ID: 945639604

View in Genome Browser
Species Human (GRCh38)
Location 2:212407047-212407069
Sequence ACATAGGGAATATGGGCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 140}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945639604 Original CRISPR ACATAGGGAATATGGGCAGT GGG (reversed) Intronic
902123963 1:14192969-14192991 ACACAGGGATTATGGGGATTTGG - Intergenic
902805358 1:18857971-18857993 ATATTGGTAATATGGGTAGTGGG - Intronic
907681275 1:56566280-56566302 ACGTGGAGAATATAGGCAGTAGG + Intronic
909436455 1:75647797-75647819 ACAATGGGAGTATGGGCATTGGG - Intergenic
909531822 1:76690804-76690826 ATATATTGAATATGAGCAGTAGG - Intergenic
910910707 1:92230795-92230817 ACATAGGGAATATGTGAGGTAGG - Intronic
911404701 1:97421956-97421978 AAATACAGAATAGGGGCAGTGGG + Intronic
914717850 1:150266703-150266725 ACAGAGAGAATATGGGGATTAGG - Intronic
916291440 1:163171076-163171098 AGCTAGGGAACATGGGCGGTGGG - Intronic
916418501 1:164614492-164614514 ACATAGAGAATAGGGGAGGTAGG - Intronic
918444938 1:184608409-184608431 ACATATGGGCTATGGGCCGTGGG + Intronic
921047629 1:211488797-211488819 ACGGAGGGAATATGGGGAGAGGG - Intronic
921696414 1:218215474-218215496 ACATGGGGATTATGGGGATTTGG + Intergenic
922285129 1:224164244-224164266 ACAGAAGAAATATGAGCAGTTGG + Intergenic
1063000097 10:1909186-1909208 ACAGAGGGAAAGTGGGCACTGGG + Intergenic
1063300804 10:4847210-4847232 ACATGGGGAACATGGCCAGTCGG - Exonic
1063774045 10:9239717-9239739 ACATATGAAATAAGGGCAGATGG + Intergenic
1064470380 10:15629386-15629408 ACATAGATGAAATGGGCAGTGGG - Intronic
1067701903 10:48579972-48579994 AGATTGGGAACCTGGGCAGTGGG + Intronic
1069887510 10:71633432-71633454 AGATAGGGAATATGTCAAGTAGG + Intronic
1073704927 10:105972335-105972357 AGATAGGGAAAATGGGCACATGG + Intergenic
1074498680 10:114002634-114002656 ACATAGAGAAGATGGGGCGTTGG - Intergenic
1074544675 10:114393384-114393406 ACACAGGGAATGTGGGCTGCTGG + Intronic
1074807470 10:117067822-117067844 ACATATTGGATATGGGAAGTGGG + Intronic
1077399996 11:2350266-2350288 ACATTGGGGATATGGGCATTGGG - Intergenic
1078393483 11:10956671-10956693 ACAATGGGAGTATGGGCATTGGG - Intergenic
1078625719 11:12955839-12955861 AAATAGGGAATATTGGATGTTGG + Intergenic
1083032495 11:59605881-59605903 ACATAGGTCATAGAGGCAGTTGG + Intronic
1084736975 11:71111685-71111707 ACATACAGAAAATGGGCAGGTGG - Intronic
1085793727 11:79518215-79518237 AGCTAGGGAATATGGGAACTGGG + Intergenic
1088528559 11:110784198-110784220 ACATAGGGATTATGGGAAAATGG + Intergenic
1088931146 11:114351888-114351910 ACAAAGGGAACATGGGCAAGTGG - Intergenic
1091669576 12:2443208-2443230 ACAATGGGAATATAGGCATTGGG + Intronic
1091696845 12:2633416-2633438 ACCGAGGGAATGCGGGCAGTAGG + Intronic
1092548660 12:9473605-9473627 ATGTAGGGAACATGGGCTGTAGG + Intergenic
