intronic
1060922443 9:127431344-127431366 GAATCGCTTGAGCATTGGGGGGG - Intronic
1061857794 9:133452260-133452282 AAATCAGTTGGGGGTGGTGGCGG - Intronic
1062339046 9:136085839-136085861 CAGTGAGTTCAGGATTGTGGAGG - Intronic
1185882774 X:3756270-3756292 AAATTAGTTGAGCATGGTGGTGG - Intergenic
1186986903 X:15026871-15026893 GAATTAGCTCATGATTGTGGAGG - Intergenic
1187752603 X:22484048-22484070 GAATCAGTTGAGGCAGGTGTAGG - Intergenic
1191672563 X:63762030-63762052 GCATCAGTTCAAGACTGTGGTGG + Intronic
1192563909 X:72146820-72146842 GAATAAGTTGGGGCTGGTGGGGG - Intergenic
1194477359 X:94375154-94375176 GATTCAATTGAGGAGTGAGGGGG - Intergenic
1195335956 X:103854424-103854446 GTATCAGTTGAGAATTGCAGTGG + Intergenic
1200934438 Y:8725859-8725881 CAATCAGTTGAGGGTTGCTGGGG - Intergenic
1201569632 Y:15400083-15400105 GAATGAGTTAAGATTTGTGGGGG + Intergenic
1201723200 Y:17125798-17125820 GAATCATTTCAAGAGTGTGGTGG + Intergenic