ID: 945660899

View in Genome Browser
Species Human (GRCh38)
Location 2:212683985-212684007
Sequence GGAAGGGACCAACAGGGACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945660896_945660899 -10 Left 945660896 2:212683972-212683994 CCTGAGGCAGGCAGGAAGGGACC No data
Right 945660899 2:212683985-212684007 GGAAGGGACCAACAGGGACCAGG No data
945660895_945660899 -9 Left 945660895 2:212683971-212683993 CCCTGAGGCAGGCAGGAAGGGAC No data
Right 945660899 2:212683985-212684007 GGAAGGGACCAACAGGGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945660899 Original CRISPR GGAAGGGACCAACAGGGACC AGG Intergenic
No off target data available for this crispr