1094312714 12:29103041-29103063 ACATAGGGAAAATGCAAAGTAGG - Intergenic
1094740698 12:33285128-33285150 ACATATGGACTAAGGTCAGTTGG - Intergenic
1095301332 12:40587705-40587727 AAATGTGGAATAAGGGCAGTGGG + Intergenic
1096163264 12:49398580-49398602 ACATAGGCACTATGGGAAGAAGG + Intronic
1096821274 12:54236935-54236957 ACATAGGGAAAATGGACTGCTGG + Exonic
1097354522 12:58586563-58586585 ATACAGGGAACATGAGCAGTTGG - Intronic
1098521973 12:71442312-71442334 AGATAGGGAACATTGGCAGTAGG - Intronic
1099351885 12:81581530-81581552 AAATAGGGAACATAGGAAGTGGG - Intronic
1099673139 12:85719972-85719994 ACAAAGAGAAGATGGTCAGTAGG + Intergenic
1102993660 12:117332359-117332381 ACATAGAGAATAATGGCAGGGGG + Intronic
1103865509 12:124048939-124048961 AGAGATGGAAGATGGGCAGTGGG - Intronic
1104109041 12:125688672-125688694 ACCTGGGGACTATGGGAAGTGGG - Intergenic
1106710019 13:32320689-32320711 ACAAAGGGAATATAGGTAATGGG + Intronic
1108486936 13:50936093-50936115 ACACAGGGAACATGGGCTGGAGG + Intronic
1110033919 13:70654687-70654709 ACAATGGGCATATGGGCAGTGGG - Intergenic
1110134233 13:72045500-72045522 ACAGAGGGAATATGAGAAGCTGG + Intergenic
1111457791 13:88507023-88507045 ACAATGGGAATATAGGCATTGGG - Intergenic
1112345110 13:98582927-98582949 ACATTTGGCATATGGGCACTGGG - Intergenic
1112839261 13:103555589-103555611 ACTTAGGGAAGCTGGGCAGGTGG + Intergenic
1114059463 14:19006412-19006434 ACATAGGGGAAATGAGCAGCAGG + Intergenic
1114103083 14:19395339-19395361 ACATAGGGGAAATGAGCAGCAGG - Intergenic
1114295311 14:21323998-21324020 AGGTAGGAAATATTGGCAGTGGG - Intronic
1115134887 14:30096184-30096206 ACAATGGGAATATAGGCATTGGG - Intronic
1115492338 14:33969508-33969530 AAAAAGAGAACATGGGCAGTGGG - Intronic
1115742815 14:36405986-36406008 AAATAGAGAATATGGGGAGAGGG + Intergenic
1118691574 14:68345064-68345086 ACAATGGTAATATGGGCATTGGG - Intronic
1119721720 14:76896162-76896184 AGAAAGGGAAAATGGGCATTGGG + Intergenic
1120912321 14:89678488-89678510 ACATATGGCGTGTGGGCAGTGGG + Intergenic
1126172509 15:45706082-45706104 GCCTTGGGAATATGGGCTGTAGG + Intergenic
1134473461 16:14549312-14549334 GAATAGGGAATATGGGGAATAGG - Intronic
1140428714 16:74883465-74883487 ACATTTGGAATCTGGGAAGTGGG - Intronic
1141894527 16:86950350-86950372 ACATAGGGGACATGGGCTTTGGG - Intergenic
1142395812 16:89830708-89830730 ACAAACTGAATATGGGCAGTAGG + Intronic
1143097266 17:4484928-4484950 ACATAGGGAATAAGGGGTGGTGG + Intronic
1143326310 17:6100722-6100744 ACTGAGGGAATATGGGCTGTTGG - Intronic
1145261459 17:21357192-21357214 ACAGAGGGAATATGAGTAGATGG - Intergenic
1147501842 17:40972921-40972943 ACATAGGAAGAATGGGCACTGGG + Intergenic
1149335637 17:55633087-55633109 ACAAAGGGAAAATGGGGAGATGG - Intergenic
1151303986 17:73251132-73251154 ACACAGGGACTATCTGCAGTAGG - Intronic
