ID: 945637188

View in Genome Browser
Species Human (GRCh38)
Location 2:212370099-212370121
Sequence TACCTGGACCTGCCCTTGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 1, 2: 15, 3: 27, 4: 166}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945637188_945637196 27 Left 945637188 2:212370099-212370121 CCTGTCAAGGGCAGGTCCAGGTA 0: 1
1: 1
2: 15
3: 27
4: 166
Right 945637196 2:212370149-212370171 CCTCCATGCTGTTCTCAGAATGG 0: 1
1: 3
2: 22
3: 96
4: 467
945637188_945637191 -4 Left 945637188 2:212370099-212370121 CCTGTCAAGGGCAGGTCCAGGTA 0: 1
1: 1
2: 15
3: 27
4: 166
Right 945637191 2:212370118-212370140 GGTAGAGATAATTGAATCATGGG 0: 49
1: 738
2: 1615
3: 3775
4: 7547
945637188_945637194 1 Left 945637188 2:212370099-212370121 CCTGTCAAGGGCAGGTCCAGGTA 0: 1
1: 1
2: 15
3: 27
4: 166
Right 945637194 2:212370123-212370145 AGATAATTGAATCATGGGGGTGG 0: 716
1: 2489
2: 3822
3: 4761
4: 5158
945637188_945637190 -5 Left 945637188 2:212370099-212370121 CCTGTCAAGGGCAGGTCCAGGTA 0: 1
1: 1
2: 15
3: 27
4: 166
Right 945637190 2:212370117-212370139 AGGTAGAGATAATTGAATCATGG 0: 52
1: 799
2: 1596
3: 2948
4: 5655
945637188_945637192 -3 Left 945637188 2:212370099-212370121 CCTGTCAAGGGCAGGTCCAGGTA 0: 1
1: 1
2: 15
3: 27
4: 166
Right 945637192 2:212370119-212370141 GTAGAGATAATTGAATCATGGGG 0: 44
1: 713
2: 1562
3: 3820
4: 7520
945637188_945637193 -2 Left 945637188 2:212370099-212370121 CCTGTCAAGGGCAGGTCCAGGTA 0: 1
1: 1
2: 15
3: 27
4: 166
Right 945637193 2:212370120-212370142 TAGAGATAATTGAATCATGGGGG 0: 41
1: 766
2: 2808
3: 6739
4: 7779

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945637188 Original CRISPR TACCTGGACCTGCCCTTGAC AGG (reversed) Intronic
900545281 1:3225431-3225453 TGGCTGGACCTGCCCTTCAGAGG - Intronic
900957143 1:5892977-5892999 TGCCTGGATCTGCCTTTGAATGG - Intronic
901195251 1:7436660-7436682 TTCCTGGACTTGCCCTTCCCGGG + Intronic
901791311 1:11654882-11654904 CGCCTGGACCTGCGCTTGCCTGG - Exonic
903774882 1:25786564-25786586 TGCCTGGCTCTGCCCTTGGCTGG - Intergenic
904009602 1:27382325-27382347 TACCTGGACATGCCTCTGAGCGG + Exonic
904200189 1:28814529-28814551 CACCTGGAGCTCCCCTAGACAGG - Intronic
904810714 1:33161724-33161746 CACCTGGAGCTGCCCTCCACAGG + Intronic
907814876 1:57908622-57908644 TTCCTAGACAGGCCCTTGACAGG - Intronic
908748530 1:67398179-67398201 ACCCAGGACATGCCCTTGACTGG + Intergenic
913340893 1:117757341-117757363 TCCATTGACCTGCTCTTGACTGG - Intergenic
914043074 1:144066770-144066792 TACCTAGACCTACCCCTGCCGGG + Intergenic
914135012 1:144893718-144893740 TACCTAGACCTACCCCTGCCGGG - Intronic
915916540 1:159944149-159944171 GCCCTGGATTTGCCCTTGACTGG - Intronic
918277621 1:182968739-182968761 TACTTTGAACTGACCTTGACTGG - Intergenic
