ID: 945650380

View in Genome Browser
Species Human (GRCh38)
Location 2:212551259-212551281
Sequence ATGTTTCATCCTAATGAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945650378_945650380 4 Left 945650378 2:212551232-212551254 CCAGCGATATTACATTATATTCC No data
Right 945650380 2:212551259-212551281 ATGTTTCATCCTAATGAAAGAGG No data
945650377_945650380 5 Left 945650377 2:212551231-212551253 CCCAGCGATATTACATTATATTC No data
Right 945650380 2:212551259-212551281 ATGTTTCATCCTAATGAAAGAGG No data
945650376_945650380 27 Left 945650376 2:212551209-212551231 CCACTGTGGACGTTGTCTTCAGC No data
Right 945650380 2:212551259-212551281 ATGTTTCATCCTAATGAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945650380 Original CRISPR ATGTTTCATCCTAATGAAAG AGG Intergenic
No off target data available for this crispr