ID: 945642953

View in Genome Browser
Species Human (GRCh38)
Location 2:212453288-212453310
Sequence GATTTCCCATTTAAGGTCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 109}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945642949_945642953 14 Left 945642949 2:212453251-212453273 CCCTTGCAAGTCTACTTTGTAAA 0: 1
1: 0
2: 2
3: 17
4: 251
Right 945642953 2:212453288-212453310 GATTTCCCATTTAAGGTCCATGG 0: 1
1: 0
2: 0
3: 8
4: 109
945642950_945642953 13 Left 945642950 2:212453252-212453274 CCTTGCAAGTCTACTTTGTAAAG 0: 1
1: 0
2: 1
3: 10
4: 201
Right 945642953 2:212453288-212453310 GATTTCCCATTTAAGGTCCATGG 0: 1
1: 0
2: 0
3: 8
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945642953 Original CRISPR GATTTCCCATTTAAGGTCCA TGG Intronic
904513186 1:31031568-31031590 GTCTTCCCATTTAAAGTTCAAGG + Intronic
905650419 1:39652806-39652828 TACTTCCCAATTAAGGTCAATGG + Intergenic
906701492 1:47861467-47861489 TATTTTCCATTTAATGTCCATGG - Intronic
907932758 1:59015719-59015741 GATTTCCCTTTTATTCTCCAAGG - Intergenic
913054156 1:115142006-115142028 TACTTCCTCTTTAAGGTCCAGGG + Intergenic
915573450 1:156759078-156759100 GATCTCTCCTTTGAGGTCCAAGG - Intronic
920522853 1:206641686-206641708 GATTTCCTATTTAATGTGCTGGG + Intronic
1064838076 10:19557307-19557329 AATTTCCCATTTATGGTTCCTGG + Intronic
1066229484 10:33418490-33418512 CACTTCCCATTTCATGTCCAAGG + Intergenic
1066330224 10:34413654-34413676 GGTTTCCTACTTAATGTCCAAGG - Intronic
1068607587 10:59023340-59023362 GATTCCCCTTTTAAGCTTCAGGG - Intergenic
1074603494 10:114938056-114938078 AATTTTCTATTTAAAGTCCAAGG + Intergenic
1078032181 11:7764121-7764143 AGTCTCCCATTTAAGGTCCCAGG - Intergenic
1081470204 11:43362841-43362863 GAATTCCCAAATATGGTCCAGGG + Intronic
1087455272 11:98377122-98377144 GACGTCCCCTTTAAGGTCGAGGG + Intergenic
1088464895 11:110124701-110124723 AATTTCCCACTTAAGGTGAAGGG - Intronic
1090526141 11:127539650-127539672 GATTTCCTATTTGTAGTCCATGG + Intergenic
1093903983 12:24667415-24667437 CATTTCCCATAAAAGGTACAAGG + Intergenic
1094124324 12:27007014-27007036 GTTTAACCATTTAAGGTCAAAGG - Intronic
1095174015 12:39069468-39069490 GCTTTCCAATTTCAGGTTCAAGG + Intergenic
1095297536 12:40544231-40544253 GATTTCACATTTTAGTTCAAGGG + Intronic
1096145740 12:49277436-49277458 GCTTTGCTATTTAAGGTCAATGG - Intergenic
1098360014 12:69645462-69645484 GACTTACCCTTTGAGGTCCATGG - Intronic
1104586517 12:130052412-130052434 TATCTCACATTTAAGATCCAAGG - Intergenic
1105884238 13:24628302-24628324 GCTTTCTCATGTGAGGTCCAGGG - Intergenic
1107869150 13:44731093-44731115 GATTGAACATTCAAGGTCCATGG - Intergenic
1108138950 13:47397658-47397680 GATTTGCCCTTTGGGGTCCATGG - Intergenic
1109689044 13:65862094-65862116 AATTTGCCATTTAATGTCCCAGG - Intergenic
1111748673 13:92299000-92299022 GATTTCCAATTTCAGATTCACGG - Intronic
1111913221 13:94334790-94334812 GATTTCCGATGGAAGGTCCAGGG - Intronic
1113187633 13:107707459-107707481 GAATTTCCATTTCAGTTCCAAGG - Intronic
1115212119 14:30977846-30977868 TATTTTCCTTTTAATGTCCATGG - Intronic
