ID: 945659724

View in Genome Browser
Species Human (GRCh38)
Location 2:212671022-212671044
Sequence CATTATAGGCAGTGAATGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945659724_945659730 11 Left 945659724 2:212671022-212671044 CCTTCCATTCACTGCCTATAATG No data
Right 945659730 2:212671056-212671078 GAAAAAAGCTACTCTTCATCTGG No data
945659724_945659731 20 Left 945659724 2:212671022-212671044 CCTTCCATTCACTGCCTATAATG No data
Right 945659731 2:212671065-212671087 TACTCTTCATCTGGAATTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945659724 Original CRISPR CATTATAGGCAGTGAATGGA AGG (reversed) Intergenic
No off target data available for this crispr