ID: 945650412

View in Genome Browser
Species Human (GRCh38)
Location 2:212551637-212551659
Sequence CTCCCATGATAGAAGGGGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945650406_945650412 -8 Left 945650406 2:212551622-212551644 CCTTCCTGTTATAACCTCCCATG No data
Right 945650412 2:212551637-212551659 CTCCCATGATAGAAGGGGCAAGG No data
945650405_945650412 16 Left 945650405 2:212551598-212551620 CCACTTTCTGGCTTATAAATGGC No data
Right 945650412 2:212551637-212551659 CTCCCATGATAGAAGGGGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945650412 Original CRISPR CTCCCATGATAGAAGGGGCA AGG Intergenic
No off target data available for this crispr