ID: 945657123

View in Genome Browser
Species Human (GRCh38)
Location 2:212638208-212638230
Sequence TCCCCAGGAAACTTCCATAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945657116_945657123 13 Left 945657116 2:212638172-212638194 CCCAAGCTGTTCGTCCAGCCTTG No data
Right 945657123 2:212638208-212638230 TCCCCAGGAAACTTCCATACCGG No data
945657117_945657123 12 Left 945657117 2:212638173-212638195 CCAAGCTGTTCGTCCAGCCTTGC No data
Right 945657123 2:212638208-212638230 TCCCCAGGAAACTTCCATACCGG No data
945657121_945657123 -10 Left 945657121 2:212638195-212638217 CCTTGTCTTGCCTTCCCCAGGAA No data
Right 945657123 2:212638208-212638230 TCCCCAGGAAACTTCCATACCGG No data
945657118_945657123 -1 Left 945657118 2:212638186-212638208 CCAGCCTTGCCTTGTCTTGCCTT No data
Right 945657123 2:212638208-212638230 TCCCCAGGAAACTTCCATACCGG No data
945657119_945657123 -5 Left 945657119 2:212638190-212638212 CCTTGCCTTGTCTTGCCTTCCCC No data
Right 945657123 2:212638208-212638230 TCCCCAGGAAACTTCCATACCGG No data
945657115_945657123 22 Left 945657115 2:212638163-212638185 CCAGCTAATCCCAAGCTGTTCGT No data
Right 945657123 2:212638208-212638230 TCCCCAGGAAACTTCCATACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945657123 Original CRISPR TCCCCAGGAAACTTCCATAC CGG Intergenic
No off target data available for this crispr