1152259898 17:79261177-79261199 CAATAGGGGAGATGGGCAGTTGG - Intronic
1153894513 18:9546146-9546168 GCATAGGTAATATGTGAAGTGGG - Intergenic
1155623672 18:27810207-27810229 AAATAGTAAATATGGACAGTTGG - Intergenic
1158101602 18:53835392-53835414 ACAACGGGAATATAGGCATTGGG - Intergenic
1160208464 18:76857135-76857157 ACATAGGAATTATGGGGAGGCGG - Intronic
1161618372 19:5285270-5285292 ACATAGGGGATGAGGGCAGTAGG - Intronic
1162059431 19:8085849-8085871 ACAGAGGGAAGAGGGGCAGCAGG + Intronic
1166346216 19:42167789-42167811 CCATAGGCAATATGGGCAATGGG - Intronic
925651272 2:6092080-6092102 ACATAGGGGACAAAGGCAGTTGG - Intergenic
928101131 2:28437987-28438009 ACTTGGGGATTATGGGCAGGTGG + Intergenic
932248415 2:70218133-70218155 AGATAGAGAATATGGGCACAAGG + Intronic
934026153 2:88003173-88003195 ACAAAGGGAACAGGGGCAGGAGG - Intergenic
934288706 2:91672208-91672230 ACAGAGGGAATGTGGGGACTTGG + Intergenic
934942735 2:98514205-98514227 GCCTAGGGAATATTGGGAGTAGG + Intronic
935234181 2:101124299-101124321 ACATAGGGCATCTAAGCAGTGGG + Intronic
938644255 2:133315085-133315107 ACATAGGGAACAATTGCAGTGGG + Intronic
938797204 2:134727841-134727863 ACATATTGAATTTGGGGAGTGGG - Intergenic
943886308 2:193221277-193221299 ACAGAGGGAAAATGGACAGATGG - Intergenic
945353306 2:208807626-208807648 ACATAGAGAATGTTGGCTGTAGG - Intronic
945639604 2:212407047-212407069 ACATAGGGAATATGGGCAGTGGG - Intronic
946503514 2:220275134-220275156 ACATAGGGAAAATGTGTAATTGG - Intergenic
947104596 2:226655401-226655423 CCATAGGGAAGATGGTCAGAAGG - Intergenic
1173547688 20:43911489-43911511 ACTGTGGAAATATGGGCAGTAGG + Intergenic
1175986787 20:62768059-62768081 ACACAGGGAACAGGGGCAGCAGG - Intergenic
1176850109 21:13906767-13906789 ACATAGAGGAAATGAGCAGTAGG - Intergenic
1178086630 21:29118926-29118948 GAATGGGGAATATGGGAAGTAGG - Intronic
1179042031 21:37811843-37811865 ACCTAGGGAATATGGAGAGGTGG + Intronic
1180477943 22:15729027-15729049 ACATAGGGGAAATGAGCAGCAGG + Intergenic
1181338444 22:22159383-22159405 ACAGAGGGCAGATGGGAAGTTGG + Intergenic
1181562633 22:23714708-23714730 ACATAGGAGATATGGGGAGGGGG + Intergenic
1184082388 22:42232259-42232281 ACATAGCCTAGATGGGCAGTCGG + Intronic
1184335667 22:43851711-43851733 ACACAGGGCATGTGGGAAGTAGG - Intronic
950149424 3:10675102-10675124 ACATAGGCGATGTGGGAAGTGGG + Intronic
950179496 3:10901268-10901290 GCATAGGGCAGATGGGCAGTTGG - Intronic
950607758 3:14098318-14098340 ACAAAGGGATTATAGCCAGTGGG - Intergenic
951419774 3:22470605-22470627 ACATAGAGAAAATGGCCAATGGG - Intergenic
954842791 3:53526585-53526607 ACATAGTGAATAAGGACAGCTGG + Intronic
971953392 4:33383349-33383371 ACAGAGGGTATATGGGCTGTTGG - Intergenic
972829878 4:42802615-42802637 ACAAAGGGGAGATGTGCAGTTGG - Intergenic
976750531 4:88447720-88447742 ACATATGTCATATGGTCAGTAGG + Intergenic