1116321992 14:43479610-43479632 GATTTCCCCTTTAAAGTGAAAGG - Intergenic
1117786556 14:59291901-59291923 CACTTCCCATTTAAGATCTAGGG + Intronic
1118519995 14:66572223-66572245 GTTTTCCTATTTAAGGTCTTTGG + Intronic
1120351734 14:83369610-83369632 GATTTCCAATTATAGGTCTAGGG + Intergenic
1120360917 14:83500875-83500897 GAATTGCCATTCATGGTCCAGGG - Intergenic
1126016505 15:44356410-44356432 TATTTTCCTTTTAATGTCCATGG - Intronic
1138297507 16:55899593-55899615 GATTCTCCTTTGAAGGTCCATGG - Intronic
1138839354 16:60480339-60480361 GATATCCCATTTAAGCCTCATGG - Intergenic
1143121810 17:4612614-4612636 TATTTCCCAATGAAGGTCCAGGG + Intergenic
1144432099 17:15202251-15202273 GATTTAAAATTTAAGGTTCAAGG + Intergenic
1145766899 17:27464389-27464411 GATTTCCCACCTAATTTCCAGGG - Intronic
1146069586 17:29667913-29667935 GATTTCATATTAAAGTTCCAAGG - Intronic
1150694242 17:67390471-67390493 GATTTCCCATTCAATGCTCACGG - Intronic
1151086661 17:71388208-71388230 GGTTTCCCCTTCCAGGTCCAGGG - Intergenic
1154208560 18:12359104-12359126 GAATTCCCAAATAAGCTCCATGG + Intronic
1155416888 18:25607817-25607839 GTTATCCCATTTCAGGTCCAGGG + Intergenic
1164651225 19:29892263-29892285 GATTTCCCCTTTATACTCCAAGG - Intergenic
1168451551 19:56470425-56470447 GATTTGCCATTCAAGGTTAAAGG - Intronic
936076788 2:109406364-109406386 GACTGCCCATTTAGGGTCCTCGG - Intronic
936340309 2:111625619-111625641 GATTTTACATATAATGTCCAGGG - Intergenic
936922257 2:117701164-117701186 GATTGCCAACTGAAGGTCCATGG + Intergenic
938164509 2:129015071-129015093 GTTTTCCCATTTAAGGTCAGTGG + Intergenic
940503752 2:154527201-154527223 GATGTTCCTTTTAAGGCCCAAGG + Intergenic
940637054 2:156310062-156310084 GAACTCCCATTGAGGGTCCAGGG - Intergenic
941032841 2:160532596-160532618 GACTTAGCATTTAAAGTCCAAGG + Intergenic
945642953 2:212453288-212453310 GATTTCCCATTTAAGGTCCATGG + Intronic
948029513 2:234805508-234805530 GATTCTCCATTTAAGGTTGAAGG + Intergenic
948672288 2:239576211-239576233 GATTCCCCAGTGAAGCTCCAGGG - Intergenic
1169832548 20:9839675-9839697 GATTTCGAATTTAAGGCCCAGGG + Intergenic
1173173706 20:40748067-40748089 GATTTCCTATTCCAGTTCCATGG - Intergenic
1175853969 20:62109609-62109631 AATTTCCCATTGAAGGTGCCTGG - Intergenic
1179301995 21:40120497-40120519 GATAACCCTTTTAAGGTCCCAGG - Intronic
951705036 3:25535751-25535773 TATTTCCCATTTAAGAGACAAGG - Intronic
953229867 3:41055176-41055198 GATTTCTGATTTAGGGCCCAGGG + Intergenic
953511900 3:43550104-43550126 GTATTCCCAATTCAGGTCCAGGG - Intronic
953837464 3:46359269-46359291 GATTTCAAATGTAAGGTGCATGG - Intronic
956226582 3:66965914-66965936 GATTAACCATTTAAGATCAAAGG + Intergenic
961931833 3:130541969-130541991 GATTAGCCTTTTAATGTCCATGG + Intergenic
963104128 3:141631010-141631032 GTTTACCCATTTTAGGTTCATGG - Intergenic
963146255 3:141998298-141998320 GATTTCAAAATTAAGGTTCAGGG - Intronic
963399264 3:144776839-144776861 GATTGCAAACTTAAGGTCCATGG + Intergenic
969539365 4:7777244-7777266 GATTTGCCAGATAAGGTCAAAGG + Intronic
969911038 4:10446622-10446644 GATTTACCATAAAATGTCCAAGG - Intronic