922420071 1:225453708-225453730 CACCTGGCCCTGCCCTTGACAGG + Intergenic
922853544 1:228755163-228755185 TACCTGGACCTCCCTCAGACAGG - Intergenic
923339527 1:232995814-232995836 CACCTGGAACTGGCCTTGCCTGG - Intronic
1063368691 10:5507338-5507360 TGCCTGGACCTGCTCTGGCCTGG - Intergenic
1065056077 10:21843916-21843938 CACCTCACCCTGCCCTTGACAGG - Intronic
1067723834 10:48751144-48751166 TTTCTGGGCCTGCCCTTGCCAGG - Intronic
1069532460 10:69229460-69229482 TACTGGGACGTGTCCTTGACAGG + Intronic
1070510214 10:77154024-77154046 CACCTGGTCCCACCCTTGACAGG - Intronic
1070902647 10:80044186-80044208 TACCTGGACTTCACCTGGACAGG + Intergenic
1072107925 10:92291433-92291455 TCCCTGGGCCTGGCCTTGAGCGG + Exonic
1074383765 10:113001100-113001122 TTCCTCGCCCTGCCCTTGGCTGG + Intronic
1075623502 10:123945274-123945296 CACCTGGAACAGCCCTTGAGAGG - Intergenic
1076410317 10:130244600-130244622 CACCTGCCCCTGCTCTTGACAGG + Intergenic
1076514146 10:131033733-131033755 TACCTGCAGCTGCCATTGCCAGG - Intergenic
1076849393 10:133085782-133085804 TCCCTGGAGCTGCCCTTGGAGGG - Intronic
1077037004 11:500106-500128 TACCTGCTCCTTCCCTGGACGGG + Intronic
1079101677 11:17545676-17545698 TCCTTGCCCCTGCCCTTGACAGG - Intergenic
1080840901 11:35982632-35982654 TACCCAGACATGCCCTTGAGTGG - Intronic
1083944393 11:65915980-65916002 TGCCTGGCCCTGGCCTTGATTGG - Intergenic
1087987876 11:104707264-104707286 CACCTGGTCCCGCCCTTGATAGG + Intergenic
1090210290 11:124916325-124916347 TCTCTGGACCTGCCCAGGACTGG - Intergenic
1091801439 12:3327079-3327101 GTCCTGGCCGTGCCCTTGACTGG + Intergenic
1092105041 12:5915408-5915430 TACCTGGGCATGCTTTTGACAGG - Intronic
1093913985 12:24779692-24779714 TTCCTGGACTGGCCCTTGAGTGG + Intergenic
1095535395 12:43240166-43240188 CACTTGGCCCTGCCCTTGACAGG + Intergenic
1097769940 12:63572156-63572178 TTTCTGGACCTGCCCTGGGCTGG + Intronic
1098324050 12:69281850-69281872 TTCCTGGGTCTGCCCTTTACTGG - Intergenic
1099111888 12:78572279-78572301 CACCTGGCCCCACCCTTGACAGG + Intergenic
1099646577 12:85365717-85365739 CACCTGGCCCTGCCCTTAACAGG - Intergenic
1099914263 12:88872602-88872624 TACCTGGTCCCACCCTTGACAGG - Intergenic
1099938629 12:89158621-89158643 TACATGGAACTGACCTTGCCTGG - Intergenic
1100072364 12:90736182-90736204 CACCAGGTCCTTCCCTTGACAGG + Intergenic
1104299488 12:127551359-127551381 CACCTGGCCCCGCCTTTGACAGG + Intergenic
1104367090 12:128187684-128187706 GACCTGGCCCTCCCATTGACAGG + Intergenic
1105972146 13:25439186-25439208 TACCCCGAACTGCCCTTGCCAGG - Intronic
1106499038 13:30309426-30309448 CACCTGGCCCTGCCCTTGACAGG - Intergenic
1106969824 13:35126081-35126103 TACCTGGTCCCACCCTTTACAGG - Intronic
1108164390 13:47677053-47677075 CACCTGGCCCCGCCCTTGACAGG + Intergenic
1110970911 13:81759649-81759671 CACCTGGCCTTGCCCTTGACAGG + Intergenic
