ID: 945668260

View in Genome Browser
Species Human (GRCh38)
Location 2:212769215-212769237
Sequence ATAAAGCACCTGTACAACTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945668259_945668260 15 Left 945668259 2:212769177-212769199 CCTGTAAGATTTTCTTTTAGTAT No data
Right 945668260 2:212769215-212769237 ATAAAGCACCTGTACAACTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945668260 Original CRISPR ATAAAGCACCTGTACAACTT TGG Intergenic
No off target data available for this crispr