ID: 945662459

View in Genome Browser
Species Human (GRCh38)
Location 2:212703044-212703066
Sequence GCACATAGAAAATATAAACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945662457_945662459 20 Left 945662457 2:212703001-212703023 CCATGTATAGGTTTTCAGATATG No data
Right 945662459 2:212703044-212703066 GCACATAGAAAATATAAACTTGG No data
945662458_945662459 -7 Left 945662458 2:212703028-212703050 CCTGCTAACAAGTCATGCACATA No data
Right 945662459 2:212703044-212703066 GCACATAGAAAATATAAACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945662459 Original CRISPR GCACATAGAAAATATAAACT TGG Intergenic
No off target data available for this crispr