1111388331 13:87559850-87559872 CACCTGACCCTGCCTTTGACAGG + Intergenic
1113549803 13:111184049-111184071 CACCTGGTCCCGCCCTTGACAGG - Intronic
1113568953 13:111339633-111339655 CACCTGGAGCTGCCTTTCACAGG + Intronic
1118956673 14:70489139-70489161 TTTCTGGACCTGCCCTGGGCTGG + Intergenic
1119296803 14:73539294-73539316 TACCTGGTCCTGCCATGCACAGG - Intronic
1121300976 14:92870722-92870744 CACCTGGCCCTGCCCTTGACAGG + Intergenic
1121301175 14:92872503-92872525 CACCTGGCCCTGCCCTTGACAGG + Intergenic
1121301309 14:92873653-92873675 CACCTGGCCCTGCCCTTGACAGG + Intergenic
1121942341 14:98083073-98083095 GACTTGCTCCTGCCCTTGACTGG + Intergenic
1122830212 14:104392296-104392318 TGCCCGGACCTGCCCATGAGGGG - Intergenic
1123197040 14:106627105-106627127 TCCCTGCACCTGCTCCTGACCGG + Intergenic
1128292546 15:66489053-66489075 TACCTGTGCCTTTCCTTGACTGG + Intronic
1130695610 15:86128363-86128385 CACCTGGCCCTGCCCTTGACAGG + Intergenic
1132476754 16:143133-143155 AGCCTGGGCCTGCCCTTGGCAGG + Intergenic
1132598405 16:763401-763423 CACCTGGACCTGCATGTGACTGG + Intronic
1132770935 16:1562926-1562948 TACCTGCAGCTGCTCTGGACAGG + Intronic
1137567343 16:49541676-49541698 CACCTGGTCCCGCCCTTGACAGG - Intronic
1137599876 16:49749291-49749313 TCCCAGGTCCTGACCTTGACAGG + Intronic
1138496587 16:57412713-57412735 TGCCTGGAGCTGCCCTTCCCTGG + Intronic
1141381186 16:83578545-83578567 AAACTGGACCTGCCCTTGAAGGG - Intronic
1141860134 16:86710819-86710841 TCCCTGGCCCTGTCCATGACCGG - Intergenic
1142973712 17:3630501-3630523 TGCCTGGGCCTGCCCTCCACTGG + Intronic
1146516073 17:33490475-33490497 CACCTGGCCCCACCCTTGACAGG - Intronic
1148735051 17:49860581-49860603 GGCCTGGCCCTGCCCTTGAAGGG + Intergenic
1149501900 17:57159174-57159196 TACCTGTTCCTGCCTTTGACAGG - Intergenic
1151674796 17:75591894-75591916 TCCCTGGACCTGCCCCTAGCTGG + Intergenic
1151701134 17:75743156-75743178 TCTCTGGTCCTGCCCGTGACTGG + Intronic
1152545687 17:80999106-80999128 TGCCTGGGCCTGGCCTTGACAGG - Exonic
1152759357 17:82099847-82099869 TAGCTGGCCCAGCCCTCGACAGG - Intergenic
1156045160 18:32869832-32869854 TGCCTGAAACTGCCCTTGAGGGG + Intergenic
1156719890 18:40057435-40057457 CACCTGGTCCTGCCCTTGACAGG - Intergenic
1157369269 18:47095344-47095366 CACCTGGTCCCGTCCTTGACAGG - Intronic
1158198753 18:54916811-54916833 CACCTGGCCCTGCCCTTGACAGG - Intronic
1161030494 19:2055961-2055983 TCCCTAGACCAGCCCTGGACAGG + Intergenic
1161721363 19:5904459-5904481 TGCCTGGATCTACCCCTGACAGG + Intergenic
1165645499 19:37432071-37432093 TCTCTGGACCTGCCCGTGGCTGG + Intronic
925178251 2:1799788-1799810 CACCTGGTCCTGCCCTTCACAGG - Intronic
925450888 2:3968439-3968461 CACCTGGTCCCGCCCTTGACCGG - Intergenic
925777096 2:7346360-7346382 TATCTGGCCCTGCCCTTTACAGG - Intergenic
