ID: 945650406

View in Genome Browser
Species Human (GRCh38)
Location 2:212551622-212551644
Sequence CATGGGAGGTTATAACAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945650406_945650417 5 Left 945650406 2:212551622-212551644 CCTTCCTGTTATAACCTCCCATG No data
Right 945650417 2:212551650-212551672 AGGGGCAAGGCAGCTCTCTGGGG 0: 37
1: 138
2: 295
3: 526
4: 998
945650406_945650415 3 Left 945650406 2:212551622-212551644 CCTTCCTGTTATAACCTCCCATG No data
Right 945650415 2:212551648-212551670 GAAGGGGCAAGGCAGCTCTCTGG 0: 44
1: 130
2: 301
3: 527
4: 909
945650406_945650412 -8 Left 945650406 2:212551622-212551644 CCTTCCTGTTATAACCTCCCATG No data
Right 945650412 2:212551637-212551659 CTCCCATGATAGAAGGGGCAAGG No data
945650406_945650416 4 Left 945650406 2:212551622-212551644 CCTTCCTGTTATAACCTCCCATG No data
Right 945650416 2:212551649-212551671 AAGGGGCAAGGCAGCTCTCTGGG 0: 39
1: 138
2: 321
3: 551
4: 893

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945650406 Original CRISPR CATGGGAGGTTATAACAGGA AGG (reversed) Intergenic
No off target data available for this crispr