ID: 945650405

View in Genome Browser
Species Human (GRCh38)
Location 2:212551598-212551620
Sequence GCCATTTATAAGCCAGAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945650405_945650415 27 Left 945650405 2:212551598-212551620 CCACTTTCTGGCTTATAAATGGC No data
Right 945650415 2:212551648-212551670 GAAGGGGCAAGGCAGCTCTCTGG 0: 44
1: 130
2: 301
3: 527
4: 909
945650405_945650416 28 Left 945650405 2:212551598-212551620 CCACTTTCTGGCTTATAAATGGC No data
Right 945650416 2:212551649-212551671 AAGGGGCAAGGCAGCTCTCTGGG 0: 39
1: 138
2: 321
3: 551
4: 893
945650405_945650417 29 Left 945650405 2:212551598-212551620 CCACTTTCTGGCTTATAAATGGC No data
Right 945650417 2:212551650-212551672 AGGGGCAAGGCAGCTCTCTGGGG 0: 37
1: 138
2: 295
3: 526
4: 998
945650405_945650412 16 Left 945650405 2:212551598-212551620 CCACTTTCTGGCTTATAAATGGC No data
Right 945650412 2:212551637-212551659 CTCCCATGATAGAAGGGGCAAGG No data
945650405_945650410 11 Left 945650405 2:212551598-212551620 CCACTTTCTGGCTTATAAATGGC No data
Right 945650410 2:212551632-212551654 ATAACCTCCCATGATAGAAGGGG No data
945650405_945650408 9 Left 945650405 2:212551598-212551620 CCACTTTCTGGCTTATAAATGGC No data
Right 945650408 2:212551630-212551652 TTATAACCTCCCATGATAGAAGG No data
945650405_945650409 10 Left 945650405 2:212551598-212551620 CCACTTTCTGGCTTATAAATGGC No data
Right 945650409 2:212551631-212551653 TATAACCTCCCATGATAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945650405 Original CRISPR GCCATTTATAAGCCAGAAAG TGG (reversed) Intergenic
No off target data available for this crispr