925941759 2:8827421-8827443 GACCTGGAGCTGCCGTTTACTGG - Intronic
933102937 2:78282922-78282944 TACCTGGTCCTGCCCTTGACAGG - Intergenic
934605374 2:95691165-95691187 TGGCAGGACCTGCACTTGACTGG + Intergenic
934863728 2:97787528-97787550 TTCCTGGACCTCCCATTGTCTGG + Intronic
935230359 2:101090549-101090571 CAGCAGGACCTGCCCCTGACAGG + Intronic
936156360 2:110049844-110049866 TACCTGGACCTGATCCTTACTGG + Intergenic
936188329 2:110321598-110321620 TACCTGGACCTGATCCTTACTGG - Intergenic
936538834 2:113333712-113333734 TGGCAGGACCTGCACTTGACTGG + Intergenic
938558198 2:132445831-132445853 TACAGGGGCCTGCCCTTGACTGG - Intronic
945637188 2:212370099-212370121 TACCTGGACCTGCCCTTGACAGG - Intronic
946472523 2:219975463-219975485 CACCTGGCCCTGCTGTTGACAGG - Intergenic
948412539 2:237775179-237775201 TACCTAGAACTGCCCTGGCCTGG - Intronic
948696239 2:239734447-239734469 TACCAGGTCCCTCCCTTGACAGG + Intergenic
948760764 2:240189754-240189776 ACCCTGGACTTGGCCTTGACTGG - Intergenic
1169981369 20:11388276-11388298 TACCTGGTCCCTCCCATGACAGG + Intergenic
1174220354 20:48949476-48949498 CATCTGGACTTGCCCTTCACAGG + Intronic
1175613704 20:60374108-60374130 CACCTGGCCCTGCCCTTGACAGG - Intergenic
1176099398 20:63358142-63358164 GTCCTGGAGCTGCCCTTGAGTGG - Intronic
1176723790 21:10413811-10413833 CAGCTGGAGCTGCTCTTGACCGG + Intergenic
1176877635 21:14149349-14149371 CACCTGGTCCCGCCCTTGACAGG + Intronic
1177132994 21:17279856-17279878 TCTCTGGACCTGCCCTGGGCTGG + Intergenic
1178140885 21:29682011-29682033 TATCAGGACCTGCCTATGACAGG + Intronic
1180304935 22:11066552-11066574 CAGCTGGAGCTGCTCTTGACCGG + Intergenic
1180905876 22:19411089-19411111 TGCATGGATCTGCACTTGACTGG + Intronic
1181331501 22:22095938-22095960 TATCTCGACCTGCTCTTGATTGG - Intergenic
1181471981 22:23146065-23146087 GACCTGGGTCTCCCCTTGACAGG - Intronic
1184209936 22:43029458-43029480 TGCTTGAACTTGCCCTTGACAGG + Intergenic
1185332178 22:50256764-50256786 TACCTTGGTCTGCCCTTGAAGGG - Intronic
949101918 3:155862-155884 TACATAGACCTGCCAGTGACTGG - Intergenic
949769874 3:7568125-7568147 TGCCTGGAACTTCCCTTGATGGG + Intronic
951659602 3:25047888-25047910 TACTTTGTCCTGCCCTTTACAGG - Intergenic
952758611 3:36894154-36894176 TTCCTGGGCCCTCCCTTGACTGG + Intronic
953776895 3:45826847-45826869 TAACTGGACATACCCTTAACTGG + Intronic
954318171 3:49812572-49812594 TGCCTGGACCTGCCTTCCACAGG + Intronic
954365985 3:50146432-50146454 TGGCTGGCCCAGCCCTTGACAGG - Intergenic
954911940 3:54117890-54117912 CACCTGGTCCTGTCCTTGACAGG - Intergenic
955469351 3:59270088-59270110 TACCTGGATCTGATTTTGACAGG - Intergenic
959657724 3:108828928-108828950 TACCTGGATCTACCCATGAATGG - Intronic
959906163 3:111713037-111713059 TGCCTGGAACTGCCCTTCCCAGG - Intronic
