ID: 945660891

View in Genome Browser
Species Human (GRCh38)
Location 2:212683960-212683982
Sequence CAAGGCAAACACCCTGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945660887_945660891 22 Left 945660887 2:212683915-212683937 CCTGTAGCCATACAAAAGGAAGT No data
Right 945660891 2:212683960-212683982 CAAGGCAAACACCCTGAGGCAGG No data
945660888_945660891 15 Left 945660888 2:212683922-212683944 CCATACAAAAGGAAGTAGAAGCG No data
Right 945660891 2:212683960-212683982 CAAGGCAAACACCCTGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945660891 Original CRISPR CAAGGCAAACACCCTGAGGC AGG Intergenic
No off target data available for this crispr