ID: 945655000

View in Genome Browser
Species Human (GRCh38)
Location 2:212612315-212612337
Sequence CACCCCTTCAGCCCTAGTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945654995_945655000 24 Left 945654995 2:212612268-212612290 CCTCTCCTCCAAGCTTCTAAATT No data
Right 945655000 2:212612315-212612337 CACCCCTTCAGCCCTAGTGGTGG No data
945654996_945655000 19 Left 945654996 2:212612273-212612295 CCTCCAAGCTTCTAAATTTCAAT No data
Right 945655000 2:212612315-212612337 CACCCCTTCAGCCCTAGTGGTGG No data
945654997_945655000 16 Left 945654997 2:212612276-212612298 CCAAGCTTCTAAATTTCAATAAT No data
Right 945655000 2:212612315-212612337 CACCCCTTCAGCCCTAGTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945655000 Original CRISPR CACCCCTTCAGCCCTAGTGG TGG Intergenic
No off target data available for this crispr