961347633 3:126274396-126274418 TCCCTGGACCTGCCCCTCTCAGG + Intergenic
961569892 3:127790114-127790136 ATCCTGGATCTGCCCCTGACTGG + Intronic
961637687 3:128343372-128343394 TACCTAGACCTGCCCTCAAGTGG + Intronic
963351772 3:144160393-144160415 CACCTGGTCCTGCCCTTTACAGG + Intergenic
965100328 3:164289770-164289792 CACCTGGTCCCGCCCTTGACAGG + Intergenic
965601470 3:170458725-170458747 TACCTGGACTGCCCCTGGACAGG - Intronic
965691178 3:171358497-171358519 CACCTGGCCCCACCCTTGACCGG + Intronic
970121780 4:12761986-12762008 CACCTGGGCCTGCCTTTGACAGG + Intergenic
970378151 4:15479599-15479621 CACCTGGACCCTCCCTTGAAAGG - Intronic
970667454 4:18353981-18354003 TTTCTGGACCTGCCCTGGGCTGG - Intergenic
972851629 4:43057491-43057513 TTTCTGGACTTGCCCTTGGCAGG + Intergenic
976313744 4:83637551-83637573 TCACTGGACCAACCCTTGACTGG - Intergenic
977788962 4:101075130-101075152 CACCTGGCCCTGCCCTTGACAGG + Intronic
979250579 4:118562852-118562874 CACCTGGTCCTGCCCTTGACAGG - Intergenic
979565049 4:122145581-122145603 TTTCTGGACCTGCCCTGGGCCGG - Intergenic
985572052 5:652142-652164 TACCTTGACCTGCCACAGACAGG - Intronic
985682325 5:1262948-1262970 TACCTGGTCCTGGCCTCCACTGG - Intronic
986124280 5:4870526-4870548 CACCTGGTCCCACCCTTGACAGG - Intergenic
986277473 5:6290376-6290398 CACCTGGTCCCACCCTTGACAGG + Intergenic
987371499 5:17197697-17197719 GACCTGGACCAGCTCTTGTCTGG + Intronic
989664807 5:43841676-43841698 TTTCTGGACATGCCCTTGAAAGG - Intergenic
989770284 5:45136456-45136478 TGCCTGGAATTGCCCTTGATGGG + Intergenic
990942401 5:61215812-61215834 AGCCTGGCCCTGCCCTGGACTGG - Intergenic
992492562 5:77259378-77259400 TGCCTGGAGCTGCCCTTGAAGGG - Intronic
992895658 5:81243048-81243070 TACCTGGAACTTCCCTTAAAGGG + Intronic
994273138 5:97806093-97806115 TTCCTAGACCTGCTCTTGAAGGG - Intergenic
996201804 5:120684938-120684960 TACCTGTAGTAGCCCTTGACTGG + Intronic
997207262 5:132057105-132057127 TACCTGGAGGTGACCTTGAGGGG - Intergenic
997714889 5:136035128-136035150 GCCATGGACCTGCCCTGGACAGG - Intronic
1001436482 5:171703312-171703334 GTCATGGGCCTGCCCTTGACTGG - Intergenic
1007409943 6:41655780-41655802 TTGCTGGACCTACCATTGACAGG + Intergenic
1008405308 6:51112514-51112536 AACATAGACCTGCCCATGACAGG - Intergenic
1016025438 6:139282032-139282054 AACCTAGACCAGACCTTGACAGG - Intronic
1016025851 6:139286265-139286287 AACCTAGACCAGACCTTGACAGG - Intronic
1021365323 7:19772180-19772202 TAAGTGAGCCTGCCCTTGACAGG + Intronic
1022366958 7:29730610-29730632 TTTCTGGACCTGCCCTCGGCTGG - Intergenic
1022598934 7:31738495-31738517 CACCTGGCCCTGCTCTTGACAGG + Intergenic
1023907860 7:44534806-44534828 TTCCTGGACCTCCCCTTGGGAGG - Intronic
1024254016 7:47526547-47526569 GTCCTGGCCCTGCCCCTGACAGG - Intronic