969925123 4:10578101-10578123 GATTTCCCACCTAAATTCCATGG - Intronic
976386873 4:84470272-84470294 TATTTCTCATTTAAAGTTCAGGG + Intergenic
978526110 4:109667393-109667415 TATTTTCCTTTTAATGTCCATGG + Intronic
978658239 4:111092423-111092445 CATTATCCATTTAATGTCCATGG - Intergenic
979812807 4:125060710-125060732 TATTTCCAATTTAATGGCCAGGG - Intergenic
980953039 4:139400509-139400531 GATTTCCAAATTCAGTTCCATGG - Intronic
981666510 4:147233127-147233149 GATTTCCCATTTAATGTTTTTGG - Intergenic
983401786 4:167275325-167275347 GATTTTCCATTTGAGGTAAATGG - Intergenic
983426766 4:167594513-167594535 GATTTCCTATCTGAGGACCAAGG + Intergenic
994737421 5:103572267-103572289 GATTTCTCACTCAAAGTCCATGG - Intergenic
995074288 5:107963309-107963331 CATTTCCCATTTTGGGACCAGGG - Intronic
997406439 5:133652063-133652085 GATTATCCTTTTAATGTCCATGG + Intergenic
998488141 5:142521649-142521671 GATTTCCCATCTCAAGTCAAAGG - Intergenic
1000679917 5:164170833-164170855 CATTTCCCATATCAGGTCCTGGG - Intergenic
1001339999 5:170834346-170834368 GTTTTCCCATTTTAGAGCCATGG - Intergenic
1002371139 5:178755856-178755878 GTTTTCCCATTTTAGAGCCATGG + Intergenic
1008803229 6:55395888-55395910 GATTTCCCATCAAATGTACAAGG + Intronic
1011882674 6:92050241-92050263 GATTTCCCATTTGAGGATCAAGG + Intergenic
1013810925 6:114043624-114043646 GGTTTCCTATTTATGGTCCAAGG + Intergenic
1014660835 6:124169699-124169721 GATTTTCCATTCAAAGTGCATGG - Intronic
1014754261 6:125285968-125285990 GATTTAAGATTTAAGGTCCCGGG - Intronic
1015656945 6:135529673-135529695 GATTACCCAGTTCAGGTCCCCGG - Intergenic
1016128060 6:140430824-140430846 GATTTTCCTTTTAATGTTCATGG + Intergenic
1016776174 6:147907187-147907209 GGTTTCCCACTTAAGATCCCGGG + Intergenic
1022043650 7:26604535-26604557 GTTTTCCCTTCTAAGATCCAGGG + Intergenic
1028274580 7:88838679-88838701 GATTTGACATTTTAGGGCCATGG + Intronic
1029381225 7:100216096-100216118 GTTTTCCCAGCTGAGGTCCAGGG + Intronic
1031913436 7:127540992-127541014 GATGTCCTATTAAATGTCCATGG + Intergenic
1038400343 8:27279726-27279748 GATTTCCCCTATAAAGCCCATGG - Intergenic
1041330716 8:56720756-56720778 AATTTCCCAATTAATTTCCAGGG - Intergenic
1044495990 8:92883502-92883524 CATTTACCATTTATGGTCCTTGG - Intergenic
1046969116 8:120201515-120201537 TATTGCCCATTTAAATTCCAGGG - Intronic
1051570160 9:18547405-18547427 TATTTTCCATTTTTGGTCCATGG - Intronic
1057498157 9:95576241-95576263 GATTTCAGATTCAAGGTGCAGGG - Intergenic
1060385109 9:123218693-123218715 AATTTCCTATATAAGGTGCAGGG + Intronic
1186155322 X:6719335-6719357 AATTACCTCTTTAAGGTCCAAGG + Intergenic
1187041475 X:15600646-15600668 GATTTCCCTTTTCAGTTTCACGG + Intronic
1188347303 X:29082589-29082611 AATTTTCAATTTAAGGTGCATGG - Intronic
1192307063 X:69972581-69972603 GGTTTCACATTTAAGGACCTGGG + Intronic
1194990778 X:100544330-100544352 GAGTTCCCATTTGAGAGCCAGGG - Intergenic
1198010430 X:132547379-132547401 AAATTCCCATTTGATGTCCAAGG - Intergenic
1198295789 X:135285020-135285042 AATTTCCCATTTTAGTTTCAAGG + Intronic
1199968982 X:152844684-152844706 CATATCCCATCTAAGGTGCAGGG - Intronic