978419223 4:108512169-108512191 ACGTAGGGGATGTGGACAGTGGG - Intergenic
979464021 4:121015884-121015906 ACATAGGGAAAATATACAGTGGG - Intergenic
980212780 4:129811356-129811378 CCATAGGGGATATGGCCATTGGG + Intergenic
982320780 4:154075258-154075280 ACAAAGGGATTATGGGGGGTGGG - Intergenic
983472092 4:168169591-168169613 ACAGAGGGGATATTGCCAGTTGG - Intronic
983985863 4:174060220-174060242 ACAATGGGAATATAGGCATTAGG + Intergenic
986044712 5:4025842-4025864 ACATAGCCAAGGTGGGCAGTAGG - Intergenic
989657820 5:43762896-43762918 ACATAGAGAATCTGTGCACTTGG - Intergenic
992069265 5:73134993-73135015 ACTGAGGCAATGTGGGCAGTGGG + Intergenic
992311029 5:75499100-75499122 ACATTGAGGGTATGGGCAGTGGG - Intronic
992915877 5:81452704-81452726 ACATAGGGAATTCAGGAAGTGGG + Intronic
993537396 5:89103701-89103723 TCATAGGGAAAATGGACAGAAGG + Intergenic
993829803 5:92740996-92741018 ACTTAGGGTATATGGGTAATTGG - Intergenic
1001589464 5:172855521-172855543 AAACAGGGAAGATGGACAGTTGG + Intronic
1001726024 5:173900824-173900846 AGATAAGGTATATGGGCAGCAGG - Intronic
1004573646 6:16871950-16871972 ACATGGGGAATATAGGAAGATGG - Intergenic
1009684730 6:66942632-66942654 AGATAGGGAAGATAGGGAGTGGG + Intergenic
1009763533 6:68038863-68038885 GCAGAGGGAAAATGTGCAGTTGG - Intergenic
1012796295 6:103766229-103766251 ACATAGGAAAAATAGGCAGATGG - Intergenic
1015635684 6:135271630-135271652 ACATATGGAAAATATGCAGTAGG - Intergenic
1024413694 7:49078467-49078489 ACAATGGGAATATAGGCATTGGG + Intergenic
1033023922 7:137754414-137754436 GCACAGGGAAGAAGGGCAGTGGG + Intronic
1038431370 8:27502970-27502992 ACATAGGGATTTTGGGCGGGGGG - Intronic
1038684328 8:29702643-29702665 ACAGAGGGAAAATGTGCAGAGGG + Intergenic
1041386754 8:57312411-57312433 ACAATGGGAGTATGGGCATTGGG - Intergenic
1042463047 8:69093270-69093292 ACATATGGTATAGGGGTAGTGGG + Intergenic
1043571152 8:81603676-81603698 AGATGGGAAATATGGGCTGTAGG + Intergenic
1051169341 9:14303418-14303440 ACAAAGGCAATATGGGGAATAGG + Intronic
1052389016 9:27856236-27856258 ACATTGGGAGTATGGGCACTGGG + Intergenic
1053315280 9:37045892-37045914 GCATAGGGACTTTGGGTAGTGGG + Intergenic
1054902855 9:70388128-70388150 ACATAGGGATTTTGGGGAGGGGG - Intronic
1057093204 9:92279407-92279429 ACATAGGGAAATTGTGCAGATGG + Intronic
1059058433 9:111008933-111008955 ACATTGGGAGAATGGGGAGTGGG + Intronic
1188570771 X:31582969-31582991 AAATAGAGAATAGAGGCAGTAGG + Intronic
1189967491 X:46389807-46389829 ATAGAGTGAATATAGGCAGTTGG - Intergenic
1193286639 X:79722465-79722487 ACTTAAAGAATATGGGAAGTGGG + Intergenic
1193564074 X:83055967-83055989 ACAATGGGAATATAGGCATTGGG + Intergenic
1193801920 X:85946693-85946715 ACATAGGGAAAATGTGGGGTCGG + Intronic
1199688542 X:150287394-150287416 ACATAATGAATTTGGGCAGGGGG - Intergenic