1028972618 7:96875695-96875717 TTCCTGGACCTGCCCTGGGCTGG + Intergenic
1029825309 7:103186845-103186867 TTTCTGGACCTGCCCTGGGCTGG + Intergenic
1030991617 7:116307963-116307985 GACCAGGACCTGCTCTTGCCTGG + Intronic
1031255105 7:119436738-119436760 CACCGGGTCCTACCCTTGACAGG + Intergenic
1031998724 7:128250409-128250431 TCCCAGCAGCTGCCCTTGACTGG + Intronic
1032709078 7:134446978-134447000 TGCCTGGACCTGCCCTGCACTGG - Intronic
1034496898 7:151428528-151428550 TTCTTGGACCAGCCCTTGGCTGG + Intergenic
1034760960 7:153671474-153671496 CACCTGGTCCTGCCCTTGACAGG - Intergenic
1035675867 8:1455232-1455254 CACCTGCACCTGCACCTGACTGG - Intergenic
1037211467 8:16393433-16393455 TGCCTGGAACTTCCCTTGAAGGG - Intronic
1037922921 8:22820460-22820482 GTCCTGGCCCTCCCCTTGACCGG + Intronic
1038070385 8:24006596-24006618 CACCTGGTCCTGCCCTTGACAGG - Intergenic
1038975653 8:32692901-32692923 TAACTGGACCTGCACATGTCAGG - Intronic
1041723519 8:60997691-60997713 TGCCTCGACCTGCACTTGGCTGG - Intergenic
1043632205 8:82349809-82349831 TACCTTGACCTGGCCTAGATTGG - Intergenic
1046038582 8:108874732-108874754 CATCTGGGTCTGCCCTTGACAGG + Intergenic
1046163590 8:110398853-110398875 CACCTGGTCCTGCCCTTGACAGG - Intergenic
1049705463 8:144040163-144040185 TCCCTGGGCCTGCCCTCCACTGG + Exonic
1051413187 9:16811902-16811924 TACCTTGACCTTCCCTTCAGAGG + Intronic
1052181482 9:25533922-25533944 CACCTGGTCCTGCCCTTTACAGG - Intergenic
1055671234 9:78608054-78608076 CACCTGGCCCCACCCTTGACAGG - Intergenic
1056578932 9:87876424-87876446 GACTTGCACCTGCCCTTGTCAGG - Intergenic
1058030892 9:100196518-100196540 TGCCTGGACTTTCCCTTGAAGGG + Intronic
1059830309 9:118087780-118087802 CACCTGGCCCTGCCCTTGACAGG - Intergenic
1187041932 X:15605580-15605602 TACCAGGACCTGACCATGACTGG - Intergenic
1188237488 X:27747770-27747792 TACCCGTACCTGCCCATCACGGG - Exonic
1188405537 X:29804434-29804456 CACCTGGCCCCACCCTTGACAGG - Intronic
1188987484 X:36780483-36780505 TGCCTGGGCCTGCCCTTGAATGG + Intergenic
1189679187 X:43497382-43497404 CACCTGGCCCCACCCTTGACAGG - Intergenic
1192698024 X:73438558-73438580 CACCAGGCCCTGCCCTTGACAGG + Intergenic
1193899551 X:87161018-87161040 TATCTGGACCTGCCGTGGGCTGG - Intergenic
1194476903 X:94369574-94369596 TCTCTGGACCTGCCCTGGGCCGG + Intergenic
1195424627 X:104714353-104714375 CACCTGGTCCCACCCTTGACAGG - Intronic
1197488791 X:127090093-127090115 TCTCTGGACCTGCCCAGGACTGG - Intergenic
1199076727 X:143534139-143534161 TAACTGGACCTGACATGGACAGG - Intergenic
1199746211 X:150773275-150773297 TCCATGGCCCTGCCCTTGCCAGG + Intronic
1200115986 X:153769920-153769942 TACCTGGCCCTGCTCCTGGCGGG - Exonic
1200171044 X:154074996-154075018 TACCTGGACCTTCTCCTCACTGG - Intronic
1201547493 Y:15181495-15181517 CACCTGGTCCTTCCCATGACAGG - Intergenic